
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Oncology, Markers, Clinical Correlates |
1 Division of Thoracic Surgery, Taipei Veterans General Hospital, National Yang-Ming University School of Medicine, Taipei; 2 Department of Life Sciences, National Taiwan Normal University, Taipei; 3 Department of Pathology and 4 Division of Thoracic Surgery, Taichung Veterans General Hospital, Taichung; and 5 Division of Pulmonary and Critical Care Medicine, Department of Internal Medicine, China Medical College Hospital and Institute of Medicine, Chung Shan Medical University, Taichung, Republic of China
| ABSTRACT |
|---|
|
|
|---|
Results: We found that 34% of NSCLC patients had aberrant P14ARF protein expression, which was more frequent in adenocarcinomas (AD; 44%) than in squamous cell carcinomas (22%; P = 0.024). A high concordance was observed between alterations in protein and mRNA expression and 5'CpG hypermethylation (P
0.001). The p14ARF hypermethylation inversely correlated with P53 overexpression (P = 0.001). This mutually exclusive relationship for alteration between p14ARF and p53 was also supported by a worse prognosis of AD patients with positive P14ARF expression (P = 0.01) and of AD patients with P53 overexpression (P = 0.006). Our data also indicated that hemizygous/homozygous deletion and mutation in the p14ARF gene occurred at 26%, 9%, and 0%, respectively, of microdissected NSCLCs.
Conclusions: Our data suggest that p14ARF 5'CpG hypermethylation is the predominant mechanism involved in the aberrant expression of the p14ARF gene. In addition, p14ARF 5'CpG hypermethylation occurs inversely to P53 overexpression.
| INTRODUCTION |
|---|
|
|
|---|
transcript composed of exons 1
, 2, and 3. The other product, P14ARF, is encoded by the smaller ß transcript, which is composed of exons 1ß, 2, and 3 (2)
. It is known that P14ARF and P16INK4a are upstream regulators in the P53 and RB tumor suppressor pathways, respectively. P16INK4a inhibits cyclin-dependent kinases 4 and 6 to phosphorylate RB protein, resulting in the induction of G1 arrest (3)
. P14ARF prevents the MDM2-mediated degradation of P53 protein (4
, 5)
. Thus, P14ARF overexpression leads to the stabilized P53, which then induces several biological responses against DNA damage, such as G1 arrest, G2-M arrest, and apoptosis (5, 6, 7)
. It has also been reported that the P14ARF-mediated G1 and G2 arrests are abolished in mouse embryonic fibroblasts lacking functional P53, indicating that P53 acts downstream of P14ARF in a cell cycle regulatory pathway (8)
. Inactivation of the p16INK4a gene results from intragenic mutation, homozygous/hemizygous deletions, and promoter hypermethylation, and these genetic and epigenetic alterations have been detected frequently in a variety of human cancers (9) including nonsmall cell lung cancer (NSCLC; Refs. 10, 11, 12 ). However, the pathogenic and biological significance of p14ARF gene alterations in human cancers is still unclear. Although the p14ARF null mice (where only the exon 1ß is lost) develop spontaneous tumors at an early age (8) , no germ-line mutations affecting the p14ARF-specific exon 1ß have been identified (13 , 14) , and yet many INK4a/ARF exon 2 mutations alter both the P16INK4a and P14ARF amino acid sequences (15) . Alteration of the P14ARF protein expression is found by using immunohistochemistry in 2541% of NSCLCs (16 , 17) . However, contrary results have been reported when loss of P14ARF expression was correlated with abnormal ß transcripts (16 , 17) . Various loss of heterozygosity (LOH) assays using different microsatellite markers have indicated allelic loss in the 9p21 at various frequencies (12 , 18 , 19) . In two studies of NSCLC, homozygous deletion of p14ARF was indirectly inferred from allelotype pattern at 9p21 (18) or from amplification of a fragment containing noncoding intronic sequence (20) , but this was not confirmed in other studies. Sequence analysis revealed that exon 1ß mutation occurs rarely in the p14ARF gene (16 , 18 , 20) . In data published to date, only a few reports showed p14ARF methylation in 59% of primary NSCLCs (21, 22, 23) . However, the correlation of p14ARF methylation with protein expression was not examined in these studies.
The frequency and mechanisms of p14ARF gene inactivation and their correlation with loss of protein expression in NSCLCs vary between different studies. Furthermore, data concerning the frequency and mechanisms of p14ARF gene inactivation have rarely been documented in the same series of NSCLC. To elucidate the possible mechanisms involved in p14ARF changes in NSCLC tumorigenesis, we performed a comprehensive genetic and epigenetic study of the p14ARF status in a series of 102 NSCLC samples and compared the data with the clinicopathological parameters and prognosis of the patients. To clarify the biological significance of p14ARF alterations, we also analyzed the relationship of p14ARF alterations with p53 and p16INK4a alterations. The results indicated that p14ARF alteration is involved in NSCLC tumorigenesis and mainly results from 5'CpG hypermethylation. In addition, p14ARF hypermethylation inversely correlated with P53 overexpression and occurred frequently in tumors with p16INK4a hypermethylation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Surgically resected tumor samples were immediately snap-frozen and subsequently stored in liquid nitrogen. For the methylation assay, genomic DNA was prepared using proteinase K digestion and phenol-chloroform extraction followed by ethanol precipitation. For LOH, homozygous deletion, and mutation analyses, samples were microdissected to retrieve only tumor tissue from four 5-µm serial sections containing formalin-fixed, paraffin-embedded tumors and normal lung. A 25-gauge needle attached to a tuberculin syringe was used to remove the tumor cells under a dissecting microscope. After samples were de-waxed in xylene, genomic DNA was extracted according to the standard methods described above. For the RNA expression assay, the total RNA were prepared from matched pairs of primary tumors and nearby normal lung tissues using Trizol reagent (Invitrogen, Carlsbad, CA). cDNA was synthesized using SuperScript reverse transcriptase (Invitrogen) with the protocols provided by the manufacturer.
Analysis of Protein Expression: Immunohistochemistry Assay.
Paraffin blocks of tumors were cut into 5-µm slices and then processed using standard deparaffinization and rehydration techniques. Polyclonal antibody p14ARF/p16ß Ab-4 (1:100; NeoMarkers, Union City, CA) was used as the primary antibodies to detect P14ARF protein expression. The primary antibody was detected using biotinylated secondary antibody (DAKO, Carpinteria, CA) according to the manufacturers instructions. The sections were then counterstained with hematoxylin. The stains were graded negative when there was complete absence of staining in the tumor cell nuclei, with adequate nuclear staining in surrounding normal stromal and epithelial cells. The samples were assayed in batches including both negative- and positive-expression patients. The analysis for the P53 expression was described previously (24)
.
Analysis of mRNA Expression: Multiplex Reverse Transcription-PCR (RT-PCR) Assay.
The RNA was extracted, and 96 samples had adequate RNA for additional analysis. p14ARF mRNA expression was assayed in a multiplex RT-PCR analysis using the ß-actin gene as an internal control. The coding regions of exons 12 of the P14ARF gene and the ß-actin gene were amplified using primers described by Gazzeri et al. (16)
. Reactions were carried out in a volume of 25 µl with 1 µl cDNA and 0.25 pmol primers on a DNA thermal cycler. PCR was performed for 35 cycles with an annealing temperature of 70°C. The number of cycles and the amount of primers and the cDNA used were determined to provide quantitative amplification during multiplex RT-PCR. To quantify the relative levels of gene expression in the multiplex RT-PCR assay, the value for the internal standard (ß-actin) in each test tube was used as the baseline value for gene expression in that sample, and a relative value was calculated for each target p14ARF transcript amplified from each tumor and matched normal sample. Tumor cells that exhibited mRNA expression below 50% of that of normal cells were deemed to have an abnormal pattern.
Analysis of 5'CpG Hypermethylation: Restriction Enzyme-Based Multiplex PCR (RE-PCR) Methylation Assay and Methylation-Specific PCR (MSP) Assay.
Samples for the methylation assay were selected on the basis that they were composed of >70% tumor tissue when observed within each of the resected tissue sections at low-power (x100) magnification under a light microscope. Therefore, the methylation assay was performed with 91 samples. The 5'CpG methylation status of the p14ARF and p16INK4a genes were investigated using the BstUI- and SmaI-based multiplex PCR analyses, respectively. The analysis of SmaI-based multiplex PCR for the p16INK4a hypermethylation was described previously (12)
. Genomic DNA from 91 tumor samples (250 ng) were digested either with 3 units of the methylation-sensitive enzyme (BstUI; New England Biolabs, Beverly, MA) or placed in the appropriate buffer without an enzyme for 16 h at 37°C. The DNA was subjected to a second round of digestion by another 3 units of freshly added enzymes to improve specificity and completeness of digestion. The digested DNA was purified by phenol-chloroform extraction followed by ethanol precipitation. Fifty ng of the purified DNA were subjected to the multiplex PCR. The primer nucleotide sequences and thermocycling temperatures were as follows: for the 5'CpG at the exon 1 of p14ARF gene, sense-5'GCTCACCTCTGGTGCCAAAGGGC3'; antisense-5' CTGCCCTAGACGCTGGCTCCT 3'; for the internal control IFNßI sequence, which is located distal to the p14ARF gene and contained no BstUI site, sense-5'ATGAGCTACAACTTGCTTGGA3', antisense-5'TCGGTTTCGGAGGTAACCTGT3'. PCR was performed for 40 cycles with an annealing temperature of 66°C. In addition, DNA from normal lymphocytes and SssI methylase-treated DNA were included in each assay to serve as unmethylated and methylated controls, respectively. An aliquot of each PCR product was resolved on a 1.5% agarose gel. Methylation was determined by the ratio of the normalized intensity (p14ARF/IFNßI) of the samples pretreated with BstUI (+) over the undigested () samples. DNA of normal lung tissues from 30 NSCLC patients was examined, and the ratios were <0.19 for all of the samples. Therefore, a ratio >0.19 was defined as hypermethylation.
The methylation status of the p14ARF gene of 37 tumor samples was also determined by chemical treatment with sodium bisulfite and subsequent methylation-specific PCR (MSP) analysis as described (22) . PCR was performed for 40 cycles with the annealing temperature of 65°C using 60 ng bisulfite-modified DNA and 1 unit of AmpliTaq Gold polymerase (PE Applied Biosystems, Foster City, CA). All of the PCRs were performed with positive controls for both unmethylated and methylated alleles and no DNA control.
LOH in Microdissected Tumor Samples.
Two microsatellite markers locating at the chromosome region harboring the p14ARF gene were used for LOH analysis. These markers were D9S942 (located in intron 1 of the p14ARF gene and 3.7 Kb downstream to the exon 1) and D9S925 (located 3.6 Mb distal to the p14ARF locus). Genomic DNA (20 ng) from normal lung cells or the microdissected tumor samples from 81 informative patients were used for LOH analysis as described previously (12)
.
Comparative Multiplex PCR Assay for Homozygous Deletion in Microdissected Tumor Samples.
Twenty ng of microdissected tumor DNA from 55 patients were subjected to multiplex PCR to determine homozygous deletions. A primer set of intron sequences adjacent to exon 1 or 2 of the p14ARF gene and the 1063.7 sequence as an internal control were included in the same PCR reaction. The c1063.7 sequence is located distal to the p14ARF gene; sense-5'CCGTTTCAGCTTCTCATCAC3', antisense-5'CCGACTGTCCCATTGTGATT3'. The primer nucleotide sequences were as follows: for the exon 1 of the p14ARF gene, sense-5'AGTCTGCAGTTAAGG3'; antisense-5'GGCTAGAGACGAATTATCTGT3' (outer); antisense-5'CACCAAACAAAACAAGTGCG3' (inner); primers for the exon 2 of the p14ARF gene were described previously (12)
. PCR was performed for 40 cycles with an annealing temperature of 55°C and 61°C for exons 1 and 2, respectively. DNA from normal lung tissues was included in each assay to serve as the control. A homozygous deletion was scored if the normalized intensity (p14ARF/c1063.7) was <10%.
Sequencing Analysis of Microdissected Tumor Samples.
Sequencing templates were prepared by the PCR amplification of microdissected DNA from 55 tumor patients using primers described as for the detection of homozygous deletions. PCR products were purified by a Qiagen gel elution kit (Qiagen, Cologne, Germany). Aliquots of the purified DNA were used as templates for cycle sequencing and were run on a 373 DNA Sequencer (Applied Biosystems, Foster City, CA), and the sequences were analyzed using the Sequence Navigator software (Applied Biosystems). Sequencing was performed on both DNA strands.
Statistical Analysis.
Pearsons
2 test was used to compare the frequency of p14ARF alterations in NSCLC patients with different characteristics, including sex and smoking status, and various clinicopathological parameters, such as tumor type and tumor stage. The comparison of age distributions between patients with and without changes in p14ARF was analyzed with a two-sample t test. Type III censoring was performed on subjects who were still alive at the end of the study. The Kaplan-Meier method was used to estimate the probability of survival as a function of time and the median survival. The log rank test was used to assess the significance of the difference between pairs of survival probabilities.
| RESULTS |
|---|
|
|
|---|
2 analysis indicated a highly significant correlation between aberrant P14ARF expression and histological type, recorded as negative staining in 44% (19 of 42) of NSCLC with AD compared with 22% (12 of 54) of NSCLC with SQ (P = 0.024; Table 1
|
|
|
|
|
|
Homozygous Deletion and Intragenic Mutation of the p14ARF in Resected Tumors.
Homozygous deletion of the p14ARF gene was analyzed in 55 microdissected tumors, using comparative multiplex PCR for exon 1 and exon 2 regions. Five patients (9%) showed absence of exon 1 of the p14ARF during the multiplex PCR assay (Fig. 5)
. In the remaining tumors without homozygous deletion of the exon 1 region of p14ARF, no mutation was found by sequencing analysis. In addition, we did not detect any tumors with homozygous deletion in exon 2 of the gene. One case showed a complex mutation at bases 537541 (codons 179 and 180) of the exon 2 region, which was described previously (12)
. Therefore, the mutation frequency of the p14ARF gene was 2% (1 of 55).
|
|
| DISCUSSION |
|---|
|
|
|---|
5'CpG hypermethylation that leads to gene silencing of the p14ARF has been described in bladder, colorectal, hepatocellular, and gastric cancers in the range of 1735% (22 , 25, 26, 27) , but reports are quite limited regarding primary lung cancers. The frequency of 5'CpG hypermethylation of the p14ARF gene reported in this study was 30% (27 of 91) by the RE-PCR assay. However, Zöchbauer-Müller et al. (21) and Esteller et al. (22) found frequencies of 8% (9 of 107) and 5% (1 of 20), respectively, for the p14ARF 5'CpG hypermethylation in NSCLC using the MSP assay. There seems to be at least three possible explanations for the discordance between the last mentioned two studies and the present study. First, the lower methylation frequency detected by the MSP assay compared with the RE-PCR assay may partly result from the fact that the regions examined in the two assays were different and the methylation frequency of the various CpG sites may have been different. In the present study, both RE-PCR and MSP assays were used to examine the methylation status of the p14ARF gene. A high concordance of the methylation status for the hMLH1 gene between the two assays was observed. Therefore, we considered the difference of regions examined to be an unlikely explanation for the discordance between the two assays. Secondly, the ethnic difference may also account for the difference between the three studies. Finally, the varying results may be due, in part, to differences in the types and/or stage of tumors analyzed in the contrasting studies.
5'CpG hypermethylation of p16INK4a, which is another gene located in the INK4a/ARF locus, has also been reported in many cancers by others and our group (9, 10, 11, 12) . The question regarding whether adjacent p16INK4a 5'CpG hypermethylation would be related to 5'CpG hypermethylation of the p14ARF gene was also examined in this study. Our data indicated that 80% (16 of 20) of the patients showing p14ARF 5'CpG hypermethylation were also exhibiting 5'CpG hypermethylation at the p16INK4a gene, suggesting that 5'CpG hypermethylation plays a major role in alteration of the INK4a/ARF locus. It is possible that these tumors belong to the so-called CpG island methylator phenotype group and have many genes of which the expression is down-regulated because of aberrant 5'CpG methylation. More candidate gene approaches and genomic screening techniques that permit simultaneous analysis of 5'CpG methylation of many genes should lead to a more complete knowledge of the epigenetic events occurring in tumors and its functional consequences.
In many cancers, biallelic inactivation of tumor suppressor genes is observed (28 , 29) . This two-step process is reflected by the LOH of polymorphic markers linked to the suppressor gene locus. We looked for such LOH at two microsatellite markers located at the chromosomal region that harbors the p14ARF gene, and examined its correlation with the status of P14ARF expression and 5'CpG hypermethylation. Eighteen samples with no expression of P14ARF protein clearly showed the retention of both alleles and DNA hypermethylation, indicating that biallelic inactivation of p14ARF expression was induced by 5'CpG hypermethylation. Nine samples lacking P14ARF expression but exhibiting aberrant methylation and LOH in the p14ARF gene suggest that biallelic inactivation of the p14ARF gene resulted from the loss of one allele and 5'CpG methylation in the remaining allele. Six tumors with no demonstrable mRNA expression and no evidence of 5'CpG methylation and LOH, other mechanisms such as mutations in promoter region of the gene, or dysfunction of the regulatory proteins could conceivably be involved in the negative mRNA expression. In addition, 2 patients with positive protein and mRNA expression showed promoter methylation. This could be explained by the presence of several distinct tumor subpopulations, one of which has methylation and does not express the gene, the others having no methylation and expressing the gene. After re-evaluating the slides from the immunohistochemistry analysis, these patients showed only 110% of their cells having positive stained nuclei, which was considered low P14ARF expression. Alternatively, partial methylation at only some potential sites or methylation of only one allele in these tumors may result in the positive mRNA/protein expression observed. Our results also indicated that 5 patients with homozygous deletion exhibited no P14ARF expression. The intragenic mutation was not a major cause of p14ARF inactivation in primary NSCLC, which is in agreement with the data reported by others (16 , 18 , 20) . The single mutation in 1 patient resulted in one base substitution and four-base deletion. This complex mutation also changes the fourth ankyrin repeat consensus sequence of P16INK4a protein (12) .
We observed more frequent changes in p14ARF expression in lung AD than in lung SQ. This may be partly explained by its inverse correlation with p53 alteration, which has been shown to be associated with SQ type of NSCLC in our previous study (24) and many other studies (30 , 31) . In addition, p14ARF alteration can be potentially used as a prognostic factor in lung AD. The poor prognosis of AD patients with positive P14ARF expression may result from their association with P53 overexpression, which has been shown to be a poor prognosis factor in AD type of NSCLCs in the present study and other studies (31 , 32) . We also observed an inverse correlation of p14ARF hypermethylation with p53 alteration. The data are consistent with the reports by Vonlanthen et al. (17) and by Xue et al. (33) , which showed a preferential occurrence of loss of P14ARF expression in NSCLC without P53 overexpression. However, several studies observed an absence of the inverse correlation between P14ARF expression and P53 overexpression (18 , 22) . Two proposed explanations for the conflicting results are that selection pressures for alteration in the P53-P14ARF pathway may vary in different tumors, and cancers of different stages were analyzed in various studies. It is possible that functional dysregulation of both p53 and p14ARF genes occurred in a subset of NSCLC.
In conclusion, negative protein expression, aberrant mRNA expression, hypermethylation of the 5'CpG region, and LOH of the p14ARF gene were identified in 34%, 31%, 30%, and 26% of NSCLC patients, respectively, indicating that p14ARF deregulation is involved in NSCLC tumorigenesis. Our data add support to the premise that P14ARF is a tumor suppressor in NSCLC carcinogenesis and show for the first time a frequent p14ARF 5'CpG hypermethylation in lung cancer and an inverse correlation of p14ARF hypermethylation and P53 overexpression in NSCLC tumorigenesis.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Yi-Ching Wang, Department of Life Sciences, National Taiwan Normal University, No. 88, Sec. 4, Tingchou Road, Taipei 116, Republic of China. Phone: 886-2-29336876, extension 373; Fax: 886-2-29312904; E-mail: t43017{at}cc.ntnu.edu.tw
Received 12/10/03; revised 3/26/04; accepted 4/19/04.
| REFERENCES |
|---|
|
|
|---|
and p19ARF/p16ß is frequently altered in non-small cell lung cancer and correlates with p53 overexpression. Oncogene, 17: 2779-85, 1998.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
C. Mascaux, F. Bex, B. Martin, A. Burny, A. Haller, M. Paesmans, K. Willard-Gallo, V. Ninane, and J-P. Sculier The role of NPM, p14arf and MDM2 in precursors of bronchial squamous cell carcinoma Eur. Respir. J., September 1, 2008; 32(3): 678 - 686. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Wang, R.-K. Lin, Y.-H. Tan, J.-T. Chen, C.-Y. Chen, and Y.-C. Wang Wild-Type p53 Overexpression and Its Correlation With MDM2 and p14ARF Alterations: An Alternative Pathway to Non-Small-Cell Lung Cancer J. Clin. Oncol., January 1, 2005; 23(1): 154 - 164. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |