Clinical Cancer Research The Future of Cancer Research: Science and Patient Impact Infection and Cancer: Biology, Therapeutics, and Prevention
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fisher, L. W.
Right arrow Articles by Fedarko, N. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fisher, L. W.
Right arrow Articles by Fedarko, N. S.
Clinical Cancer Research Vol. 10, 8501-8511, December 15, 2004
© 2004 American Association for Cancer Research

Molecular Oncology, Markers, Clinical Correlates

Small Integrin Binding Ligand N-Linked Glycoprotein Gene Family Expression in Different Cancers

Larry W. Fisher1, Alka Jain2, Matt Tayback2 and Neal S. Fedarko2

1 Craniofacial and Skeletal Diseases Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Department of Health and Human Services, Bethesda, Maryland; and 2 Division of Geriatric Medicine, Department of Medicine, Johns Hopkins University, Baltimore, Maryland


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Purpose: Members of the small integrin binding ligand N-linked glycoprotein (SIBLING) gene family have the capacity to bind and modulate the activity of matrix metalloproteinases (MMPs). The expression levels of five SIBLING gene family members [bone sialoprotein (BSP), osteopontin (OPN), dentin matrix protein 1 (DMP1), matrix extracellular phosphoglycoprotein (MEPE), and dentin sialophosphoprotein (DSPP)] and certain MMPs were determined using a commercial cancer array.

Experimental Design: Cancer profiling arrays containing normalized cDNA from both tumor and corresponding normal tissues from 241 individual patients were used to screen for SIBLING and MMP expression in nine distinct cancer types.

Results: Significantly elevated expression levels were observed for BSP in cancer of the breast, colon, stomach, rectum, thyroid, and kidney; OPN in cancer of the breast, uterus, colon, ovary, lung, rectum, and thyroid; DMP1 in cancer of the breast, uterus, colon, and lung; and dentin sialophosphoprotein in breast and lung cancer. The degree of correlation between a SIBLING and its partner MMP was found to be significant within a given cancer type (e.g., BSP and MMP-2 in colon cancer, OPN and MMP-3 in ovarian cancer; DMP1 and MMP-9 in lung cancer). The expression levels of SIBLINGs were distinct within subtypes of cancer (e.g., breast ductal tumors compared with lobular tumors). In general, SIBLING expression increased with cancer stage for breast, colon, lung, and rectal cancer.

Conclusions: These results suggest SIBLINGs as potential markers of early disease progression in a number of different cancer types, some of which currently lack vigorous clinical markers.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The small integrin-binding ligand N-linked glycoprotein (SIBLING) gene family is clustered on human chromosome 4, and its members include bone sialoprotein (BSP), osteopontin (OPN), dentin matrix protein 1 (DMP1), matrix extracellular phosphoglycoprotein (MEPE), and dentin sialophosphoprotein (DSPP; ref. 1 ). SIBLINGs are normally thought to be restricted in expression to mineralizing tissue such as bones and teeth (1) . Retrospective studies using pathological specimens have shown that OPN expression occurs in cancer of the breast, colon, stomach, ovary, lung, thyroid, kidney, prostate, and pancreas (2 , 3) . The expression of other SIBLING members in cancer has not been extensively studied. BSP expression was been reported in breast (4 , 5) , prostate (6) , lung (7) , and thyroid cancer (8) . DMP1 has been shown to be strongly up-regulated in lung cancer (9) . Elevated levels of MEPE mRNA expression by tumors from patients with hypophosphatemia and osteomalacia have been reported (10) . The neoplastic expression pattern of DSPP has not been defined.

Matrix metalloproteinases (MMPs) are critical for development, wound healing, and the progression of cancer. We have recently shown that BSP, OPN, and DMP1 specifically bind to pro–MMP-2, pro–MMP-3, and pro–MMP-9, respectively, thereby activating the latent proteolytic activity (11) . Furthermore, it was shown that active MMPs inhibited by either tissue inhibitors of MMPs or low molecular weight synthetic inhibitors were reactivated by their corresponding SIBLING. The current study was undertaken to determine the mRNA expression patterns of SIBLINGs in nine different types of cancer. An additional goal was to determine whether SIBLINGs exhibited expression levels that correlated with their MMP partners as well as various measures of tumor progression.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cancer Array Analysis.
A cancer profiling array (product 7841-1; Clontech, Palo Alto, CA) containing normalized cDNA from tumor and corresponding normal tissues from 241 individual patients was used to screen for SIBLING and MMP expression (12) . Several cancer profiling arrays were hybridized in ExpressHyb hybridization solution (Clontech) with 32P-labeled cDNA probes as per the manufacturer’s instructions. Briefly, 1 to 2 x 107 cpm of random-prime labeled cDNA was made single stranded by heating to 95°C for 5 minutes and allowed to hybridize with the prepared membrane overnight at 65°C. Membranes were washed in a series of high stringency washes as recommended by the manufacturer. The washed membranes were quantified by exposure to PhosphorImager screens for 1 to 24 hours, and the exposed screen was analyzed on a PhosphorImager (Amersham Biosciences, Piscataway, NJ) using the manufacturer’s ImageQuant program. All polymerase chain reaction (PCR) products were subcloned into a shuttle plasmid, cloned, and sequenced, and the inserts were gel-purified before 32P labeling by random priming. Unincorporated label was removed before hybridization.

SIBLING Probes.
The labeled DNA used for probing was obtained as follows. Human BSP and OPN were cDNA inserts released from OP-10 and B6-5g plasmids, respectively (13 , 14) . Human DMP1 insert was the ~1.4-kb coding region of exon 6 (15) amplified from human genomic DNA subcloned into pBluescript at the EcoRI and BamHI sites using oligonucleotides ATTATAGAATTCAAATGAAGACCCCAGTGAC-AG (forward) and TAATTAGGATCCAATAGCCGTCTTGGCAGTC (reverse). The MEPE probe was a 1.45-kb, exon 5, cDNA insert corresponding to the last exon of human MEPE, which constitutes 95% of the mature protein as defined by Rowe et al. (10) . The exon was amplified by PCR from human genomic DNA using a 5' oligonucleotide with a NdeI restriction site engineered in AGTACCCATATGAAAGACAATATTGG-TTTTCACCAT and a 3' oligonucleotide with a BamHI site (CTGATGGGATCCCTAGTCACCATCGCTCTCAC). The PCRproduct was subcloned into pBluescript and sequenced, and the ~1.5-kb insert was released with NdeI plus BamHI and labeled. The DSPP probe corresponding to the last exon was similarly amplified using a 5' oligonucleotide with a HindIII restriction site engineered in CTGTTGGTACCGATATCGAAATCAAGGGTCCCAGCAG and a 3' oligonucleotide with a KpnI restriction site (GTGCAAAGCTTCTAATCATCACTGGTTGAGTGG), subcloned, and sequenced, and the released ~2.6-kb insert was labeled.

Matrix Metalloproteinase Probes.
Specific probes of ~300 bp each for human MMP-2, MMP-3, and MMP-9 were made by PCR using human genomic DNA as template and the following oligonucleotides: MMP-2, ATTAGGATCCGGTCACAGCTACTTCTTCAAG (forward with BamHI site added for subcloning) and ATATGGATCCGCCTGGGAGGAGTACAG (reverse with BamHI site); MMP-3, ATATGGATCCAGCTGGCTTAATTGTTGAAAG (forward with BamHI) and TAA-TGGATCCAACTGACAAATCGTCTTTATTA (reverse with BamHI); and MMP-9, AATTGAATTCAGAGAAAGCCTA-TTTCTGCCAG (forward with EcoRI) and TAATGAATTCGGTTAGAGAATCCAAGTTTATTAG (reverse with EcoRI). In each case, the PCR products were subcloned into pBluescript and verified by sequencing, and the ~0.3-kb inserts were released and labeled. Membranes were used up to three times, each time removing the previous probe according to the manufacturer’s instructions. The stripped membranes were reimaged by PhosphorImager to verify the removal of the previous probe.

Statistical Analysis.
Clinical data linked to samples spotted on the cancer profiling array were accessed through the manufacturer’s World Wide Web-based database.3 Comparisons between normal and tumor tissue (derived from the same subject) were performed using a paired t test. The coordinated expression of SIBLINGs with MMP binding partners in tumors was tested by regression analysis. Significant differences in tumor subtype expression of SIBLINGs was tested by Student’s t test. The association of SIBLING expression levels with tumor stage was investigated using a conservative statistical approach. The nonparametric Spearman rank order correlation was used to examine the correlation of tumor stage and SIBLING expression. The analysis was performed on untransformed data, and the adjusted Spearman correlation coefficient (rS) is reported. All statistical calculations were carried out using StatView software (SAS Institute, Inc., Cary, NC).


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
SIBLINGs Are Elevated in Multiple Cancer Types.
Because BSP and OPN protein expression have been found to be greatly increased in many separate, often immunohistochemistry-based studies of different neoplasms, the expression levels of five SIBLING gene family members were determined using a commercial cancer array. The array included normalized cDNA from tumor and corresponding normal tissues from 241 individual patients, as well as certain internal controls (Fig. 1)Citation . Because the sample sizes were too small for some tumor types on the array, the tissues reported for this study include only breast, uterus, colon, stomach, ovary, lung, kidney, rectum, and thyroid. In each array experiment, the patient’s normal and tumor cDNA was separately hybridized with 32P-labeled probes for BSP, OPN, DMP1, MEPE, and DSPP, and the array was digitized by PhosphorImager. Whereas BSP, DMP1, and DSPP exhibited minimal normal tissue expression, significant OPN expression by normal tissues was observed. In fact, the highest levels of expression of OPN were seen in normal kidney. Because MEPE expression was minimal in both normal and tumor tissue, its expression was not analyzed further (data not shown). The amount of hybridized probe was quantified, and the average expression values of BSP, OPN, DMP1, and DSPP in normal and tumor tissue were compared (Fig. 2)Citation . The expression levels of BSP were significantly elevated (from 2- to 6-fold) in cancer of the breast, colon, rectum, thyroid, and kidney. OPN expression was significantly elevated (2- to 4-fold) in cancer of the breast, uterus, colon, ovary, lung, rectum, and thyroid. DMP1 exhibited significant (1.7- to 3-fold) elevated expression in cancer of the breast, uterus, colon, and lung, whereas DSPP exhibited significant (2-fold) increase in cancer of the breast and lung. Elevated SIBLING family expression was greatest in breast cancer, in which expression of four different family members was increased. Colon, lung, and thyroid cancer had significantly elevated expression of three different SIBLING family members. Of the nine different types of tumors quantified, each one had a significantly high expression of at least one SIBLING.



View larger version (42K):
[in this window]
[in a new window]
  		Fig. 1. SIBLING expression in different cancer types. A cancer profiling array was hybridized with cDNA probes for SIBLINGs. The arrays contained samples from 13 different types of cancer with paired normal and tumor tissue mRNA from individual subjects (A). The amount of hybridized probe for BSP (B), OPN (C), and DMP1 (D) was visualized by PhosphorImager. br, breast cancer; ut, uterine cancer; co, colon cancer; st, stomach cancer; ov, ovarian cancer; lu, lung cancer; ki, kidney cancer; re, rectal cancer; th, thyroid cancer; n, normal tissue; t, tumor tissue. Those hybridization spots that are not contiguous with the identified tumor types represent patient samples with tumor types too few in number to be statistically useful.

 


View larger version (28K):
[in this window]
[in a new window]
  		Fig. 2. SIBLING mRNAs are induced in multiple cancer types. Digitized exposures from Fig. 1Citation were quantified using ImageQuant software, and the mean values of relative expression of BSP (A), OPN (B), DMP1 (C), and DSPP (D) in normal tissue ({square}) and tumor tissue ({blacksquare}) were determined for each of nine different cancer types. Asterisks denote the statistical significance as determined by paired t tests. *, P ≤ 0.05; **, P ≤ 0.005; ***, P ≤ 0.0001. Error bars represent the SE, and numbers in parentheses represent the number of subjects. OPN expression in both normal and tumor tissue from kidney is shown at one-tenth the actual mean values.

 
Matrix Metalloproteinases Are Elevated in Multiple Cancer Types.
We have recently shown that three members of the SIBLING family can specifically bind and modulate the activity of three different MMPs (11) . The SIBLINGs BSP, OPN, and DMP1 were found to bind to and modulate the activity of MMP-2, MMP-3, and MMP-9, respectively. Corresponding MMP partners for DSPP and MEPE, if any, have yet to be identified. Because MMPs have been postulated to play major roles in tumor cell progression and metastasis (16) , the expression levels of SIBLING-matched MMPs were screened in different cancer types. The cancer arrays were separately hybridized with probes for MMP-2, MMP-3, and MMP-9, and the expression values between normal tissue and the corresponding tumor sample for each patient were compared (Fig. 3)Citation . MMP-2 expression was significantly elevated in cancer of the colon, stomach, lung, and rectum. MMP-3 expression exhibited significant elevation in cancer of the breast, colon, stomach, and rectum. MMP-9 expression levels were significantly elevated in cancer of the breast, uterus, colon, stomach, ovary, lung, rectum, and kidney. The increases in expression ranged from 2- to 3-fold higher for MMP-2 and MMP-3, whereas expression levels were increased 2- to 7-fold for MMP-9.



View larger version (26K):
[in this window]
[in a new window]
  		Fig. 3. MMP mRNAs are induced in multiple cancer types. Cancer profiling arrays were hybridized with cDNA probes for different MMPs, the amount of hybridized probe was quantified using ImageQuant software, and the mean values of expression of MMP-2 (A), MMP-3 (B), and MMP-9 (C) in normal tissue ({square}) and tumor tissue ({blacksquare}) were determined for each of nine different cancer types. Asterisks denote the statistical significance as determined by paired t tests. *, P ≤ 0.05; **, P ≤ 0.005; ***, P ≤ 0.0001. Error bars represent the SE, and numbers in parentheses represent the number of subjects.

 
Correlated Expression of SIBLINGs and Their Partner Matrix Metalloproteinases.
Given the observed binding and activation specificity seen with SIBLINGs and their partner MMPs [BSP with MMP-2, OPN with MMP-3, and DMP1 with MMP-9 (11) ], it was reasonable to postulate that SIBLINGs and their paired MMPs might exhibit correlated expression levels. When the levels of SIBLING and matched MMP expressed by individual tumors were analyzed by regression analysis, significant correlation was seen within different cancer types (Fig. 4)Citation . The expression of BSP and MMP-2 was significantly correlated in breast and colon cancer [r2 = 0.40 (P ≤ 0.0001) and r2 = 0.36 (P ≤ 0.0001), respectively]. OPN pairing with MMP-3 showed a significant correlation in stomach and ovarian cancer [r2 = 0.52 (P ≤ 0.0001) and r2 = 0.45 (P ≤ 0.005), respectively]. DMP1 and MMP-9 expression was significantly correlated in lung and kidney cancer [r2 = 0.60 (P ≤ 0.001) and r2 = 0.39 (P ≤ 0.05), respectively]. Mismatched pairs of BSP with MMP-3, OPN with MMP-2, or DMP1 with MMP-2, for example, showed no significant correlation (data not shown).



View larger version (29K):
[in this window]
[in a new window]
  		Fig. 4. Paired SIBLING and MMP expression is correlated in specific cancers. The expression levels of SIBLINGs and their respective binding partner MMPs were analyzed by regression analysis. BSP and MMP-2 levels in breast (A) and colon cancer (D), OPN and MMP-3 levels in stomach (B) and ovarian cancer (E), as well as DMP1 and MMP-9 levels in lung (C) and rectal cancer (F) were paired by subject and analyzed by regression analysis.

 
SIBLING Expression Is Distinct in Different Cancer Subtypes.
Within cancers arising from a given tissue/organ, there are histopathologically defined subtypes that are often used in assessing disease course and treatment. There were sufficient numbers of breast cancer array samples to permit segregation by clinically defined subtypes of ductal versus lobular tumors. The results of microarray screening of SIBLING expression in breast cancer tissue were segregated by the pathological classification, and the average values of each group were compared (Fig. 5A)Citation . SIBLING mRNA levels were significantly higher in the ductal cancer groups, whereas the levels in the lobular group were intermediate between normal and ductal levels.



View larger version (32K):
[in this window]
[in a new window]
  		Fig. 5. SIBLING expression distinguishes cancer subtypes for breast and uterine tumors. The expression values of BSP, OPN, DMP1, and DSPP by breast cancer tumors were stratified by pathological classification (ductal versus lobular), and the average values were compared (A). Similarly, the expression of SIBLINGs by uterine tumors stratified into groups defined as adenocarcinoma, squamous cell, or benign tumor were averaged and compared (B). Asterisks denote the statistical significance as determined by t test. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.005. Error bars represent the SE.

 
A similar analysis was carried out on uterine cancer samples, where there were sufficient numbers to permit segregation into clinically defined subtypes of adenocarcinoma, squamous cell, and benign tumors (Fig. 5B)Citation . OPN expression was significantly different between the two subtypes of malignant uterine tumors (P ≤ 0.005) and between malignant and benign tumors (P ≤ 0.05). The adenocarcinoma subtype expressed higher levels than the squamous cell subtype.

SIBLING Expression and Tumor Stage.
Defined cancer stages represent how large the tumor is and how far it may have spread. The association of SIBLING expression levels with tumor progression was investigated by identifying tumor types with sufficient clinical detail to stratify into different tumor stages. Tumors from colon, rectal, and lung cancer were grouped by stage, and the distribution of SIBLINGs was compared (Fig. 6)Citation . In general, cancer stages mark tumors that were either localized and had a relatively small size (stage I), localized and larger in size (stage II), metastasized to lymph nodes (stage III), or metastasized to distant sites (stage IV). Colon cancer tumors exhibited mean values of BSP, OPN, DMP1, and DSPP that increased between stage I and stage III. Colon tumors with distant metastases exhibited SIBLING values with a similar or lower pattern of distribution than that of stage III tumors. Rectal cancer tumors showed increasing BSP, OPN, and DMP1 levels from stage I to stage IV, whereas DSPP values were unchanged across different stages. In lung cancer, BSP, OPN, and DSPP levels increased with increasing stage. When the association of SIBLING expression and tumor stage in colon cancer was analyzed by Spearman rank order correlation analysis, only BSP was significantly correlated (Table 1)Citation . In rectal tumors, BSP, OPN, and DMP1 levels correlated with stage, whereas for lung cancer, BSP, OPN, and DSPP levels correlated with stage.



View larger version (35K):
[in this window]
[in a new window]
  		Fig. 6. Comparison of SIBLING mRNA levels with tumor stage in colon, rectal, and lung cancer. The expression values of BSP (A–C), OPN (D–F), DMP1 (G–I), and DSPP (J–L) by colon cancer tumors (A, D, G, and J), rectal cancer tumors (B, E, H, and K), and lung cancer tumors (C, F, I, and L) were stratified by pathological classification (stage), and the average values were compared. Top line, bottom line, and line through the middle correspond to 75th percentile, 25th percentile, and 50th percentile (median), respectively. Error bar whiskers represent the 10th and 90th percentile, whereas {blacksquare} indicates the arithmetic mean. Rectal and colon cancer stages were as follows: I, tumor invaded submucosa; II, tumor invaded through muscularis propia; III, invasive tumor with metastasis in one to three pericolic or perirectal lymph nodes; and IV, invasive tumor with metastasis in pericolic or perirectal lymph nodes and distant metastasis. Lung cancer stages were as follows: I, tumor < 3 cm in greatest dimension; IB, tumor > 3 cm in greatest dimension, involved main bronchus, associated with atelectasis or obstructive pneumonitis; II, metastasis to ipsilateral peribronchial and/or ipsolateral lymph nodes; and III, metastasis to ipsilateral mediastinal, and/or subcarinal lymph nodes. The number of subjects (n) for each group is shown at the bottom.

 

View this table:
[in this window]
[in a new window]
  		Table 1 SIBLING expression and tumor staging

 
Breast cancer tumors were stratified into tumor-node-metastasis (TNM) stages, which reflect tumor size (T), lymph node involvement (N), and metastatic state (M). Enough breast tumor samples were analyzed to enable the analysis of SIBLING expression and tumor progression. Tumors were grouped by TNM stage, and the stages were ordered in sequence of increasing progression. The sequence of tumors ranged from those with no nodal involvement or metastasis state (N0M0) that increased in size as well as N1M0 tumors that increased in size. For BSP, OPN, DMP1, and DSPP, significant differences were observed in the expression pattern as a function of tumor progression (Fig. 7Citation ; Table 1Citation ). Spearman rank order correlation analysis of SIBLING values and TNM stage yielded significant correlation for all four SIBLINGs.



View larger version (25K):
[in this window]
[in a new window]
  		Fig. 7. Comparison of SIBLING mRNA levels and tumor stage in breast cancer. The expression values of BSP (A), OPN (B), DMP1 (C), and DSPP (D) by breast cancer tumors were stratified by increasing TNM stage, and the values were compared. Top line, bottom line, and line through the middle correspond to 75th percentile, 25th percentile, and 50th percentile (median), respectively. Error bar whiskers represent the 10th and 90th percentile, whereas {blacksquare} indicates the arithmetic mean. Breast cancer TNM staging was as follows: T1, tumor ≤ 2 cm in greatest dimension; T2, 2 cm < tumor < 5 cm; T3, tumor > 5 cm; N0, no regional lymph node metastasis; N1, metastasis to movable ipsilateral axillary lymph node(s); N2, metastasis to movable ipsilateral axillary lymph node(s) fixed to one another or to other structure; M0, no distant metastasis; and M1, distant metastasis. The number of subjects (n) for each group is shown at the bottom. The normal group consisted of the 36 normal breast tissue samples corresponding to the 36 paired tumor tissues with well-defined TNM stage.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Microarray technology has been typically used to screen the simultaneous expression of many genes using an array spotted with thousands of genes and measuring hybridization of target cDNA generated from a given tissue or cell type. In contrast, the cancer profiling array used in the current study was developed to enable the quantification of expression of a single gene across multiple tissue types and tumor stages. The cancer profiling array contained multiple cDNA pairs from normal and tumor tissues including breast, uterus, colon, stomach, ovary, lung, kidney, rectum, thyroid, prostate, small intestine, pancreas, and cervix. Complementary DNA was generated by an efficient cDNA amplification technique that is based on the switching mechanism at the 5' end of mRNA templates (17) . This methodology has been shown to yield a high representation of mRNA transcripts, avoidance of biased amplification, linearity of signal, and recapitulation of the complexity of the original mRNA (12) . Because the expression of individual housekeeping genes varies between normal and tumor tissue (18, 19, 20) , the equal loading of cDNA onto the array membrane was carried out by normalizing to the average expression of three housekeeping genes: ubiquitin, ß-actin, and Mr 23,000 highly basic protein (12 , 21) . The array has recently been used to profile a number of genes that exhibited either up- or down-regulation in cancer including gelsolin and glutathione peroxidase (12) , netrin 1 (22) , thiamin transporter THTR2 (23) , PAGE 4 (24) , and XAGE-1 (25) . Strong correlation between tumor tissue expression by the current cDNA microarray and by in situ hybridization (24 , 25) as well as reverse transcription-PCR and immunohistochemical staining (26 , 27) has been observed.

The microarray design pairing normalized cDNA from an individual subject’s tumor and normal tissue enabled differences in expression to be analyzed by paired t test, which provided a greater power to detect significant differences. Another method of evaluating the significance of biomarker elevation is to compare target tissue measures to a cut point of the mean of normal levels plus twice the SD (m + 2 SD). A value of >m + 2 SD translates to a <5% probability that the elevation is due to chance (95% of normal values will lie within the m + 2 SD range). The overall significance of the microarray results was assessed by comparing concordance between these two methods of analysis, as well as comparison with the published results of other studies (Table 2)Citation . Elevated BSP expression was identified in two tissues (breast and thyroid), in agreement with previous studies. The current results for BSP did not replicate previous reports on elevated expression in cancer of the uterus or lung. Novel expression was identified in four different cancer types (colon, stomach, rectum, and kidney). Elevated OPN expression was observed in the current study in four different cancer types (breast, colon, ovary, and lung) in agreement with other published studies. For cancer of the stomach, thyroid, and kidney, the OPN expression levels and published literature were not in concordance. Novel expression of OPN in cancer of the uterus and rectum was identified. Elevated DMP1 expression was confirmed in lung cancer and newly identified in breast cancer. DMP1 levels in cancer of the uterus and colon, although significantly elevated by paired t test, did not satisfy the >m + 2 SD criteria. DSPP expression was elevated significantly by both criteria in lung cancer, but only by paired t test in breast cancer. Cancers for which the two analysis methods were not in accordance are obvious targets for further, more extensive studies.


View this table:
[in this window]
[in a new window]
  		Table 2 SIBLING expression in different cancer types

 
The observed increase in MMP-2 expression observed in tumor samples is consistent with previous studies of breast (41 , 42) , colon (43, 44, 45, 46, 47) , stomach (48 , 49) , lung (50, 51, 52, 53) , rectal (43 , 54) , and kidney cancer (55, 56, 57) . Whereas a strong association of increased MMP-3 has been found in breast cancer (41 , 58, 59, 60, 61) , the increased expression levels observed in other tumor types are not as well supported by published literature. Altered MMP-3 levels have been observed in colon (62, 63, 64) , stomach (65, 66, 67) , and rectal (68) cancer, although in some cases, the increases were relatively small. In addition, studies have indicated that the MMP-3 source was not necessarily tumor cell but stromal cell or another infiltrating cell type, distinct from the tumor. The observed increases in MMP-9 expression are consistent with published studies of breast (41 , 69) , uterine (70 , 71) , colon (46 , 53 , 72) , stomach (73, 74, 75) , ovarian (76 , 77) , lung (50 , 78) , rectal (43 , 79) , and kidney cancer (56 , 80) .

A correlation of SIBLING message expression levels with MMP message levels of their partners (BSP with MMP-2, OPN with MMP-3, and DMP1 with MMP-9) was observed. That, in association with the recently described ability of these SIBLINGs to bind to and modulate the activity of specific MMPs, suggests that the same factors that activate SIBLING genes in tumor progression may be the same ones that can activate the corresponding MMP genes. It is also possible that the expression of one SIBLING member in a tumor may induce the production of its corresponding MMP partner, or vice versa. Interestingly, SIBLING production by tumors could facilitate angiogenesis because both BSP and OPN have been shown to possess angiogenesis activity in vivo (81 , 82) .

SIBLING expression was different between different subtypes of cancer. Whereas the historical basis for the distinction between the main two types of breast cancer (the belief that ductal carcinomas arose from ducts and lobular carcinomas from lobules) is subject to debate (both can arise from the terminal duct lobular unit), there is evidence that the two classes as used clinically refer to disease entities that differ in tumor size, shape, dissemination, and proliferation rates (83) . The most common hallmark associated with the lobular classification is multifocality. Lobular tumors tend to be more slowly proliferating than ductal tumors. They also tend to frequently exhibit hormone receptor positivity and show distinct chromosomal changes (84 , 85) . The more rapidly progressing ductal tumors had an associated higher level of SIBLING expression. OPN was recently identified by microarray analysis as a discriminating marker between ductal and lobular cancer (86) . In our current study, OPN, as well as BSP, DMP1, and DSPP were significantly different between lobular and ductal tumors. Similarly, the association of higher OPN expression with adenocarcinomas as opposed to squamous cell carcinomas in uterine cancer may be associated with different size, shape, and progression rates.

SIBLING expression correlated with tumor stages associated with changing size and lymph node involvement. These observations are consistent with SIBLING expression coupled with MMP activity modulation having an effect on early tumor progression. These results suggest SIBLINGs as potential markers of early disease progression in a number of different cancers. Future studies of SIBLING expression and serum levels will address the degree to which these tumor biomarkers can be correlated with disease progression.


   FOOTNOTES
 
Grant support: Grants CA 87311 (N. Fedarko) and DAMD17-02-0684 (N. Fedarko).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Neal S. Fedarko, Room 5A-64 JHAAC, 5501 Hopkins Bayview Circle, Baltimore, MD 21224. Phone: 410-550-2632; Fax: 410-550-1007; E-mail: ndarko{at}jhmi.edu

3 http://bioinfo.clonetech.com/dparray/array-list-action.do. Back

Received 6/ 1/04; revised 9/10/04; accepted 9/17/04.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Fisher LW, Fedarko NS. Six genes expressed in bones and teeth encode the current members of the SIBLING family of proteins. Connect Tissue Res 2003;44(Suppl 1):33-40.
  2. Brown LF, Papadopoulos-Sergiou A, Berse B, et al Osteopontin expression and distribution in human carcinomas. Am J Pathol 1994;145:610-23.[Abstract]
  3. Coppola D, Szabo M, Boulware D, et al Correlation of osteopontin protein expression and pathological stage across a wide variety of tumor histologies. Clin Cancer Res 2004;10:184-90.[Abstract/Free Full Text]
  4. Bellahcene A, Merville MP, Castronovo V. Expression of bone sialoprotein, a bone matrix protein, in human breast cancer. Cancer Res 1994;54:2823-6.[Abstract/Free Full Text]
  5. Waltregny D, Bellahcene A, de Leval X, et al Increased expression of bone sialoprotein in bone metastases compared with visceral metastases in human breast and prostate cancers. J Bone Miner Res 2000;15:834-43.[CrossRef][Medline]
  6. Waltregny D, Bellahcene A, Van Riet I, et al Prognostic value of bone sialoprotein expression in clinically localized human prostate cancer. J Natl Cancer Inst (Bethesda) 1998;90:1000-8.[Abstract/Free Full Text]
  7. Bellahcene A, Maloujahmoum N, Fisher LW, et al Expression of bone sialoprotein in human lung cancer. Calcif Tissue Int 1997;61:183-8.[CrossRef][Medline]
  8. Bellahcene A, Albert V, Pollina L, et al Ectopic expression of bone sialoprotein in human thyroid cancer. Thyroid 1998;8:637-41.[Medline]
  9. Chaplet M, De Leval L, Waltregny D, et al Dentin matrix protein 1 is expressed in human lung cancer. J Bone Miner Res 2003;18:1506-12.[CrossRef][Medline]
  10. Rowe PS, de Zoysa PA, Dong R, et al MEPE, a new gene expressed in bone marrow and tumors causing osteomalacia. Genomics 2000;67:54-68.[CrossRef][Medline]
  11. Fedarko NS, Jain A, Karadag A, Fisher LW. Three small integrin binding ligand N-linked glycoproteins (SIBLINGs) bind and activate specific matrix metalloproteinases. FASEB J 2004;18:734-6.[Abstract/Free Full Text]
  12. Zhumabayeva B, Diatchenko L, Chenchik A, Siebert PD. Use of SMART-generated cDNA for gene expression studies in multiple human tumors. Biotechniques 2001;30:158-63.[Medline]
  13. Fisher LW, McBride OW, Termine JD, Young MF. Human bone sialoprotein. Deduced protein sequence and chromosomal localization. J Biol Chem 1990;265:2347-51.[Abstract/Free Full Text]
  14. Oldberg A, Franzen A, Heinegard D. Cloning and sequence analysis of rat bone sialoprotein (osteopontin) cDNA reveals an Arg-Gly-Asp cell-binding sequence. Proc Natl Acad Sci USA 1986;83:8819-23.[Abstract/Free Full Text]
  15. Hirst KL, Simmons D, Feng J, et al Elucidation of the sequence and the genomic organization of the human dentin matrix acidic phosphoprotein 1 (DMP1) gene: exclusion of the locus from a causative role in the pathogenesis of dentinogenesis imperfecta type II. Genomics 1997;42:38-45.[CrossRef][Medline]
  16. Freije JM, Balbin M, Pendas AM, et al Matrix metalloproteinases and tumor progression. Adv Exp Med Biol 2003;532:91-107.[Medline]
  17. Chenchik A, Zhu YY, Diatchenko L, Li R, Hill J, Siebert PD. Generation and use of high-quality cDNA from small amounts of total RNA by SMART PCR Siebert P Larrick J eds. . Gene Cloning and Analysis by RT-PCR 1998p. 305-19. Eaton Publishing Natick, MA
  18. Blanquicett C, Johnson MR, Heslin M, Diasio RB. Housekeeping gene variability in normal and carcinomatous colorectal and liver tissues: applications in pharmacogenomic gene expression studies. Anal Biochem 2002;303:209-14.[CrossRef][Medline]
  19. Rondinelli RH, Epner DE, Tricoli JV. Increased glyceraldehyde-3-phosphate dehydrogenase gene expression in late pathological stage human prostate cancer. Prostate Cancer Prostatic Dis 1997;1:66-72.[CrossRef][Medline]
  20. Aerts JL, Gonzales MI, Topalian SL. Selection of appropriate control genes to assess expression of tumor antigens using real-time RT-PCR. Biotechniques 2004;36:84-6, 88, 901.[Medline]
  21. Zhumabayeva B, Chenchik A, Siebert PD, Herrler M. Disease profiling arrays: reverse format cDNA arrays complimentary to microarrays. Adv Biochem Eng Biotechnol 2004;86:191-213.[Medline]
  22. Thiebault K, Mazelin L, Pays L, et al The netrin-1 receptors UNC5H are putative tumor suppressors controlling cell death commitment. Proc Natl Acad Sci USA 2003;100:4173-8.[Abstract/Free Full Text]
  23. Liu S, Huang H, Lu X, et al Down-regulation of thiamine transporter THTR2 gene expression in breast cancer and its association with resistance to apoptosis. Mol Cancer Res 2003;1:665-73.[Abstract/Free Full Text]
  24. Iavarone C, Wolfgang C, Kumar V, et al PAGE4 is a cytoplasmic protein that is expressed in normal prostate and in prostate cancers. Mol Cancer Ther 2002;1:329-35.[Abstract/Free Full Text]
  25. Egland KA, Kumar V, Duray P, Pastan I. Characterization of overlapping XAGE-1 transcripts encoding a cancer testis antigen expressed in lung, breast, and other types of cancers. Mol Cancer Ther 2002;1:441-50.[Abstract/Free Full Text]
  26. Sers C, Husmann K, Nazarenko I, et al The class II tumour suppressor gene H-REV107-1 is a target of interferon-regulatory factor-1 and is involved in IFNgamma-induced cell death in human ovarian carcinoma cells. Oncogene 2002;21:2829-39.[CrossRef][Medline]
  27. Wiechen K, Diatchenko L, Agoulnik A, et al Caveolin-1 is down-regulated in human ovarian carcinoma and acts as a candidate tumor suppressor gene. Am J Pathol 2001;159:1635-43.[Abstract/Free Full Text]
  28. Bellahcene A, Menard S, Bufalino R, Moreau L, Castronovo V. Expression of bone sialoprotein in primary human breast cancer is associated with poor survival. Int J Cancer 1996;69:350-3.[CrossRef][Medline]
  29. Detry C, Waltregny D, Quatresooz P, et al Detection of bone sialoprotein in human (pre)neoplastic lesions of the uterine cervix. Calcif Tissue Int 2003;73:9-14.[CrossRef][Medline]
  30. Gillespie MT, Thomas RJ, Pu ZY, et al Calcitonin receptors, bone sialoprotein and osteopontin are expressed in primary breast cancers. Int J Cancer 1997;73:812-5.[CrossRef][Medline]
  31. Tuck AB, O’Malley FP, Singhal H, et al Osteopontin expression in a group of lymph node negative breast cancer patients. Int J Cancer 1998;79:502-8.[CrossRef][Medline]
  32. Yeatman TJ, Chambers AF. Osteopontin and colon cancer progression. Clin Exp Metastasis 2003;20:85-90.[CrossRef][Medline]
  33. Agrawal D, Chen T, Irby R, et al Osteopontin identified as lead marker of colon cancer progression, using pooled sample expression profiling. J Natl Cancer Inst (Bethesda) 2002;94:513-21.[Abstract/Free Full Text]
  34. Maeng HY, Choi DK, Takeuchi M, et al Appearance of osteonectin-expressing fibroblastic cells in early rat stomach carcinogenesis and stomach tumors induced with N-methyl-N'-nitro-N-nitrosoguanidine. Jpn J Cancer Res 2002;93:960-7.[Medline]
  35. Ue T, Yokozaki H, Kitadai Y, et al Co-expression of osteopontin and CD44v9 in gastric cancer. Int J Cancer 1998;79:127-32.[CrossRef][Medline]
  36. Kim JH, Skates SJ, Uede T, et al Osteopontin as a potential diagnostic biomarker for ovarian cancer. JAMA 2002;287:1671-9.[Abstract/Free Full Text]
  37. Tiniakos DG, Yu H, Liapis H. Osteopontin expression in ovarian carcinomas and tumors of low malignant potential (LMP). Hum Pathol 1998;29:1250-4.[CrossRef][Medline]
  38. Zhang J, Takahashi K, Takahashi F, et al Differential osteopontin expression in lung cancer. Cancer Lett 2001;171:215-22.[CrossRef][Medline]
  39. Chambers AF, Wilson SM, Kerkvliet N, et al Osteopontin expression in lung cancer. Lung Cancer 1996;15:311-23.[CrossRef][Medline]
  40. Tunio GM, Hirota S, Nomura S, Kitamura Y. Possible relation of osteopontin to development of psammoma bodies in human papillary thyroid cancer. Arch Pathol Lab Med 1998;122:1087-90.[Medline]
  41. Lebeau A, Nerlich AG, Sauer U, Lichtinghagen R, Lohrs U. Tissue distribution of major matrix metalloproteinases and their transcripts in human breast carcinomas. Anticancer Res 1999;19:4257-64.[Medline]
  42. Onisto M, Riccio MP, Scannapieco P, et al Gelatinase A/TIMP-2 imbalance in lymph-node-positive breast carcinomas, as measured by RT-PCR. Int J Cancer 1995;63:621-6.[Medline]
  43. Liabakk NB, Talbot I, Smith RA, Wilkinson K, Balkwill F. Matrix metalloprotease 2 (MMP-2) and matrix metalloprotease 9 (MMP-9) type IV collagenases in colorectal cancer. Cancer Res 1996;56:190-6.[Abstract/Free Full Text]
  44. Ornstein DL, MacNab J, Cohn KH. Evidence for tumor-host cooperation in regulating MMP-2 expression in human colon cancer. Clin Exp Metastasis 1999;17:205-12.[CrossRef][Medline]
  45. Karakiulakis G, Papanikolaou C, Jankovic SM, et al Increased type IV collagen-degrading activity in metastases originating from primary tumors of the human colon. Invasion Metastasis 1997;17:158-68.[Medline]
  46. Collins HM, Morris TM, Watson SA. Spectrum of matrix metalloproteinase expression in primary and metastatic colon cancer: relationship to the tissue inhibitors of metalloproteinases and membrane type-1-matrix metalloproteinase. Br J Cancer 2001;84:1664-70.[CrossRef][Medline]
  47. Papadopoulou S, Scorilas A, Arnogianaki N, et al Expression of gelatinase-A (MMP-2) in human colon cancer and normal colon mucosa. Tumour Biol 2001;22:383-9.[CrossRef][Medline]
  48. Mori M, Mimori K, Shiraishi T, et al Analysis of MT1-MMP and MMP2 expression in human gastric cancers. Int J Cancer 1997;74:316-21.[CrossRef][Medline]
  49. Ohtani H, Nagai T, Nagura H. Similarities of in situ mRNA expression between gelatinase A (MMP-2) and type I procollagen in human gastrointestinal carcinoma: comparison with granulation tissue reaction. Jpn J Cancer Res 1995;86:833-9.[CrossRef][Medline]
  50. Nakagawa H, Yagihashi S. Expression of type IV collagen and its degrading enzymes in squamous cell carcinoma of lung. Jpn J Cancer Res 1994;85:934-8.[CrossRef][Medline]
  51. Yamamoto M, Mohanam S, Sawaya R, et al Differential expression of membrane-type matrix metalloproteinase and its correlation with gelatinase A activation in human malignant brain tumors in vivo and in vitro. Cancer Res 1996;56:384-92.[Abstract/Free Full Text]
  52. Suzuki M, Iizasa T, Fujisawa T, et al Expression of matrix metalloproteinases and tissue inhibitor of matrix metalloproteinases in non-small-cell lung cancer. Invasion Metastasis 1998;18:134-41.[CrossRef][Medline]
  53. Creighton C, Hanash S. Expression of matrix metalloproteinase 9 (MMP-9/gelatinase B) in adenocarcinomas strongly correlated with expression of immune response genes. In Silico Biol 2003;3:301-11.[Medline]
  54. Chan CC, Menges M, Orzechowski HD, et al Increased matrix metalloproteinase 2 concentration and transcript expression in advanced colorectal carcinomas. Int J Colorectal Dis 2001;16:133-40.[CrossRef][Medline]
  55. Kitagawa Y, Kunimi K, Uchibayashi T, Sato H, Namiki M. Expression of messenger RNAs for membrane-type 1, 2, and 3 matrix metalloproteinases in human renal cell carcinomas. J Urol 1999;162:905-9.[CrossRef][Medline]
  56. Hagemann T, Gunawan B, Schulz M, Fuzesi L, Binder C. mRNA expression of matrix metalloproteases and their inhibitors differs in subtypes of renal cell carcinomas. Eur J Cancer 2001;37:1839-46.
  57. Slaton JW, Inoue K, Perrotte P, et al Expression levels of genes that regulate metastasis and angiogenesis correlate with advanced pathological stage of renal cell carcinoma. Am J Pathol 2001;158:735-43.[Abstract/Free Full Text]
  58. Freije JM, Diez-Itza I, Balbin M, et al Molecular cloning and expression of collagenase-3, a novel human matrix metalloproteinase produced by breast carcinomas. J Biol Chem 1994;269:16766-73.[Abstract/Free Full Text]
  59. Basset P, Bellocq JP, Anglard P, et al Stromelysin-3 and other stromelysins in breast cancer: importance of epithelialstromal interactions during tumor progression. Cancer Treat Res 1996;83:353-67.[Medline]
  60. Iwata H, Kobayashi S, Iwase H, et al Production of matrix metalloproteinases and tissue inhibitors of metalloproteinases in human breast carcinomas. Jpn J Cancer Res 1996;87:602-11.[CrossRef][Medline]
  61. Chenard MP, O’Siorain L, Shering S, et al High levels of stromelysin-3 correlate with poor prognosis in patients with breast carcinoma. Int J Cancer 1996;69:448-51.[CrossRef][Medline]
  62. Baker EA, Bergin FG, Leaper DJ. Matrix metalloproteinases, their tissue inhibitors and colorectal cancer staging. Br J Surg 2000;87:1215-21.[CrossRef][Medline]
  63. Gallegos NC, Smales C, Savage FJ, Hembry RM, Boulos PB. The distribution of matrix metalloproteinases and tissue inhibitor of metalloproteinases in colorectal cancer. Surg Oncol 1995;4:21-9.[Medline]
  64. Matrisian LM, Wright J, Newell K, Witty JP. Matrix-degrading metalloproteinases in tumor progression. Princess Takamatsu Symp 1994;24:152-61.[Medline]
  65. Murray GI, Duncan ME, Arbuckle E, Melvin WT, Fothergill JE. Matrix metalloproteinases and their inhibitors in gastric cancer. Gut 1998;43:791-7.[Abstract/Free Full Text]
  66. Nomura H, Fujimoto N, Seiki M, Mai M, Okada Y. Enhanced production of matrix metalloproteinases and activation of matrix metalloproteinase 2 (gelatinase A) in human gastric carcinomas. Int J Cancer 1996;69:9-16.[CrossRef][Medline]
  67. Saarialho-Kere UK, Vaalamo M, Puolakkainen P, et al Enhanced expression of matrilysin, collagenase, and stromelysin-1 in gastrointestinal ulcers. Am J Pathol 1996;148:519-26.[Abstract]
  68. Imai K, Yokohama Y, Nakanishi I, et al Matrix metalloproteinase 7 (matrilysin) from human rectal carcinoma cells. Activation of the precursor, interaction with other matrix metalloproteinases and enzymic properties. J Biol Chem 1995;270:6691-7.[Abstract/Free Full Text]
  69. Pacheco MM, Mourao M, Mantovani EB, Nishimoto IN, Brentani MM. Expression of gelatinases A and B, stromelysin-3 and matrilysin genes in breast carcinomas: clinico-pathological correlations. Clin Exp Metastasis 1998;16:577-85.[CrossRef][Medline]
  70. Davidson B, Goldberg I, Liokumovich P, et al Expression of metalloproteinases and their inhibitors in adenocarcinoma of the uterine cervix. Int J Gynecol Pathol 1998;17:295-301.[Medline]
  71. Davidson B, Goldberg I, Kopolovic J, et al Expression of matrix metalloproteinase-9 in squamous cell carcinoma of the uterine cervix-clinicopathologic study using immunohistochemistry and mRNA in situ hybridization. Gynecol Oncol 1999;72:380-6.[CrossRef][Medline]
  72. Takeha S, Fujiyama Y, Bamba T, et al Stromal expression of MMP-9 and urokinase receptor is inversely associated with liver metastasis and with infiltrating growth in human colorectal cancer: a novel approach from immune/inflammatory aspect. Jpn J Cancer Res 1997;88:72-81.[Medline]
  73. Parsons SL, Watson SA, Collins HM, et al Gelatinase (MMP-2 and -9) expression in gastrointestinal malignancy. Br J Cancer 1998;78:1495-502.[Medline]
  74. Torii A, Kodera Y, Ito M, et al Matrix metalloproteinase 9 in mucosally invasive gastric cancer. Gastric Cancer 1998;1:142-5.[CrossRef][Medline]
  75. Wang L, Zhang LH, Li YL, Liu Z. Expression of MMP-9 and MMP-9 mRNA in gastric carcinoma and its correlation with angiogenesis[in Chinese]. Zhonghua Yi Xue Za Zhi 2003;83:782-6.[Medline]
  76. Sakata K, Shigemasa K, Nagai N, Ohama K. Expression of matrix metalloproteinases (MMP-2, MMP-9, MT1-MMP) and their inhibitors (TIMP-1, TIMP-2) in common epithelial tumors of the ovary. Int J Oncol 2000;17:673-81.[Medline]
  77. Davidson B, Goldberg I, Gotlieb WH, et al High levels of MMP-2, MMP-9, MT1-MMP and TIMP-2 mRNA correlate with poor survival in ovarian carcinoma. Clin Exp Metastasis 1999;17:799-808.[CrossRef][Medline]
  78. Kremer EA, Chen Y, Suzuki K, Nagase H, Gorski JP. Hydroxyapatite induces autolytic degradation and inactivation of matrix metalloproteinase-1 and -3. J Bone Miner Res 1998;13:1890-902.[CrossRef][Medline]
  79. Roeb E, Dietrich CG, Winograd R, et al Activity and cellular origin of gelatinases in patients with colon and rectal carcinoma differential activity of matrix metalloproteinase-9. Cancer (Phila) 2001;92:2680-91.
  80. Inoue K, Kamada M, Slaton JW, et al The prognostic value of angiogenesis and metastasis-related genes for progression of transitional cell carcinoma of the renal pelvis and ureter. Clin Cancer Res 2002;8:1863-70.[Abstract/Free Full Text]
  81. Hirama M, Takahashi F, Takahashi K, et al Osteopontin overproduced by tumor cells acts as a potent angiogenic factor contributing to tumor growth. Cancer Lett 2003;198:107-17.[CrossRef][Medline]
  82. Bellahcene A, Bonjean K, Fohr B, et al Bone sialoprotein mediates human endothelial cell attachment and migration and promotes angiogenesis. Circ Res 2000;86:885-91.[Abstract/Free Full Text]
  83. Sainsbury JRC, Anderson TJ, Morgan DAL. Breast cancer. Br Med J 2000;321:745-50.[Free Full Text]
  84. Coradini D, Pellizzaro C, Veneroni S, Ventura L, Daidone MG. Infiltrating ductal and lobular breast carcinomas are characterized by different interrelationships among markers related to angiogenesis and hormone dependence. Br J Cancer 2002;87:1105-11.[CrossRef][Medline]
  85. Gunther K, Merkelbach-Bruse S, Amo-Takyi BK, et al Differences in genetic alterations between primary lobular and ductal breast cancers detected by comparative genomic hybridization. J Pathol 2001;193:40-7.[CrossRef][Medline]
  86. Korkola JE, DeVries S, Fridlyand J, et al Differentiation of lobular versus ductal breast carcinomas by expression microarray analysis. Cancer Res 2003;63:7167-75.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Dent. Res.Home page
C. Qin, R. D'Souza, and J.Q. Feng
Dentin Matrix Protein 1 (DMP1): New and Important Roles for Biomineralization and Phosphate Homeostasis
J. Dent. Res., December 1, 2007; 86(12): 1134 - 1141.
[Abstract] [Full Text] [PDF]

Home page
 J. Histochem. Cytochem.Home page
L. R. Amir, A. Jovanovic, F. B.T. Perdijk, S. Toyosawa, V. Everts, and A. L.J.J. Bronckers
Immunolocalization of Sibling and RUNX2 Proteins During Vertical Distraction Osteogenesis in the Human Mandible
J. Histochem. Cytochem., November 1, 2007; 55(11): 1095 - 1104.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
L. R. Rodrigues, J. A. Teixeira, F. L. Schmitt, M. Paulsson, and H. Lindmark-Mansson
The Role of Osteopontin in Tumor Progression and Metastasis in Breast Cancer
Cancer Epidemiol. Biomarkers Prev., June 1, 2007; 16(6): 1087 - 1097.
[Abstract] [Full Text] [PDF]

Home page
 Eur J EndocrinolHome page
R. B T Verkooijen, J. W A Smit, J. A Romijn, and M. P M Stokkel
The incidence of second primary tumors in thyroid cancer patients is increased, but not related to treatment of thyroid cancer
Eur. J. Endocrinol., December 1, 2006; 155(6): 801 - 806.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Q. Zhang, K. Furukawa, H.-H. Chen, T. Sakakibara, T. Urano, and K. Furukawa
Metastatic Potential of Mouse Lewis Lung Cancer Cells Is Regulated via Ganglioside GM1 by Modulating the Matrix Metalloprotease-9 Localization in Lipid Rafts
J. Biol. Chem., June 30, 2006; 281(26): 18145 - 18155.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J.-S. Nam, A. M. Suchar, M.-J. Kang, C. H. Stuelten, B. Tang, A. M. Michalowska, L. W. Fisher, N. S. Fedarko, A. Jain, J. Pinkas, et al.
Bone Sialoprotein Mediates the Tumor Cell-Targeted Prometastatic Activity of Transforming Growth Factor {beta} in a Mouse Model of Breast Cancer.
Cancer Res., June 15, 2006; 66(12): 6327 - 6335.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
A. Karadag, N. S. Fedarko, and L. W. Fisher
Dentin Matrix Protein 1 Enhances Invasion Potential of Colon Cancer Cells by Bridging Matrix Metalloproteinase-9 to Integrins and CD44
Cancer Res., December 15, 2005; 65(24): 11545 - 11552.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager