| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Clinical Trials |
1 National Cancer Institute, Surgery Branch and 2 National Heart, Lung, and Blood Institute, Hematology Branch, NIH, Bethesda, Maryland
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Experimental Design: Fourteen patients with metastatic cancers were vaccinated with hTERT:540-548 emulsified in incomplete Freund’s adjuvant.
Results: In 7 patients, peripheral blood mononuclear cells collected after immunization recognized hTERT:540-548, whereas those collected before vaccination did not. However, none of these CTLs recognized tumors that endogenously expressed telomerase, and none of the patients had an objective clinical response. Several highly avid T-cell clones were generated that recognized T2 cells pulsed with 
1 nM hTERT:540-548, but none of these recognized HLA-A*0201+ hTERT+ tumors or cells transduced with the human telomerase reverse transcriptase (hTERT) gene. Also, an antibody specific for hTERT:540-548/HLA-A*0201 complexes stained peptide-pulsed cells but not telomerase+ tumors.
Conclusions: Our results are discordant with previous studies and those of a clinical trial that claimed peripheral blood mononuclear cells from patients vaccinated with peptide-pulsed dendritic cells lysed hTERT+ tumors. However, our findings are consistent with a previous study that demonstrated that the hTERT:540-548 peptide is cleaved in the proteasome. These results suggest that hTERT:540-548 is not presented on the surfaces of tumor cells in the context of HLA-A*0201 and will not be useful for the immunotherapy of patients with cancer.
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The ribonucleoprotein telomerase has also been suggested to be a tumor-associated antigen (3 , 4) . This enzyme mediates the RNA-dependent synthesis of telomeric DNA. Telomeres at the distal ends of eukaryotic chromosomes stabilize the chromosomes during cell division and prevent end-to-end fusion (5) . The telomerase catalytic subunit, human telomerase reverse transcriptase (hTERT), is the rate-limiting component in the telomerase complex and is most closely correlated with telomerase activity (6 , 7) . More than 85% of human cancers have telomerase activity and express hTERT, whereas most normal adult human cells do not maintain the lengths of their telomeres (8, 9, 10, 11) . Therefore, telomerase was considered to be an attractive candidate target antigen for the development of immunotherapies for the treatment of patients with a variety of human cancers. In addition, telomerase expression has been directly linked to the ability of tumor cells to replicate indefinitely (12) , and the inhibition of telomerase in tumor cells has been shown to lead to cell death (13 , 14) . Therefore, if a T-cell response could be directed against peptide epitopes processed from telomerase, it seems likely that any immune escape variants that did not express this protein would not be able to survive.
The hTERT:540-548 peptide (ILAKFLHWL) was previously identified by investigators from two laboratories as an immunodominant HLA-A*0201-restricted T-cell epitope (3 , 4) . In both studies, it was reported that this peptide could induce CTL in vitro that recognized the peptide as well as cells that endogenously expressed telomerase, including breast, colon, lung, melanoma, and prostate cancers and cells transfected with the full-length hTERT gene. On the basis of these studies and our prior success with immunizing patients against peptides from the melanoma antigens MART-1 and gp100 (15 , 16) , we initiated a clinical protocol to vaccinate 14 patients with metastatic cancers with the hTERT:540-548 peptide emulsified in incomplete Freund’s adjuvant. In 7 patients, peripheral blood mononuclear cells (PBMCs) collected after immunization were able to recognize the hTERT peptide in vitro, whereas those collected before vaccination were not. However, none of these CTLs recognized tumor cells that endogenously expressed HLA-A*0201 and telomerase. We also generated several T-cell lines and clones that were highly avid for the peptide, but these lymphocytes also did not recognize HLA-A*0201+ hTERT+ tumors or cells transduced with the full-length hTERT gene. Furthermore, Fab fragments that specifically bound to the hTERT:540-548/HLA-A*0201 complex (17) stained peptide-pulsed cells but not hTERT+ tumors. These results are consistent with those of Ayyoub et al. (18) , who demonstrated that the hTERT:540-548 peptide is cleaved in the proteasome and is not presented in the context of HLA-A*0201 on the surfaces of cells that endogenously express telomerase. Our results thus indicate that the hTERT:540-548 peptide will not be useful for the development of cancer immunotherapies.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Patients were randomized into one of the following three arms of the study: (a) hTERT:540-548 peptide once a week every week for 4 or 10 cycles followed by a 3-week break and then repeated injections of peptide every week for 4 or 10 cycles (once weekly 4 or 10 cycles); (b) hTERT:540-548 peptide once every 3 weeks; and (c) hTERT:540-548 peptide 4 days in a row every 3 weeks (Monday–Thursday). For each immunization, 1 mg of peptide was injected as an emulsion with incomplete Freund’s adjuvant (Montanide ISA-51; Seppic, Paris, France) in two equal volumes (1 ml/injection) into the s.c. tissue of the anterior thigh. Patients underwent leukapheresis 3 weeks after each course of immunization, and PBMCs were cryopreserved at –180°C after Ficoll-Hypaque separation.
Media and Cell Culture.
Multiple human cell lines were used in these studies to evaluate hTERT recognition by T lymphocytes. These included T2 cells (HLA-A*0201+ peptide transporter-associated protein-deficient T-B hybrid), melanomas (888mel, 938mel, 624mel, 1861mel, and Sk23mel), renal cells (293), B lymphoblasts (C1R), EBV-transformed B lymphocytes (EBV-B cells: SKW6.4, IM9, and 1978E), myeloma (U266), colon carcinomas (H508 and SW480), breast carcinoma (HBL-100), osteosarcoma (U20S), ovarian carcinoma (SK-OV-3), renal cell carcinomas (N-KH and S-KH), and normal human fibroblasts (WI-38). All of these cell lines were routinely cultured in either RPMI 1640 supplemented with 10% heat-inactivated fetal bovine serum and 2 mM L-glutamine (Invitrogen, Carlsbad, CA) or DMEM (Invitrogen) containing 10% heat-inactivated fetal bovine serum, 2 mM L-glutamine, and 10 mM HEPES. Human lymphocytes were cultured in complete medium (CM) consisting of RPMI 1640, 2 mM L-glutamine, 50 units/ml penicillin, 50 µg/ml streptomycin (Invitrogen), and 10% heat-inactivated human AB serum (Gemini Bio-Products, Woodland, CA; Valley Biomedical, Winchester, VA).
Peptides.
For clinical administration, hTERT:540-548 (ILAKFLHWL) was purchased from Multiple Peptide Systems (San Diego, CA) as GMP-grade lyophilized powder. For other in vitro studies, HBVc:18–27(23Y) (FLPSDYFPSV), G250:254-262 (HLSTAFARV), gp100:209-217 (ITDQVPFSV), gp100:209-217(210M) (IMDQVPFSV), gp100:280-288 (YLEPGPVTA), and hTERT:540-548 (ILAKFLHWL) were commercially synthesized and purified (>95%) by reversed-phase high-performance liquid chromatography by Macromolecular Resources (Fort Collins, CO) and were resuspended at 1–5 mg/ml in DMSO as stock solutions.
Evaluation of HLA-A*0201, hTERT, and Telomerase Expression in Tumor Cell Lines and Normal Tissues.
SW480, HBL-100, SK-OV-3, and U2OS cells were kindly provided by Dr. Robert Vonderheide (Abramson Family Cancer Research Institute, University of Pennsylvania, Philadelphia, PA). These cell lines had previously been evaluated for expression of HLA-A*0201 and telomerase enzyme activity using the telomeric repeat amplification protocol (TRAP) in his laboratory with the following results: SW480 (HLA-A*0201+ hTERT+); HBL-100 (HLA-A*0201+ hTERT+); SK-OV-3 (HLA-A*0201– hTERT+); and U2OS (HLA-A*0201+ hTERT–).
The expression of HLA-A2 was evaluated on all other cell lines by fluorescence-activated cell sorting using an anti-HLA-A2 monoclonal antibody (One Lambda, Canoga Park, CA), and for some cell lines, DNA sequencing confirmed the presence of HLA-A*0201 (HLA Laboratory, NIH). Although 293 and C1R cells did not express HLA-A*0201 (293-UT and C1R-UT), they were stably transfected with cDNA encoding this MHC molecule (293-A2 and C1R-A2).
The presence of hTERT mRNA in cell lines was assessed by reverse transcriptase-PCR using specific intron-spanning primers (forward GCCTGAGCTGTACTTTGTCAA and reverse CGCAAACAGCTTGTTCTCCATGTC). In addition, PCR was performed with these primers on serially diluted cDNAs from 24 normal human tissues (Rapid-Scan; Origene Technologies, Rockville, MD). Telomerase enzyme activity was also measured in cell lines using a commercially available TRAP assay followed by detection of the telomerase products by ELISA (TRAPese ELISA, Intergen Company, Purchase, NY) following the manufacturer’s recommended protocol.
In some experiments, cells were transduced with a recombinant adenovirus encoding hTERT. To determine whether this adenovirus induced functional telomerase, human fibroblasts (WI-38) that do not naturally express hTERT were transduced with the hTERT-adenovirus at an multiplicity of infection of either 10:1 or 100:1. Telomerase activity was then measured in the transduced cells using the TRAP assay.
In Vitro Comparison of Peptide and Tumor Reactivities of Pre- and Postvaccination Peripheral Blood Lymphocytes.
PBMCs that had been cryopreserved before or after immunization with hTERT:540-548 were stimulated with peptide as described previously (16)
. Briefly, T-cell cultures were established by plating PBMCs in 24-well plates (1.5 x 106 cells/ml; 2 ml/well) in CM containing 1–10 µg/ml peptide. Two days later, 300 IU/ml recombinant interleukin 2 (rIL-2; Chiron Co., Emeryville, CA) were added, and media were replaced as needed with fresh media containing IL-2. Recognition of hTERT by bulk T-cell cultures was evaluated 
12 days after culture initiation on the basis of IFN-
secretion in response to T2 cells preincubated with peptide and HLA-A*0201+ hTERT+ cell lines. T2 cells were incubated with peptide 1–3 h at 37°C and were either used directly (peptide loaded) or were washed twice before use (peptide pulsed). 105 responder T cells were coincubated with 105 stimulator cells (250 µl total) 20 h at 37°C, and the concentration of human IFN- in coculture supernatants was measured using commercially available ELISA reagents (Endogen, Cambridge, MA).
Generation of Peptide-Reactive T-Cell Lines and Clones.
In some experiments, T-cell lines were generated from patients with metastatic cancers that specifically recognized peptides derived from hTERT, gp100, or G250 as described previously (19)
. Briefly, hTERT:540-548, gp100:209–217(210M), or G250:254-262 was used to stimulate lymphocytes in vitro from HLA-A*0201+ patients with metastatic cancer in either a bulk culture (24-well plates) or microculture (96-well plates) format. For bulk cultures, PBMCs were initially plated in 24-well plates (3 x 106 cells/well; 1.5 x 106 cells/ml; 2 ml/well) in CM containing 1–10 µM peptide. Two days later, 300 IU/ml rIL-2 (Chiron Co.) were added. On day 7 and weekly thereafter, lymphocytes were restimulated with peptide-pulsed autologous-irradiated (4000 rad) PBMCs. Responder lymphocytes were harvested and replated in new 24-well plates (2.5 x 105 cells/ml; 2 ml/well) in CM. Autologous-irradiated PBMCs were incubated with 1–10 µM peptide in 15-ml conical tubes (1–10 x 106 cells/ml; 6–12 ml/tube) 2–4 h at 37°C. Peptide-loaded PBMCs were washed and added to responder lymphocytes at a responder to stimulator ratio of 1:10. One day after each restimulation, 300 IU/ml rIL-2 were added, and generally, cultures were split between 1:1 and 1:4 3 days later with CM containing 300 IU/ml rIL-2.
For microcultures, PBMCs were initially plated in 96-well plates (3–5 x 105 cells/well; 1.5–2.5 x 106 cells/ml; 200 µl/well) in CM containing 1–10 µM peptide, and 2 days later, 300 IU/ml rIL-2 (Chiron Co.) were added. On day 7, peptide-pulsed autologous-irradiated PBMCs were prepared as described above and were added to responder lymphocytes in 96-well plates (3–5 x 105 cells/well). One day after the restimulation, 300 IU/ml rIL-2 were added, and generally, cultures were split 1:1 into new 96-well plates 3 days later with CM containing 300 IU/ml rIL-2. On day 14, each microculture was evaluated for specific peptide recognition, and positive microcultures (
100 pg/ml and at least twice background with an HBVc peptide) were restimulated individually in 24-well plates with 5 x 106 peptide-pulsed autologous-irradiated PBMCs/well.
Alternatively, in some experiments, PBMCs were initially stimulated with peptide-loaded autologous dendritic cells (DCs) as antigen-presenting cells. Immature DCs were prepared as described previously (20)
. Briefly, adherent PBMCs were cultured in CM containing 1000 units/ml granulocyte macrophage colony-stimulating factor and 1000 units/ml IL-4 (Peprotech, Rocky Hill, NJ) for 5–7 days. DCs were then harvested and preloaded with 1–10 µM peptide and plated in 96-well plates (1–5 x 104 cells/well; 100 µl/well). PBMCs were then added to the wells containing peptide-loaded DCs (3–5 x 105 cells/well; 100 µl/well). Two days later, 300 IU/ml rIL-2 (Chiron Co.) were added. On day 7, cultures were restimulated with peptide-pulsed autologous-irradiated PBMCs as described above. On day 14, peptide-reactive microcultures were restimulated individually in 24 well plates with 5 x 106 peptide-pulsed autologous-irradiated PBMCs/well. Recognition of hTERT, gp100, or G250 by T-cell cultures was evaluated 7 days after each bulk restimulation on the basis of IFN- secretion in response to T2 cells preincubated with peptide and HLA-A*0201+ cell lines that endogenously expressed the antigen of interest. In some experiments, melanoma cells were transduced with recombinant adenoviral vectors encoding hTERT or G250 1 day before use as target cells in cytokine release assays. 105 responder T cells were coincubated with 105 stimulator cells (250 µl total) 20 h at 37°C, and the concentration of human IFN- in coculture supernatants was measured using commercially available ELISA reagents (Endogen, Cambridge, MA). Alternatively, in some experiments, 51Cr release cytotoxicity assays were performed to evaluate specific recognition of peptide and tumor cells as described previously (21)
.
In some experiments, bulk T-cell populations were cloned by limiting dilution and expanded using a modified version of the previously described rapid expansion protocol (22, 23, 24)
. T lymphocytes were plated at 1, 3, 5, and/or 10 cells/well in U-bottomed 96-well plates in CM containing 30 ng/ml ortho-anti-CD3 (Ortho-Biotech, Raritan, NJ) and 300 IU/ml rIL-2 with 5 x 104 allogeneic irradiated PBMCs/well derived from at least 3 different donors. On day 5 and every 3–4 days thereafter, half of the media in each well was replaced with fresh media containing IL-2. Approximately 2 weeks after culture initiation, wells in which cell growth was visibly apparent were assayed for specific peptide recognition by IFN- secretion as described above. Positive wells were expanded with 30 ng/ml ortho-anti-CD3 and 5 x 106 irradiated allogeneic PBMCs in upright 25-cm2 flasks as described previously (22, 23, 24)
.
FACS Analysis of T-Cell Populations Using HLA-A2/hTERT:540-548 Tetramers.
Phycoerythrin-conjugated tetrameric complexes consisting of HLA-A*0201 and hTERT:540-548 or HTLV-1 tax peptide L11 (LLFGYPVYV) (as a negative control) were kindly provided by Dr. Robert Vonderheide (Abramson Family Cancer Research Institute) or were purchased commercially (Beckman Coulter Immunomics Operations, San Diego, CA). T-Cell lines were costained with phycoerythrin-labeled tetramers and FITC-conjugated antihuman CD8 (Beckman Coulter Immunomics Operations) and were analyzed by FACS on a FACScan or FACSalidur (Becton Dickinson, Mountain View, CA).
FACS Analysis of Cells Using Fab Fragments against HLA-A*0201/hTERT:540-548 Complexes.
Fab fragments that specifically bind to HLA-A*0201/hTERT:540-548 complexes (4G9) were kindly provided by Dr. Yoram Reiter (Technion-Israel Institute of Technology, Technion City, Haifa, Israel) and were used to stain cells as described previously (17)
. Briefly, T2 cells were incubated overnight with hTERT:540-548 or HBVc:18–27(23Y) (as a negative control) in serum-free media. After washing, T2 cells and tumor cells were incubated with 4G9 Fab antibodies. After washing again, cells were stained with FITC-conjugated antihuman Fab (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) and were subsequently analyzed by FACS.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). However, it was not found in any normal human tissue, including brain, muscle, heart, stomach, kidney, testis, spleen, placenta, liver, salivary gland, colon, thyroid, lung, adrenal gland, small intestine, pancreas, ovary, uterus, prostate, skin, peripheral blood lymphocytes, bone marrow, fetal brain, or fetal liver using a semiquantitative Rapid Scan Gene Expression panel (data not shown).
|
or total protein (data not shown). In addition, because telomerase is a heat-sensitive enzyme, heat-inactivated controls were run for each sample by carrying out a 10-min incubation at 85°C. Absorbance values of all controls, including a PCR/ELISA-positive template, a sample containing no cell extract, and the lysate of a hTERT+ control cell pellet, were all within the limits specified by the kit manufacturer (TSR8 template control and hTERT+ control cell pellet absorbance > 0.8, no sample control absorbance < 0.2, and heat-treated samples absorbance < 0.25). Therefore, all of the cell lines evaluated were positive for telomerase activity because the net increase in absorbance for each sample in comparison to the same heat-treated sample was always >0.15 (Fig. 1A)
. Similar results were obtained when samples were normalized to total protein content instead of cell number (data not shown).
TRAP assays were also performed on WI-38 cells that did not naturally express telomerase but became positive after transduction with an adenoviral vector encoding hTERT (Fig. 1B)
. At a multiplicity of infection of 10:1, the absorbance value of the transduced WI-38 cell extracts in the TRAP assay was 2.55 while that of untransduced cells was 0.25, suggesting that the hTERT-adenovirus was capable of inducing telomerase activity.
Immunological Evidence of Immunization in Patients Receiving hTERT:540-548.
Because hTERT:540-548 had previously been reported to be an immunodominant HLA-A*0201-restricted peptide that could stimulate T cells in vitro capable of recognizing both peptide and tumor cells endogenously expressing telomerase, we began a clinical immunization trial with this peptide. Fourteen patients who had confirmed metastatic cancer were enrolled in this clinical protocol: 11 had renal cell carcinoma; 2 had colon cancer; and 1 had melanoma (Table 1)
.
|
secretion in response to T2 cells preloaded with 1 or 0.1 µM hTERT:540-548 in comparison to a control peptide [HBVc:18–27(23Y) or gp100:280-288]. Peptide recognition by PBMCs from 13 of 14 patients is presented in Table 2
(insufficient numbers of lymphocytes from patient 8 precluded this analysis). Before immunization, no PBMCs exhibited specific recognition of hTERT:540-548. However, after immunization, PBMCs from 7 of these 13 patients exhibited specific peptide reactivity. T cells sensitized with hTERT:540-548 recognized highly purified peptide preparations synthesized by two different sources, regardless of the specific preparation used for in vitro stimulation (data not shown). Furthermore, peptide reactive T-cell cultures contained cells that were stained by HLA-A*0201/hTERT:540-548 tetrameric complexes produced by yet an additional source (Fig. 2)
. Therefore, it is unlikely that the T cells were recognizing a contaminant in the peptide preparation. Despite these in vitro results, no patient had an objective clinical response to treatment.
|
|
. After a 12-day in vitro stimulation with hTERT:540-548, PBMCs from 4 patients, in whom evidence of immunization was observed, specifically secreted IFN- in response to T2 cells pulsed with 10 ng/ml hTERT:540-548 peptide. In addition, some of these populations contained as many as 24% T cells that were dually fluorescent after staining with FITC-conjugated antihuman CD8 and phycoerythrin-labeled HLA-A*0201/hTERT:540-548 tetrameric complexes (Fig. 2)
. However, none of these T-cell populations specifically recognized HLA-A*0201+ 293 cells, melanomas, or renal cell carcinomas that endogenously expressed telomerase (Table 3)
. In contrast, these CTLs did secrete significant amounts of IFN- in response to several B-cell lines. However, this cytokine secretion did not correlate with recognition of the hTERT:540-548 peptide because PBMCs from these patients before immunization also secreted IFN- in response to these B-cell lines but not in response to hTERT peptide-pulsed T2 cells (Table 3)
.
|
, experiment 1). In a second experiment, the T-cell clones from patient 11 were evaluated for recognition of a larger panel of telomerase+ cell lines, including melanomas, transformed B lymphocytes, renal cell lines, and colon carcinomas. However, none of these cell lines were recognized either (Table 4
, experiment 2) despite highly avid recognition of peptide-pulsed T2 cells. A T-cell clone with high peptide avidity was also derived from patient 3 (clone 13-7) that specifically reacted with T2 cells pulsed with 1 nM hTERT:540-548. Similarly, these cells did not specifically recognize HLA-A*0201+ telomerase+ melanomas, B cells, or renal cell lines (Table 4
, experiments 3–5).
|
|
in response to melanomas expressing HLA-A*0201 and telomerase. In contrast, T cells from the same patient, stimulated in the same microculture format, with gp100:209-217(210M) clearly recognized HLA-A*0201+ melanomas, suggesting that these target cells were capable of antigen processing and epitope presentation (Table 4
, experiment 6).
In other experiments, we used DCs pulsed with hTERT:540-548 as antigen-presenting cells in our stimulation protocol to sensitize PBMCs from nonimmunized HLA-A*0201+ patients with melanoma. PBMCs were initially plated in 96-well plate microcultures with peptide or peptide-pulsed DCs and were restimulated multiple times with peptide-pulsed autologous-irradiated PBMCs. Three peptide reactive microcultures were selected that were initially stimulated with peptide alone, and three were selected that had been stimulated with peptide-pulsed DCs. However, none of these T-cell populations specifically recognized HLA-A*0201+ melanoma cells that naturally expressed telomerase, nor did they secrete IFN- in response to melanoma cells that had been transduced with an adenoviral vector encoding the hTERT gene (Table 5)
. In the same experiment, PBMCs from another patient were initially stimulated with DCs pulsed with an HLA-A*0201-restricted peptide derived from the renal cell carcinoma antigen G250 (G250:254-262; Ref. 25
). In contrast to the cells stimulated with hTERT:540-548, these CTLs specifically recognized the G250 peptide as well as HLA-A*0201+ melanoma cells that had been transduced with an adenovirus encoding the full-length G250 gene.
|
. Results from both types of assays were similar in that T-cell lines specifically recognized hTERT:540-548 peptide but failed to lyse or secrete IFN- in response to HLA-A*0201+ telomerase+ melanoma cell lines.
|
. All FACS analysis profiles were near-normal distributions with no apparent shoulders, and therefore, mean fluorescence intensities were used as statistically relevant data for comparison. T2 cells pulsed with 10 µg/ml hTERT:540-548 were specifically stained with 4G9 Fabs. However, mean fluorescence intensities were significantly decreased when lower peptide concentrations were used, and mean fluorescence intensities of T2 cells pulsed with hTERT:540-548 at concentrations < 0.1 µg/ml were comparable with those of T2 cells pulsed with an irrelevant control peptide (Fig. 4A)
. In addition, no specific staining above background levels was observed for B-cell lines, melanomas, or 293 cells that endogenously expressed HLA-A*0201 and telomerase (Fig. 4, B and C)
. Thus, we did not visualize HLA-A*0201/hTERT:540-548 complexes on cell surfaces using this methodology.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In previous studies that demonstrated a correlation between hTERT peptide and tumor reactivities (3
, 4)
, the bulk T-cell populations that were used may have contained distinct CTL clones, some of which were responsible for peptide recognition and others that accounted for the apparent tumor reactivities (26)
. We observed this phenomenon in bulk T-cell cultures stimulated with the hTERT:540-548 peptide as shown in Table 3
. PBMCs from 4 patients after immunization secreted IFN- in response to peptide-pulsed T2 cells as well as several B-cell lines. However, these reactivities were apparently unrelated because T cells before immunization treated similarly in vitro also secreted cytokine after coculture with the B-cell lines but not in response to the hTERT:540-548 peptide. Therefore, in the absence of a T-cell clone, as defined by a single T-cell receptor, that specifically recognizes both peptide and cells that endogenously express HLA-A*0201 and telomerase, it is not possible to conclude that CTL can recognize hTERT:540-548 on the surfaces of tumor cells.
Another potential explanation for the lack of tumor recognition may have been that peptide reactive T cells did not have sufficient avidity to recognize the low concentrations of peptides on target cell surfaces in the context of HLA-A*0201 molecules after processing and presentation of the full-length hTERT protein. To address this issue, we generated several highly avid T-cell lines and clones that specifically recognized hTERT:540-548 at concentrations of 0.1–1 nM when pulsed onto T2 cells (Table 2)
. These highly avid T cells also did not recognize HLA-A*0201+ hTERT+ cell lines. Correlations between peptide avidity and tumor cell recognition have previously been made for several melanoma-associated epitopes, including MART-1:27-35 (18)
, tyrosinase:8-17 (27)
, gp100:209-217 (28)
, and TRP-2:180-188 (21)
. In these studies, recognition of 1 nM peptide was sufficient to enable recognition of melanoma cells. Although many of the peptide reactive T-cell lines and clones described here met that criteria, it is possible that the avidity threshold for recognition of hTERT:540-548 on tumor cells was still lower than we were able to achieve. However, if this is the case, it seems unlikely that such cells could be routinely generated in vivo after immunization.
We also investigated the possibility that professional APCs were required to stimulate CTL that could recognize cells endogenously expressing hTERT. In some experiments, we initially stimulated PBMCs either with peptide alone or with peptide-pulsed autologous DCs. Although peptide recognition was generated using both protocols, none of these cultures recognized telomerase+ cell lines (Table 4)
.
One explanation for the lack of tumor recognition by hTERT:540-548 reactive lymphocytes was suggested by Ayyoub et al. (18) . In that study, a peptide precursor, hTERT:534-554, was digested by purified proteasomes and immunoproteasomes in vitro. The digestion products were analyzed by mass spectrometry and were evaluated for recognition by a hTERT:540-548 reactive T-cell clone. hTERT:540-548 could not be detected in the digestion products by either methodology, and several mass spectrometric peaks were identified that corresponded to fragments generated by proteasomal cleavage within the epitope. These authors thus suggested that the hTERT:540-548 epitope was digested in the proteasome and was not presented on the surfaces of tumor cells in the context of HLA-A*0201. Although it is possible that other HLA-A*0201-restricted epitopes may exist within telomerase that are presented on the surfaces of tumor cells, our data, together with that of Ayyoub et al. (18) , suggest that the HLA-A*0201-restricted peptide hTERT:540-548 will not be useful for the immunotherapy of patients with cancer.
The results of the work presented here cannot confirm those of a recently published clinical trial in which patients with advanced breast or prostate cancers were immunized with autologous DCs pulsed with hTERT:540-548 and keyhole limpet hemocyanin (29) . Vonderheide et al. (29) reported that peptide-reactive CTLs were induced in 4 of 7 patients who received the vaccine, and recognition of the hTERT:540-548 peptide was correlated with the ability of T cells to lyse tumor cells endogenously expressing HLA-A*0201 and telomerase. In that study, enriched HLA-A*0201/hTERT:540-548 tetramer+ T cells specifically lysed two HLA-A*0201+ telomerase+ tumor lines, but only a single HLA-A*0201– cell was included as a negative control. A different interpretation of data from that investigation may have resulted if a larger panel of target cell lines had been used, including HLA-A*0201+ telomerase– tumor lines and cells transfected or transduced with the full-length hTERT gene.
In summary, although we found evidence of immunization against the peptide in 7 of 14 patients, recognition of the hTERT:540-548 peptide was not associated with that of telomerase+ tumors or cells transduced with a recombinant adenovirus encoding the full-length hTERT gene.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Requests for reprints: Maria Parkhurst, NIH/NCI Surgery Branch, Building 10, Room 2B42, 9000 Rockville Pike, Bethesda, MD 20892-1502. Phone: (301) 435-3026; Fax: (301) 435-5167; E-mail: Maria_Parkhurst{at}nih.gov
Received 2/19/04; revised 4/15/06; accepted 4/19/04.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  L. Wenandy, R. B. Sorensen, L. Sengelov, I. M. Svane, P. thor Straten, and M. H. Andersen The Immunogenicity of the hTERT540-548 Peptide in Cancer Clin. Cancer Res., January 1, 2008; 14(1): 4 - 7. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Domchek, A. Recio, R. Mick, C. E. Clark, E. L. Carpenter, K. R. Fox, A. DeMichele, L. M. Schuchter, M. S. Leibowitz, M. H. Wexler, et al. Telomerase-Specific T-Cell Immunity in Breast Cancer: Effect of Vaccination on Tumor Immunosurveillance Cancer Res., November 1, 2007; 67(21): 10546 - 10555. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Parmiani, V. Russo, A. Marrari, G. Cutolo, C. Casati, L. Pilla, C. Maccalli, L. Rivoltini, and C. Castelli Universal and Stemness-Related Tumor Antigens: Potential Use in Cancer Immunotherapy Clin. Cancer Res., October 1, 2007; 13(19): 5675 - 5679. [Full Text] [PDF]
|
|
|
|
 |
|
 I. Bolonaki, A. Kotsakis, E. Papadimitraki, D. Aggouraki, G. Konsolakis, A. Vagia, C. Christophylakis, I. Nikoloudi, E. Magganas, A. Galanis, et al. Vaccination of Patients With Advanced Non-Small-Cell Lung Cancer With an Optimized Cryptic Human Telomerase Reverse Transcriptase Peptide J. Clin. Oncol., July 1, 2007; 25(19): 2727 - 2734. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Purbhoo, Y. Li, D. H. Sutton, J. E. Brewer, E. Gostick, G. Bossi, B. Laugel, R. Moysey, E. Baston, N. Liddy, et al. The HLA A*0201-restricted hTERT540-548 peptide is not detected on tumor cells by a CTL clone or a high-affinity T-cell receptor Mol. Cancer Ther., July 1, 2007; 6(7): 2081 - 2091. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Hirano, M. O. Butler, Z. Xia, A. Berezovskaya, A. P. Murray, S. Ansen, S. Kojima, and L. M. Nadler Identification of an immunogenic CD8+ T-cell epitope derived from {gamma}-globin, a putative tumor-associated antigen for juvenile myelomonocytic leukemia Blood, October 15, 2006; 108(8): 2662 - 2668. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Adotevi, K. Mollier, C. Neuveut, S. Cardinaud, E. Boulanger, B. Mignen, W.-H. Fridman, M. Zanetti, P. Charneau, E. Tartour, et al. Immunogenic HLA-B*0702-Restricted Epitopes Derived from Human Telomerase Reverse Transcriptase That Elicit Antitumor Cytotoxic T-Cell Responses. Clin. Cancer Res., May 15, 2006; 12(10): 3158 - 3167. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Filaci, M. Fravega, M. Setti, P. Traverso, E. Millo, D. Fenoglio, S. Negrini, F. Ferrera, A. Romagnoli, M. Basso, et al. Frequency of telomerase-specific CD8+ T lymphocytes in patients with cancer Blood, February 15, 2006; 107(4): 1505 - 1512. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Dupont, J.-B. Latouche, C. Ma, and M. Sadelain Artificial Antigen-Presenting Cells Transduced with Telomerase Efficiently Expand Epitope-Specific, Human Leukocyte Antigen-Restricted Cytotoxic T Cells Cancer Res., June 15, 2005; 65(12): 5417 - 5427. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
