Clinical Cancer Research Joint Metastasis Research Society-AACR Conference on Metastasis Translational Cancer Medicine 2008: Cancer Clinical Trials and Personalized Medicine
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schag, K.
Right arrow Articles by Brossart, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schag, K.
Right arrow Articles by Brossart, P.
Clinical Cancer Research Vol. 10, 3658-3666, June 1, 2004
© 2004 American Association for Cancer Research

Molecular Oncology, Markers, Clinical Correlates

Identification of C-Met Oncogene as a Broadly Expressed Tumor-Associated Antigen Recognized by Cytotoxic T-Lymphocytes

Kerstin Schag1, Susanne M. Schmidt1, Martin R. Müller1, Toni Weinschenk2, Silke Appel1, Markus M. Weck1, Frank Grünebach1, Stefan Stevanovic2, Hans-Georg Rammensee2 and Peter Brossart1

1 Department of Hematology, Oncology and Immunology, University of Tübingen, and 2 Department of Immunology, Institute for Cell Biology, Tübingen, Germany

ABSTRACT

Purpose: C-Met proto-oncogene is a receptor tyrosine kinase that mediates the oncogenic activities of the hepatocyte growth factor. Using a DNA chip analysis of tumor samples from patients with renal cell carcinoma and sequencing of peptides bound to the HLA-A*0201 molecules on tumor cells a peptide derived from the c-Met protein was identified recently.

Experimental Design: We used this novel HLA-A*0201 peptide for the induction of specific CTLs to analyze the presentation of this epitope by malignant cells.

Results: The induced CTL efficiently lysed target cells pulsed with the cognate peptide, as well as HLA-A*0201-matched tumor cell lines in an antigen-specific and HLA-restricted manner. Furthermore, the induced c-Met-specific CTLs recognized autologous dendritic cells (DCs) pulsed with the peptide or transfected with whole-tumor mRNA purified from c-Met-expressing cell lines. We next induced c-Met-specific CTLs using peripheral blood mononuclear cells and DC from an HLA-A*0201-positive patient with plasma cell leukemia to determine the recognition of primary autologous malignant cells. These CTLs lysed malignant plasma cells while sparing nonmalignant B- and T-lymphocytes, monocytes, and DCs.

Conclusion: Our results demonstrate that c-Met oncogene is a novel tumor rejection antigen recognized by CTL and expressed on a broad variety of epithelial and hematopoietic malignant cells.

INTRODUCTION

C-Met encodes a heterodimeric transmembranous receptor with tyrosine kinase activity that is composed of an {alpha} chain that is disulfide-linked to a ß subunit (1 , 2) . Both subunits are expressed on the surface; the heavy ß subunit is responsible for the binding of the ligand, hepatocyte growth factor (HGF), and the {alpha} subunit contains an intracellular domain that mediates the activation of different signal transduction pathways. Met signaling is involved in organ regeneration, as demonstrated for liver and kidney, embryogenesis, hematopoiesis, muscle development, and in the regulation of migration and adhesion of normally activated B cells and monocytes. Furthermore, numerous studies indicated the involvement of c-Met overexpression in malignant transformation and invasiveness of malignant cells (3, 4, 5, 6, 7, 8, 9, 10, 11, 12) .

Using an integrated functional genomics approach that combines gene expression profiling with analysis of MHC ligands by mass spectrometry to identify genes and corresponding MHC ligands that are selectively expressed or overexpressed in malignant tissues an HLA-A*0201-presented peptide derived from the c-Met proto-oncogene could be identified (13) . In the present study we analyzed the possible function of this peptide as a T-cell epitope and its presentation by malignant cells using antigen-specific CTLs that were generated by in vitro priming with monocyte-derived dendritic cells (DCs) as antigen presenting cells. We show here that the CTLs generated from several healthy donors elicited an antigen-specific and HLA-A*0201-restricted cytolytic activity against tumor cells endogenously expressing the c-Met protein including renal cell carcinomas, breast cancer, colon cancer, melanoma, and multiple myeloma cells. Furthermore, they lysed autologous DCs pulsed with the antigenic peptide or electroporated with RNA isolated from c-Met-expressing tumor cell lines and primary autologous malignant plasma cells while sparing nonmalignant B- and T-lymphocytes, monocytes, DCs, and bone marrow-derived or mobilized CD34+ hematopoietic cells. Our results demonstrate that c-Met oncogene is a tumor rejection antigen recognized by CTLs and expressed on a broad variety of epithelial and hematopoietic malignancies.

MATERIALS AND METHODS

Tumor Cell Lines.
Tumor cell lines used in the experiments were grown in RP10 medium (RPMI 1640 supplemented with 10% heat inactivated FCS and antibiotics). The following c-Met-expressing tumor cell lines were used in experiments: MCF-7 (breast cancer, HLA-A*0201+, purchased from American Type Culture Collection), A498 (renal cell carcinoma, HLA-A*0201+) and MZ1257 (renal cell carcinoma, HLA-A*0201+, kindly provided by Prof. Alexander Knuth, Frankfurt, Germany), U266 (multiple myeloma, HLA-A*0201+), HCT116 (colon cancer, HLA-A*0201+), Mel1479 (malignant melanoma, HLA-A*0201+, kindly provided by Prof. Graham Pawelec, University of Tübin, Tübingen, Germany), and SK-OV-3 (ovarian cell line, HLA-A*03+, kindly provided by O. J. Finn, Pittsburgh, PA). The c-Met-negative cell lines T2 (HLA-A*0201+, TAP-deficient) and Croft (EBV-immortalized B-cell line, kindly donated by O. J. Finn, Pittsburgh, PA, HLA-A*0201+) were used as controls. K562 cells were used to determine the natural killer-cell activity.

Cell Isolation and Generation of DC from Adherent Peripheral Blood Mononuclear Cells (PBMNC).
Generation of DCs from peripheral blood monocytes was performed as described previously (14) . In brief, PBMNCs were isolated by Ficoll/Paque (Biochrom, Berlin, Germany) density gradient centrifugation of blood obtained from buffy coat preparations of healthy donors from the blood bank of the University of Tübingen. Cells were seeded (1 x 107 cells/3 ml/well) into six-well plates (BD Falcon, Heidelberg, Germany) in RP10 medium. After 2 h of incubation at 37°C and 5% CO2, nonadherent cells were removed, and the adherent blood monocytes were cultured in RP10 medium supplemented with the following cytokines: human recombinant granulocyte macrophage colony-stimulating factor (Leukomax, Novartis; 100 ng/ml), interleukin 4 (R&D, Wiesbaden, Germany; 20 ng/ml), and tumor necrosis factor {alpha} (R&D; 10 ng/ml). The phenotype of DCs was analyzed by flow cytometry after 7 days of culture (data not shown).

Mobilized CD34+ hematopoietic progenitor cells, B- and T-lymphocytes, as well as monocytes were isolated from peripheral blood using magnetic cell sorting technology. Activation of B and T cells was performed as described recently (15) . Monocytes were grown in RP10 medium with granulocyte macrophage colony-stimulating factor (Leukomax; Novartis; 100 ng/ml) overnight before being used as targets. Bone marrow cells and CD34+ progenitor cells were incubated for 24–48 h with stem cell factor (SCF; R&D; 100 ng/ml).

Reverse Transcription-PCR (RT-PCR).
RT-PCR was performed with some modifications as described recently (14) . Total RNA was isolated from cell lysates using Qiagen RNeasy "Mini" anion-exchange spin columns (Qiagen GmbH, Hilden, Germany) according to the instructions of the manufacturer and was subjected to a 20-µl cDNA synthesis reaction (Invitrogen, Karlsruhe, Germany). Oligodeoxythymidylic acid was used as primer. One µl of cDNA was used for PCR amplification in a volume of 15 µl. To control the integrity of the RNA and the efficiency of the cDNA synthesis, 1 µl of cDNA was amplified by an intron-spanning primer pair for the ß2-microglobulin gene. The PCR temperature profiles were as follows: 2 min pretreatment at 94°C and 30 cycles at 94°C for 30 s, annealing at 59°C for 30 s and 72°C for 60 s for the c-Met and ß2-microglobulin cDNA. Primer sequences were deduced from published cDNA sequences: ß2-microglobulin: 5' GGGTTTCATCCATCCGACAT 3' and 5' GATGCTGCTTACATGTCTCGA 3', c-Met: 5' AGTCAAGGTTGCTGATTTTGGT 3' and 5' ATGTGCTCCCCAATGAAAGTAGA 3'. Three to 5 µl of the RT-PCR reactions were electrophoresed through a 2.5% agarose gel and stained with ethidium bromide for visualization under UV light.

Induction of Antigen-Specific CTL Response Using HLA-A*0201-Restricted Synthetic Peptides.
The HLA-A*0201 binding peptides derived from c-Met (YVDPVITSI, amino acids 654–662; Ref. 13 ), adipophilin (SVASTITGV; Ref. 13 ), survivin (ELTLGEFLKL; Ref. 16 ), and HIV (ILKEPVHGV, pol HIV-1 reverse transcriptase peptide, amino acids 476–484) were synthesized using standard F-moc chemistry on a peptide synthesizer (432A; Applied Biosystems, Weiterstadt, Germany) and analyzed by reversed-phase high-performance liquid chromatography and mass spectrometry.

For CTL induction, 5 x 105 DCs were pulsed with 50 µg/ml of the synthetic c-Met peptide for 2 h, washed, and incubated with 2.5 x 106 autologous PBMNC in RP10 medium. After 7 days of culture, cells were restimulated with autologous peptide-pulsed PBMNC, and 2 ng/ml human recombinant interleukin 2 (R&D Systems) was added on days 1, 3, and 5. The cytolytic activity of induced CTL was analyzed on day 5 after the last restimulation in a standard 51Cr-release assay.

CTL Assay.
The standard 51Cr release assay was performed as described (14) . Target cells were pulsed with 50 µg/ml peptide for 2 h and labeled with [51Cr]sodium chromate in RP10 for 1 h at 37°C. Cells (104) were transferred to a well of a round-bottomed 96-well plate. Varying numbers of CTLs were added to give a final volume of 200 µl and incubated for 4 h at 37°C. At the end of the assay supernatants (50 µl/well) were harvested and counted in a ß-plate counter. The percentage of specific lysis was calculated as: 100 x (experimental release – spontaneous release/maximal release – spontaneous release). Spontaneous and maximal release were determined in the presence of either medium or 2% Triton X-100, respectively.

Antigen specificity of tumor cell lysis was additionally determined in a cold target inhibition assay (14) by analyzing the capacity of peptide-pulsed unlabeled T2 cells to block lysis of tumor cells at a ratio of 20:1 (inhibitor:target ratio).

IFN-{gamma} Enzyme-Linked Immunospot Assay.
C-Met-specific CTLs were generated in vitro using autologous DCs pulsed with the c-Met peptide. These CTLs were incubated at a concentration of 2 x 105 cells/well in a 96-well plate coated with antihuman IFN-{gamma} antibody (mAb 1-D1K, 10 µg/ml; Mabtech AB, Hamburg, Germany) together with autologous PBMNCs pulsed for 1 h with the HLA-A2 binding peptides derived from the tumor antigens c-Met or adipophilin. For the detection of spots, a biotin-labeled antihuman IFN-{gamma} antibody (Mab 7-B6–1-Biotin, 2 µg/ml; Mabtech AB) was used. Spots were counted after 40–44 h incubation using an automated enzyme-linked immunospot reader (IMMUNOSPOT ANALYZER; CTL Analyzers LLC, Cleveland, OH).

Peptide Titration.
C-Met-specific CTLs were generated as described above. For peptide titration, T2 cells were incubated with titrated amounts (10–10–7 µM) of the c-Met peptide. Corresponding specific CTLs were added to the target cells incubated with the cognate peptide at a ratio of 10:1.

PAGE and Western Blotting.
Cells were lysed in buffer containing 1% Igepal, 50 mM HEPES (pH 7.5), 150 mM NaCl, 2 mM EDTA, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, and 2 µg/ml aprotinin. Protein concentration of cell lysates were determined using a BCA assay (Pierce, Rockford, IL). Six to 30 µg of total protein were separated on a 7.5–9% polyacrylamide gel, blotted on nitrocellulose membrane, and probed with a c-Met-specific polyclonal antibody (h-Met, clone C-28, sc-161, polyclonal rabbit; Santa Cruz Biotechnology, Heidelberg, Germany). To ensure equal loading of the gel, the blots were reprobed using a polyclonal actin antibody (clone I-19; Santa Cruz Biotechnology) or a monoclonal glyceraldehyde-3-phosphate dehydrogenase antibody (clone 6C5; HyTest, Turku, Finland). Bands were visualized by enhanced chemiluminescence staining (Amersham Pharmacia, Freiburg, Germany).

Electroporation of DCs with Whole Tumor-Derived RNA.
Total RNA was isolated from tumor cell lysates using RNeasy Maxi anion-exchange spin columns (Qiagen GmbH) according to the protocol for isolation of total RNA from animal cells provided by the manufacturer. Quantity and purity of RNA were determined by UV spectrophotometry. Before electroporation on day 6, immature DCs (grown in RP10 medium in the presence of interleukin 4 and granulocyte macrophage colony-stimulating factor) were washed twice with serum-free X-VIVO 20 medium (BioWhittaker, Apen, Germany) and resuspended to a final concentration of 2 x 107 cells/ml. Subsequently, 200 µl of the cell suspension were mixed with 10 µg of total RNA and electroporated in a 4 mm cuvette using an Easyject Plus unit (Peqlab, Erlangen, Germany). The physical parameters were: voltage of 300 V, capacitance of 150 µF, resistance of 1540 {Omega}, and pulse time of 231 ms (17) . After electroporation the cells were immediately transferred into RP10 medium and returned to the incubator.

RESULTS

Induction of c-Met-Specific CTLs Using Peptide-Pulsed DCs.
C-Met proto-oncogene was shown to be overexpressed in a variety of malignant cells of epithelial and hematopoietic origin and to be involved in the malignant phenotype and invasiveness of these cells (3 , 18, 19, 20) . As demonstrated in Fig. 1Citation , expression of c-Met mRNA and protein could be detected in several tested human tumor cell lines including malignant melanoma, renal cell carcinoma, and multiple myeloma.



View larger version (33K):
[in this window]
[in a new window]
  		Fig. 1. C-Met expression in human tumor cell lines. The expression of c-Met mRNA was analyzed in human tumor cell lines by reverse transcription-PCR (A). Total RNA was subjected to cDNA synthesis. PCR products were run on a 2.5% agarose gel and visualized by ethidium bromide staining. Amplification of ß2-microglobulin was performed as control. Western blot analysis using a c-Met-specific polyclonal antibody was performed to determine the protein expression (B). To ensure equal loading of the gel, the blot was reprobed using a polyclonal actin antibody. The following cell lines showed to be c-Met positive: A498 (renal cell carcinoma, HLA-A*0201+), MZ1257 (renal cell carcinoma, HLA-A*0201+), U266 (multiple myeloma, HLA-A*0201+), Mel1479 (malignant melanoma, HLA-A*0201+), and K562 cells. T2 (HLA-A*0201+, TAP-deficient) and Croft (EBV-immortalized B-cell line, HLA-A*0201+) are c-Met negative.

 
Comparative analysis of gene expression profiling of a tumor sample derived from a patient with renal cell carcinoma and the corresponding autologous renal tissue was performed using DNA microarray technology followed by the characterization of MHC ligands present in the tumor by mass spectrometry. This resulted in the identification of an HLA-A*0201-presented peptide derived from the c-Met protein (YVDPVITSI, amino acids 654–662; Ref. 13 ).

To analyze the presentation of this epitope by tumor cells and its recognition by CTLs we induced c-Met-specific CTLs in vitro using DCs derived from adherent PBMNCs of HLA-A*0201-positive healthy donors. These monocyte-derived DCs were pulsed with the HLA-A*0201 binding c-Met peptide and used as antigen presenting cells for in vitro priming. Using this approach c-Met-specific CTLs were generated in 8 of 9 healthy donors. The cytotoxicity of the induced CTL was analyzed in a standard 51Cr release assay using peptide-loaded T2 cells and autologous DCs as targets. As shown in Fig. 2Citation , the CTL line obtained after several restimulations demonstrated antigenspecific killing. The T cells only recognized T2 cells (Fig. 2A)Citation or DCs (Fig. 2B)Citation coated with the cognate peptide, whereas they did not lyse target cells pulsed with irrelevant HLA-A*0201 binding peptides derived from survivin protein or HIV-1 reverse transcriptase confirming the specificity of the cytolytic activity.



View larger version (32K):
[in this window]
[in a new window]
  		Fig. 2. Induction of c-Met-specific CTL responses in vitro using peptide-pulsed dendritic cells (DC) as antigen presenting cells. DCs generated from adherent peripheral blood mononuclear cells in the presence of granulocyte macrophage colony-stimulating factor, interleukin 4, and tumor necrosis factor {alpha} were pulsed with the synthetic peptide derived from the c-Met protein and used for CTL induction. Cytotoxic activity of induced CTL was analyzed in a standard 51Cr release assay using T2 cells (A) or autologous DCs (B) pulsed with the cognate c-Met peptide (closed symbols) or an irrelevant peptide (HIV or survivin, open symbols) as targets. To analyze the avidity of the induced CTL lines, T2 cells were incubated with titrated amounts of the synthetic peptide, and effector cells were added after a preincubation time of 1 h at an E:T ratio of 10:1 (C). To analyze the antigen-specific secretion of IFN-{gamma} by the in vitro-induced CTL an enzyme-linked immunospot assay was performed (D). The HLA-A2-binding adipophilin peptide was used as a negative control in this experiment.

 
To analyze the avidity of the induced CTL lines T2 cells were incubated with titrated amounts of the synthetic peptide, and effector cells were added after a preincubation time of 1 h at an E:T ratio of 10:1. As shown in Fig. 2CCitation , the c-Met-specific CTL lysed the target cells in an antigen concentration-depending fashion with a sensitivity that ranged from 10 µM to 100 pM. To additionally characterize the effector functions of the c-Met-specific CTL we analyzed the secretion of cytokines using an enzyme-linked immunospot assay. The stimulation of the CTL resulted in an antigen-specific production of IFN-{gamma} as demonstrated in Fig. 2DCitation .

To determine the frequency of c-Met-reactive T cells we performed enzyme-linked immunospot assays using peripheral blood from healthy donors and 2 patients with malignant diseases (chronic lymphocytic leukemia and plasma cell leukemia). C-Met-specific T cells could be detected only in 2 of 10 healthy donors with 31 and 65 spots when 2 x 106 PBMNCs were used in the analysis (data not shown).

C-Met Peptide-Specific CTLs Efficiently Recognize Tumor Cells Endogenously Expressing the c-Met Proto-Oncogene.
We next analyzed the ability of the in vitro induced CTL to lyse tumor cells that express the c-Met protein. We used the HLA-A*0201-positive cell lines HCT116 (colon cancer), A498, MZ1257 (renal cell carcinoma), MCF-7 (breast cancer), Mel1479 (malignant melanoma), and U266 (multiple myeloma) that express c-Met as targets in a standard 51Cr release assay. The EBV-transformed B-cell line Croft (HLA-A*0201+/c-Met–) and the ovarian cancer cell line SK-OV-3 (HLA-A3+/c-Met+) were included to determine the specificity and HLA-restriction of the CTL. As demonstrated in Fig. 3, A–DCitation , the c-Met peptide-specific CTLs were able to efficiently lyse malignant cells expressing both HLA-A*0201 and c-Met. There was no recognition of the ovarian cancer cells SK-OV-3 or Croft cells demonstrating that the presentation of c-Met peptide in the context of HLA-A*0201 molecules on the tumor cells is required for the efficient lysis of target cells and confirming the antigen specificity and MHC restriction of the CTLs. The in vitro-induced T cells did not recognize the K562 cells indicating that the cytotoxic activity was not natural killer-cell mediated.



View larger version (22K):
[in this window]
[in a new window]
  		Fig. 3. Antigen-specific lysis of human tumor cell lines endogenously expressing c-Met by c-Met-specific CTLs. Human HLA-A*0201+/c-Met+ colon cell carcinoma cells HCT116, renal cell carcinoma (MZ1257 and A498), melanoma (Mel1479), breast cancer cell line MCF-7, multiple myeloma (U266) cell line, and the EBV-immortalized Croft cells (HLA-A*0201+/c-Met–) as well as the ovarian cancer cell line SK-OV-3 (HLA-A*0201-/c-Met+) were used as targets in a standard 51Cr release assay. K562 cells were included to determine the natural killer cell activity.

 
To additionally verify the antigen specificity and MHC restriction of the in vitro-induced CTL lines we performed cold target inhibition assays (Fig. 4, A and B)Citation . The lysis of the target cells (U266, Fig. 4ACitation , and A498, Fig. 4BCitation ) could be blocked in cold target inhibition assays. The addition of cold (not labeled with 51Cr) T2 cells pulsed with the cognate peptide reduced the lysis of tumor cells, whereas T2 cells pulsed with an irrelevant peptide showed no effect.



View larger version (15K):
[in this window]
[in a new window]
  		Fig. 4. Antigen-specific lysis of tumor cells in cold target inhibition assays. The antigen-specific lysis of the U266 (A) and A498 (B) tumor cell lines by the in vitro-induced CTL lines was analyzed in cold target inhibition assays using unlabeled T2 cells pulsed with the cognate c-Met peptide (U266 + T2/C-Met and A498 + T2/C-Met) or the irrelevant survivin peptide (U266 + T2/Survivin and A498 + T2/Survivin) at an inhibitor:target ratio of 20:1.

 
C-Met-Specific CTLs Can Lyse Autologous DCs Transfected with Whole Tumor RNA.
To determine the cytotoxic activity of the CTLs in an autologous setting and test the presentation of c-Met-specific T-cell epitopes upon transfection with whole tumor RNA we used autologous DCs, generated from the same PBMNCs that were used for CTL induction, as target cells. As shown in Fig. 5Citation , CTLs efficiently lysed autologous DCs electroporated with the whole tumor RNA isolated from the c-Met-expressing A498 or MCF-7 tumor cell lines indicating that the identified c-Met peptide is processed and presented after transfection of DCs with RNA derived from c-Met-positive tumor cells.



View larger version (14K):
[in this window]
[in a new window]
  		Fig. 5. C-Met-specific CTLs recognize autologous dendritic cells (DC) transfected with total RNA isolated from A498 or MCF-7 tumor cells. Autologous DCs from a healthy HLA-A*0201+ donor generated from peripheral blood monocytes were electroporated with total tumor RNA isolated from the c-Met-expressing MCF-7 or A498 tumor cell lines. These DCs were used as target cells in a standard 51Cr release assay (closed symbols). DCs electroporated with RNA derived from the c-Met-negative Croft cell line were used as controls in the assay (open symbols).

 
In the next set of experiments we analyzed the cytolytic activity of the induced CTLs against human HLA-A*0201 matched bone marrow cells and mobilized CD34+ peripheral blood progenitor cells before and after incubation with SCF that was shown to induce differentiation of the progenitor cells and up-regulation of c-Met protein (10) . As demonstrated in Fig. 6Citation , c-Met-specific CTLs recognized autologous DCs pulsed with the antigenic peptide as well as HLA-A*0201-matched allogeneic malignant plasma cells expressing c-Met while ignoring HLA-A*0201-positive bone marrow cells or mobilized CD34+ peripheral blood progenitor cells that were stimulated with SCF or left untreated.



View larger version (16K):
[in this window]
[in a new window]
  		Fig. 6. C-Met-specific CTLs recognize primary malignant cells while sparing bone marrow cells and mobilized CD34+ progenitor cells. Dendritic cells (DC) generated from adherent peripheral blood mononuclear cells of an HLA-A*0201-positive healthy donor in the presence of granulocyte macrophage colony-stimulating factor, interleukin 4, and tumor necrosis factor {alpha} were pulsed with the synthetic peptide derived from the c-Met protein and used for CTL induction. Cytotoxic activity of induced CTL was analyzed in a standard 51Cr release assay using autologous DCs pulsed with the cognate c-Met peptide or an irrelevant peptide (adipophilin, Ad) as targets. HLA-A*0201 matched allogeneic bone marrow cells (BM), mobilized CD34+ peripheral blood progenitor cells and malignant plasma cells from a patient with multiple myeloma (MM) were included in the assay. Bone marrow cells and CD34+ peripheral blood progenitor cells were additionally incubated for 48 h with stem cell factor (SCF) to induce differentiation of the cells. PBPC, peripheral blood progenitor cells.

 
We next performed RT-PCR and Western blot analysis to determine the expression of c-Met in human mobilized CD34+ progenitor and bone marrow cells before and after exposure to SCF (Fig. 7)Citation . No expression of c-Met could be detected in CD34+ cells. Expression of c-Met was found to be very low in bone marrow cells compared with high expression in the renal cell carcinoma line (A498).



View larger version (56K):
[in this window]
[in a new window]
  		Fig. 7. Comparison of c-Met expression in CD34+ progenitor cells, bone marrow cells, and tumor cells. A part of the cells was incubated with stem cell factor (SCF) for 24 h. A, c-Met expression was analyzed by Western blot analysis with a polyclonal c-Met antibody. To ensure equal loading of the gel, the blot was reprobed using a monoclonal glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody. B, analysis of c-Met mRNA level by reverse transcription-PCR. Amplification of ß2-microglobulin was performed as control.

 
C-Met-Specific CTLs Recognize Autologous Malignant Cells.
RT-PCR analysis revealed that malignant cells from a HLA-A*0201+ patient with plasma cell leukemia that developed from previously diagnosed multiple myeloma express c-Met (data not shown). The malignant plasma cells represented >90% of the blood population. Using PBMNCs derived from earlier time points we were able to generate c-Met-specific CTLs that lysed the autologous malignant cells, whereas they spared the nonmalignant autologous B-cells, T-cells, monocytes and DCs (Fig. 8)Citation .



View larger version (16K):
[in this window]
[in a new window]
  		Fig. 8. Antigen-specific killing of autologous malignant cells from a patient with plasma cell leukemia. In vitro-generated c-Met-specific CTL were induced using peripheral blood mononuclear cells from an HLA-A*0201-positive patient with multiple myeloma who developed a plasma cell leukemia. The malignant cell represented >90% of peripheral blood mononuclear cells at the time of diagnosis. C-met-specific CTLs recognize autologous malignant cells plasma cells (MM, multiple myeloma; B) and the c-Met-positive tumor cell line A498 (A) as well as dendritic cells (DC) loaded with the cognate peptide (DC + c-Met), whereas DC loaded with the irrelevant adipophilin peptide (DC + Ad) are spared (A). The c-Met-specific CTL do not lyse autologous monocytes and resting or activated B and T cells. K562 cells were included as a control, indicating that the lysis is not natural killer cell mediated (B).

 
DISCUSSION

Therapeutic vaccinations of patients with malignant diseases aim at stimulation of antitumor-directed immune responses, mainly CTLs, capable of recognizing and eliminating malignant cells. During the last years considerable efforts have been made to identify antigens specifically recognized by CTLs using reverse immunology, expression cloning, or Serex technology. However, with the exception of some tumor-associated antigens most of the identified T-cell epitopes are restricted to a limited set of malignancies (21, 22, 23) .

Comparative expression profiling of a tumor and its corresponding autologous healthy tissue by DNA microarray technology allows the identification of antigens selectively expressed or overexpressed in malignant cells making these proteins suitable targets for immunotherapeutic approaches. Combination of this genetic analysis with mass spectrometric analysis of HLA ligands enables the characterization of antigenic peptides encoded by these antigens. Using this integrated functional genomics approach an HLA-A*0201-presented peptide derived from the c-Met proto-oncogene was identified (13) .

C-Met is a heterodimeric tyrosine kinase receptor that mediates the multifunctional and potentially oncogenic activities of the HGF/scatter factor including promotion of cell growth, motility, survival, extracellular matrix dissolution, and angiogenesis (1, 2, 3) . Binding of HGF to the receptor induces autophosphorylation of c-Met and activates downstream signaling events including the ras, phosphatidylinositol 3'-kinase, phospholipase C {gamma}, and mitogen-activated protein kinase-related pathways (4 , 5 , 24, 25, 26, 27) . The c-Met gene is expressed predominantly in epithelial cells and is overexpressed in several malignant tissues and cell lines (28, 29, 30, 31, 32, 33, 34, 35, 36) . An increasing number of reports have shown that nonepithelial cells such as hematopoietic, neural, and skeletal cells respond to HGF and hematological malignancies like multiple myeloma, Hodgkin disease, leukemias, and lymphomas express the c-Met protein (37, 38, 39, 40, 41) . Deregulated control of the invasive growth phenotype by oncogenically activated c-Met provoked by c-Met-activating mutations, c-Met amplification/overexpression, and the acquisition of HGF/c-Met autocrine loops confers invasive and metastatic properties to malignant cells. Notably, constitutive activation of c-Met in HGF-overexpressing transgenic mice promotes broad tumorigenesis (42 , 43) . Therefore, targeting of c-Met and/or c-Met oncogenic transduction pathways could represent a promising therapeutic option.

We show that c-Met-specific CTLs recognizing tumor cells in an antigen-specific and MHC-restricted manner can be induced in vitro suggesting that c-Met proto-oncogene is a novel tumor rejection antigen. We used the previously identified c-Met-derived HLA-A*0201-binding ligand for CTL induction and were able to demonstrate that this c-Met epitope is expressed on a broad spectrum of epithelial and hematological malignancies including renal cell carcinomas, breast cancer, colon cancer, malignant melanoma, and multiple myeloma indicating that this c-Met peptide is an interesting candidate for the development of a broadly applicable vaccination therapy. The specificity of the elicited CTL responses was confirmed in cold target inhibition assays. Furthermore, we performed the experiments in an autologous setting and used autologous DCs that were either pulsed with the cognate peptide or electroporated with RNA isolated from c-Met-expressing tumor cell lines as targets. The in vitro-induced c-Met peptide-specific CTL efficiently lysed peptide-pulsed autologous DCs and DCs transfected with whole tumor RNA, thus demonstrating that the peptide used for CTL induction is also processed and presented upon transfection of DCs with whole tumor RNA and might, therefore, represent a very useful epitope in cancer vaccinations.

Using our in vitro priming approach with peptide-pulsed DCs we were able to generate c-Met-specific CTLs that lysed autologous malignant cells from a HLA-A*0201+ patient with plasma cell leukemia, whereas they spared the nonmalignant autologous B cells, T cells, monocytes, and DC.

Previous studies have shown that under normal conditions c-Met gene can be found in many epithelial tissues, and its expression can be induced by treatment with phorbol esters, serum, and in a paracrine fashion by mesenchymally derived HGF. HGF/scatter factor-Met signaling is required for normal development of liver, skeletal muscle, and placenta (37) . In the hematopoietic system, HGF is produced by stromal bone marrow cells and together with other cytokines and growth factors induces proliferation and differentiation of a subset of c-Met-positive progenitor cells. The c-Met/HGF interaction plays an important role in the lymphoid microenvironment and induces adhesion as well as migration of normally activated B cells and monocytes (3, 4, 5, 6, 7, 8, 9, 10, 11, 12) .

These observations indicate that the c-Met/HGF network promotes pleiotropic effects in normal cells and is not a cancer-specific antigen, and caution is required when targeting this protein in clinical vaccination trials. However, we were not able to detect any significant recognition of nonmalignant B and T lymphocytes, DCs, monocytes, or hematopoietic progenitor cells by c-Met-specific CTLs in our in vitro assays.

As mentioned above it was demonstrated recently that bone marrow cells can up-regulate the expression of c-Met upon treatment with SCF. However, these cells were not recognized by the in vitro-induced c-Met-specific CTLs as shown in Fig. 6Citation . PCR and Western blot analysis demonstrated low C-Met expression in bone marrow cells as compared with the A498 renal cell carcinoma cell line indicating that the level of antigen expression that is higher in malignant cells correlates with the ability of the in vitro-generated CTLs to recognize and lyse c-Met-presenting target cells.

In several clinical vaccination trials using DCs presenting tumor-associated antigens or adoptive transfer of tumor-reactive CTLs generated ex vivo, it was shown that these approaches can induce antitumor immunity in patients with malignant diseases (22 , 23 , 44, 45, 46, 47, 48) . However, with the exception of some reports in malignant melanoma trials where induction of vitiligo was observed after vaccinations with DCs even when antigens that are expressed in normal tissues like MUC1 or Her-2/neu were applied there has been thus far no evidence for the development of autoimmune reactions in these patients (49) . In conclusion, in our study we describe the identification of a novel broadly expressed T-cell epitope derived from a proto-oncogene that is an interesting candidate to be applied in immunotherapies of human malignancies.

ACKNOWLEDGMENTS

We thank Bruni Schuster and Sylvia Stephan for excellent technical assistance. We thank Tina Wiesner, Andreas M. Boehmler, and Hans-Joerg Buehring for providing CD34+ and bone marrow cells.

FOOTNOTES

Grant support: Deutsche Forschungsgemeinschaft (SFB 510, Projekt B2) and Deutsche Krebshilfe.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: K. Schag and S. Schmidt contributed equally to the manuscript.

Requests for reprints: Peter Brossart, University of Tübingen, Department of Hematology, Oncology and Immunology, Otfried-Müller-Strasse-10, D-72076 Tübingen, Germany. Phone: 49-7071-2982726; Fax: 49-7071-295709; E-mail: peter.brossart{at}med.uni-tuebingen.de

Received 11/25/03; revised 2/11/04; accepted 2/16/04.

REFERENCES

  1. Bottaro DP, Rubin JS, Faletto DL, Chan AM, Kmiecik E, Vande Woude GF, Aaronson SA. Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science, 251: 802-804, 1991.[Abstract/Free Full Text]
  2. Rubin JS, Bottaro DP, Aaronson SA. Hepatocyte growth factor/scatter factor and its receptor, the c-met proto-oncogene product. Biochim Biophys Acta, 1155: 357-371, 1993.[Medline]
  3. Zarnegar R, Michalopoulos GK. The many faces of hepatocyte growth factor: from hepatopoiesis to hematopoiesis. J Cell Biol, 129: 1177-1180, 1995.[Free Full Text]
  4. Naldini L, Vigna E, Narsimhan RP, Gaudino G, Zarnegar R, Michalopoulos GK, Comoglio PM. Hepatocyte growth factor (HGF) stimulates the tyrosine kinase activity of the receptor encoded by the proto-oncogene c-MET. Oncogene, 6: 501-504, 1991.[Medline]
  5. Montesano R, Soriano JV, Malinda KM, Ponce ML, Bafico A, Kleinman HK, Bottaro DP, Aaronson SA. Differential effects of hepatocyte growth factor isoforms on epithelial and endothelial tubulogenesis. Cell Growth Differ, 9: 355-365, 1998.[Abstract]
  6. Schmidt C, Bladt F, Goedecke S, Brinkman V, Zschiesche W, Sharpe M, Gherardi E, Birchmeier C. Scatter factor/hepatocyte growth factor is essential for liver development. Nature, 373: 699-702, 1995.[CrossRef][Medline]
  7. Uehara Y, Minowa O, Mori C, Shiota K, Kuno J, Noda T, Kitamura N. Placental defect and embryonic lethality in mice lacking hepatocyte growthfactor/scatter factor. Nature, 373: 702-705, 1995.[CrossRef][Medline]
  8. Bladt F, Rlethmacher D, Isenmann S, Aguzzi A, Birchmeier C. Essential role for the c-met receptor in the migration of myogenic precursor cells into the limb bud. Nature, 376: 768-771, 1995.[CrossRef][Medline]
  9. Takayama H, LaRochelle WJ, Anver M, Bockman DE, Merlino G. Scatter factor/hepatocyte growth factor as a regulator of skeletal muscle and neural crest development. Proc Natl Acad Sci, 93: 5866-5871, 1996.[Abstract/Free Full Text]
  10. Mizuno K, Higuchi O, Ihle JN, Nakamura T. Hepatocyte growth factor stimulates growth of hematopoietic progenitor cells. Biochem Biophys Res Commun, 194: 178-186, 1993.[CrossRef][Medline]
  11. van der Voort R, Taher TE, Keehnen RM, Smit L, Groenink M, Pals ST. Paracrine regulation of germinal center B cell adhesion through the c-met-hepatocyte growth factor/scatter factor pathway. J Exp Med, 185: 2121-2131, 1997.[Abstract/Free Full Text]
  12. Beilmann M, Vande Woude GF, Dienes HP, Schirmacher P. Hepatocyte growth factor-stimulated invasivness of monocytes. Blood, 95: 3964-3969, 2000.[Abstract/Free Full Text]
  13. Weinschenk T, Gouttefangeas C, Schirle M, Obermayr F, Walter S, Schoor O, Kurek R, Loeser W, Bichler KH, Wernet D, Stevanovic S, Rammensee HG. Integrated functional genomics approach for the design of patient-individual antitumor vaccines. Cancer Res, 62: 5818-27, 2002.[Abstract/Free Full Text]
  14. Brossart P, Schneider A, Dill P, Schammann T, Grunebach F, Wirths S, Kanz L, Buhring HJ, Brugger W. The epithelial tumor antigen MUC1 is expressed in hematological malignancies and is recognized by MUC1-specific cytotoxic T-lymphocytes. Cancer Res, 61: 6846-50, 2001.[Abstract/Free Full Text]
  15. Schmidt SM, Schag K, Muller MR, Weck MM, Appel S, Kanz L, Grunebach F, Brossart P. Survivin is a shared tumor associated antigen expressed in a broad variety of malignancies and recognized by specific cytotoxic T-cells. Blood, 102: 571-576, 2003.[Abstract/Free Full Text]
  16. Schmitz M, Diestelkoetter P, Weigle B, Schmachtenberg F, Stevanovic S, Ockert D, Rammensee HG, Rieber EP. Generation of survivin-specific CD8+ T effector cells by dendritic cells pulsed with protein or selected peptides. Cancer Res, 60: 4845-9, 2000.[Abstract/Free Full Text]
  17. Grünebach F, Müller MR, Nencioni A, Brossart P. Delivery of tumor derived RNA for induction of cytotoxic T-lymphocytes. Gene Ther., in press
  18. Jeffers M, Rong S, Vande Woude GF. Hepatocyte growth factor/scatter factor-Met signaling in tumorigenicity and invasion/metastasis. J Mol Med, 74: 505-513, 1996.[CrossRef][Medline]
  19. Rong S, Bodescot M, Blair D, Dunn J, Nakamura T, Mizuno K, Park M, Chan A, Aaronson S, Vande Woude GF. Tumorigenicity of the met proto-oncogene and the gene for hepatocyte growth factor. Mol Cell Biol, 12: 5152-5158, 1992.[Abstract/Free Full Text]
  20. Giordano S, Zhen Z, Medico E, Galimi F, Comoglio PM. Transfer of motogenic and invasive response to scatter factor/hepatocyte growth factor by transfection of human MET protooncogene. Proc Natl Acad Sci, 90: 649-653, 1993.[Abstract/Free Full Text]
  21. Gilboa E. The makings of a tumor rejection antigen. Immunity, 11: 263-70, 1999.[CrossRef][Medline]
  22. Jager E, Jager D, Knuth A. Clinical cancer vaccine trials. Curr Opin Immunol, 14: 178-82, 2002.[CrossRef][Medline]
  23. Brossart P, Wirths S, Brugger W, Kanz L. Dendritic cells in cancer vaccines. Exp Hematol, 29: 1247-55, 2001.[CrossRef][Medline]
  24. Furge KA, Zhang YW, Vande Woude GF. Met receptor tyrosine kinase: enhanced signaling through adapter proteins. Oncogene, 19: 5582-5589, 2000.[CrossRef][Medline]
  25. Ponzetto C, Bardelli A, Maina F, Longati P, Panayotou G, Dhand R, Waterfield MD, Comoglio PM. A novel recognition motif for phosphatidylinositol 3-kinase binding mediates its association with the hepatocyte growth factor/scatter factor receptor. Mol Cell Biol, 13: 4600-4608, 1993.[Abstract/Free Full Text]
  26. Dong G, Chen Z, Li Z-Y, Yeh NT, Bancroft CC, Van Waes C. Hepatocyte growth factor/scatter factor-induced activation of MEK and PI3K signal pathways contributes to expression of proangiogenic cytokines interleukin-8 and vascular endothelial growth factor in head and neck squamous cell carcinoma. Cancer Res, 61: 5911-5918, 2001.[Abstract/Free Full Text]
  27. Furge KA, Kiewlich D, Le P, Vo MN, Faure M, Howlett AR, Lipson KE, Vande Woude GF, Webb CP. Suppression of Ras-mediated tumorigenicity and metastasis through inhibition of the Met receptor tyrosine kinase. Proc Natl Acad Sci, 98: 10722-10727, 2001.[Abstract/Free Full Text]
  28. Di Renzo MF, Olivero M, Giacomini A, Porte H, Chastre E, Mirossay L, Nordlinger B, Bretti S, Bottardi S, Giordano S. Overexpression and amplification of the met/HGF receptor gene during the progression of colorectal cancer. Clin Cancer Res, 1: 147-154, 1995.[Abstract]
  29. Ferracini R, Di Renzo MF, Scotlandi K, Baldini N, Olivero M, Lollini P, Cremona O, Campanacci M, Comoglio PM. The Met/HGF receptor is over-expressed in human osteosarcomas and is activated by either a paracrine or an autocrine circuit. Oncogene, 10: 739-749, 1995.[Medline]
  30. Tuck AB, Park M, Sterns EE, Boag A, Elliott BE. Coexpression of hepatocyte growth factor and receptor (Met) in human breast carcinoma. Am J Pathol, 148: 225-232, 1996.[Abstract]
  31. Koochekpour S, Jeffers M, Rulong S, Taylor G, Klineberg E, Hudson EA, Resau JH, Vande Woude GF. Met and hepatocyte growth factor/scatter factor expression in human gliomas. Cancer Res, 57: 5391-5398, 1997.[Abstract/Free Full Text]
  32. Li G, Schaider H, Satyamoorthy K, Hanakawa Y, Hashimoto K, Herlyn M. Downregulation of E-cadherin and desmoglein 1 by autocrine hepatocyte growth factor during melanoma development. Oncogene, 20: 8125-8135, 2001.[CrossRef][Medline]
  33. Fischer J, Palmedo G, von Knobloch R, Burgert P, Prayer-Galetti T, Pagano F, Kovacs G. Duplication and overexpression of the mutant allel of the MET proto-oncogene in multiple hereditary papillary renal cell tumours. Oncogene, 17: 733-739, 1998.[CrossRef][Medline]
  34. Maulik G, Kijima T, Ma PC, Ghosh SK, Lin J, Shapiro GI, Schaefer E, Tibaldi E, Johnson BE, Sagia R. Modulation of the c-Met/Hepatocyt Growth Factor Pathway in small lung cell cancer. Clin Cancer Res, 8: 620-627, 2002.[Abstract/Free Full Text]
  35. Qian CN, Gua X, Cao B, Kort EJ, Lee CC, Chen J, Wang LM, Mai WJ, Min HQ, Hong MH, Vande Woude GF, Resau JH. The B. T. Met protein expression level correlates with survival in patients with late-stage nasopharyngeal carcinoma. Cancer Res, 62: 589-596, 2002.[Abstract/Free Full Text]
  36. Ramirez R, Hsu D, Patel A, Fenton C, Dinauer C, Tuttle RM, Francis GL. Over-expression of hepatocyte growth factor/scatter factor (HGF/SF) and the HGF/SF receptor (cMet) are associated with a high risk of metastasis and recurrence for children and young adults with papillary thyroid carcinoma. Clin Endocrinol, 53: 635-644, 2000.[CrossRef][Medline]
  37. Gherardi E, Stoker M. Hepatocyte growth factor-scatter factor: mitogen, motogen, and met. Cancer Cells, 3: 227-232, 1991.[Medline]
  38. Teofili L, Di Febo AL, Pierconti F, Maggiano N, Bendandi M, Rutella S, Cingolani A, Di Renzo N, Musto P, Pileri S, Leone G, Larocca LM. Expression of the c-MET proto-oncogene and its ligand, hepatocyte growth factor, in Hodgkin disease. Blood, 97: 1063-1069, 2001.[Abstract/Free Full Text]
  39. Borset M, Seidel C, Hjorth-Hansen H, Waage A, Sundan A. The role of hepatocyte growth factor and its receptor c-met in multiple myeloma and other blood malignancies. Leuk Lymphoma, 32: 249-256, 1999.[Medline]
  40. Jucker M, Gunther A, Gradl G, Fonatsch C, Krueger G, Diehl V, Tesch H. The Met/hepatocyte growth factor receptor (HGFR) gene is overexpressed in some cases of human leukemia and lymphoma. Leuk Res, 18: 7-16, 1994.[CrossRef][Medline]
  41. Pons E, Uphoff CC, Drexler HG. Expression of hepatocyte growth factor and its receptor c-met in human leukemia-lymphoma cell lines. Leuk Res, 22: 797-804, 1998.[CrossRef][Medline]
  42. Wang R, Ferrell LD, Faouzi S, Maher JJ, Bishop JM. Activation of the Met Receptor by cell attachment induces and sustains hepatocellular carcinomas in transgenic mice. J Cell Biol, 153: 1023-1033, 2001.[Abstract/Free Full Text]
  43. Takayama H, LaRochelle WJ, Sharp R, Otsuka T, Kriebel P, Anver M, Aaronson SA, Merlino G. Diverse tumorigenesis associated with aberrant development in mice overexpressing hepatocyte growth factor/scatter factor. Proc Natl Acad Sci, 94: 701-706, 1997.[Abstract/Free Full Text]
  44. Nestle FO, Alijagic S, Gilliet M, Sun Y, Grabbe S, Dummer R, Burg G, Schadendorf D. Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat Med, 4: 328-32, 1998.[CrossRef][Medline]
  45. Schuler-Thurner B, Schultz ES, Berger TG, Weinlich G, Ebner S, Woerl P, Bender A, Feuerstein B, Fritsch PO, Romani N, Schuler G. Rapid induction of tumor-specific type 1 T helper cells in metastatic melanoma patients by vaccination with mature, cryopreserved, peptide-loaded monocyte-derived dendritic cells. J Exp Med, 195: 1279-88, 2002.[Abstract/Free Full Text]
  46. Brossart P, Wirths S, Stuhler G, Reichardt VL, Kanz L, Brugger W. Induction of cytotoxic T-lymphocyte responses in vivo after vaccinations with peptide-pulsed dendritic cells. Blood, 96: 3102-8, 2001.
  47. Dudley ME, Wunderlich JR, Robbins PF, Yang JC, Hwu P, Schwartzentruber DJ, Topalian SL, Sherry R, Restifo NP, Hubicki AM, Robinson MR, Raffeld M, Duray P, Seipp CA, Rogers-Freezer L, Morton KE, Mavroukakis SA, White DE, Rosenberg SA. Cancer regression and autoimmunity in patients after clonal repopulation with antitumor lymphocytes. Science, 298: 850-4, 2002.[Abstract/Free Full Text]
  48. Holtl L, Zelle-Rieser C, Gander H, Papesh C, Ramoner R, Bartsch G, Rogatsch H, Barsoum AL, Coggin JH, Jr., Thurnher M. Immunotherapy of metastatic renal cell carcinoma with tumor lysate-pulsed autologous dendritic cells. Clin Cancer Res, 8: 3369-3376, 2002.[Abstract/Free Full Text]
  49. Gilboa E. The risk of autoimmunity associated with tumor immunotherapy. Nat Immunol, 2: 789-92, 2001.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
H. Hov, R. U. Holt, T. B. Ro, U.-M. Fagerli, H. Hjorth-Hansen, V. Baykov, J. G. Christensen, A. Waage, A. Sundan, and M. Borset
A Selective c-Met Inhibitor Blocks an Autocrine Hepatocyte Growth Factor Growth Loop in ANBL-6 Cells and Prevents Migration and Adhesion of Myeloma Cells
Clin. Cancer Res., October 1, 2004; 10(19): 6686 - 6694.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schag, K.
Right arrow Articles by Brossart, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schag, K.
Right arrow Articles by Brossart, P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation