Clinical Cancer Research Grants Advances in Breast Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jeng, Y.-M.
Right arrow Articles by Hsu, H.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jeng, Y.-M.
Right arrow Articles by Hsu, H.-C.
Clinical Cancer Research Vol. 10, 2065-2071, March 2004
© 2004 American Association for Cancer Research


Molecular Oncology, Markers, Clinical Correlates

Overexpression and Amplification of Aurora-A in Hepatocellular Carcinoma

Yung-Ming Jeng1,2, Shian-Yang Peng4, Chiao-Ying Lin3 and Hey-Chi Hsu1,2

1 Department of Pathology, National Taiwan University Hospital; 2 Graduate Institute of Pathology and 3 Clinical Dentistry, College of Medicine, National Taiwan University; and 4 Department of General Education, National Taipei College of Nursing, Taipei, Taiwan


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Purpose: Aurora-A/STK15/BTAK, a centrosome-associated serine/threonine kinase, has been shown to induce chromosomal instability, leading to aneuploidy and cell transformation. The purpose of this study was to investigate the expression and amplification of Aurora-A in hepatocellular carcinoma (HCC).

Experimental Design: Aurora-A mRNA levels were measured in 224 HCCs and 199 paired nontumorous liver tissues by reverse transcription-PCR. Aurora-A mRNA and protein levels of 8 were also measured by reverse transcription-PCR and Western blot hybridization in 8 liver cancer cell lines. Amplification of Aurora-A was determined by Southern blot hybridization in 99 cases.

Results: Aurora-A was overexpressed in 137 of 224 (61%) HCCs and all 8 of the cell lines. Overexpression of Aurora-A was associated with high-grade (grade II-IV), and high-stage (stage IIIB-IV) tumors, p53 mutation, infrequent ß-catenin mutation, and poor outcome. Aurora-A overexpression and p53 mutation acted synergistically toward poor prognosis. Amplification of Aurora-A was detected only in 3 HCCs.

Conclusion: The results show that Aurora-A is overexpressed frequently in HCC, and correlated with high grade and high stage, indicating that overexpression of Aurora-A plays a role in the development and progression of HCC.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Carcinogenesis is a multistep process that results from the accumulation of various genetic abnormalities (1) . Loss of genomic stability is believed to be one of the driving forces to the development of a tumor and its progression (2) . In most cancers, the instability is observed at the chromosome level, resulting in losses and gains of whole chromosomes or large portions thereof. Hence, a variety of chromosomal aberrations, such as abnormal ploidy, are common in cancer cells (3 , 4) . The centrosomes are thought to play a crucial role in the maintenance of genomic stability by organizing bipolar spindle during mitosis and by ensuring equal segregation of replicated chromosomes into daughter cells (5) . Centrosome defects, such as changes in centrosome numbers, organization, and behavior, have been found in some breast cancers and solid tumors in general (6, 7, 8) . By increasing the incidence of multipolar spindles and related spindle abnormalities, these defects cause chromosome misaggregation and aneuploidy, which are important for progression of malignancy (6, 7, 8) .

Drosophila aurora and yeast Ipl1 are serine/threonine kinases that are required for centrosome maturation and chromosome aggregation (9, 10) . Mutations in aurora prevent centrosome separation, leading to the formation of monopolar spindles (10) . Homologues of aurora kinase have been identified in Caenorhabditis elegans, Xenopus, mouse, and human (11) . On the basis of the similarities in protein sequences, members of the aurora family are grouped into three classes (A, B, and C; Ref. 12 ). Of the three mammalian aurora homologues, Aurora-A (also called BTAK, STK6, STK15, and Aik1) has attracted intense interest after the discovery that Aurora-A is mapped to chromosome 20q13.2, a region amplified commonly in epithelial cancers (13, 14, 15, 16) . Amplification of Aurora-A was detected in ~12% of primary breast cancers, as well as in breast, ovarian, colon, prostate, and neuroblastoma cancer cell lines (17) . Besides, Aurora-A is overexpressed frequently at mRNA and protein levels in primary cancers without Aurora-A amplification (18, 19, 20, 21) . Overexpression of Aurora-A transforms NIH3T3 fibroblasts, and induces centrosome abnormality and aneuploidy in near diploid breast cancer cell line (17) , indicating that Aurora-A is oncogenic.

Hepatocellular carcinoma (HCC) is one of the most frequent malignant tumors in southern China, Taiwan, southeastern Asia, and sub-Saharan Africa. HCC is closely associated with hepatitis B and hepatitis C infections, cirrhosis of any etiology, and aflatoxin B1 exposure (22) , but the molecular mechanism for the tumorigenesis of HCC is still poorly understood. Gain of chromosome 20q, where Aurora-A is located, was observed frequently in HCC (23, 24, 25) . To determine the involvement of Aurora-A in HCC, we analyzed the overexpression and amplification of Aurora-A in HCC. Aurora-A mRNA levels were then correlated with various clinicopathological and molecular features.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue Samples.
From January 1983 to December 1997, 1033 surgically resected primary and 188 recurrent HCCs were pathologically assessed at the National Taiwan University Hospital. The tissue samples were immediately cut into small pieces, snap-frozen in liquid nitrogen, and stored in deep freezer. Of these, 224 patients who already had DNA or RNA samples taken from resected primary HCCs were selected for this study. The definition of unifocal HCC was based on combined analyses of pathological features, hepatitis B virus DNA integration pattern, {alpha}-fetoprotein mRNA expression, and mutation patterns of ß-catenin and p53 genes, as described previously (26, 27, 28) . The 224 patients included 179 males and 45 females with a mean age of 55.26 years (range, 14–88 years). All of the patients had adequate liver function reserve at the time of surgery, and all of the tumors were surgically resectable. Cirrhosis was present in 83 patients (37%), including 22 patients with incomplete septal (early) cirrhosis, whereas 141 patients (63%) had no cirrhosis due to patient selection bias for surgery. None of these patients had received transhepatic arterial embolization or chemotherapy before surgery.

Histological Study and Tumor-Node-Metastasis Staging.
Tumor grade was divided into three groups, well-differentiated (grade I), moderately differentiated (grade II), and poorly differentiated (grade III and IV). The resected HCC was staged as stages I, II, IIIA, IIIB, and IV, as described previously (26 , 29) . The staging was based on the International Union Against Cancer criteria, with slight modification. Stage I HCC included tumors that were <=2 cm and showed no evidence of liver and vascular invasion. These tumors were either encapsulated with no liver invasion (stage IA) or unencapsulated with liver invasion (stage IB). Stage II HCCs included tumors that were <=2 cm for which vascular invasion was limited to small vessels in the tumor capsule, as well as encapsulated tumors >2 cm with no evidence of liver or vascular invasion. Stage IIIA HCCs included invasive tumors >2 cm with invasion of small vessels in the tumor capsule and/or satellites near the tumor, but no portal vein invasion. Stage IIIB HCCs included tumors with invasion of the portal vein branch near the tumor, but not of the distant portal vein in the liver parenchyma. Stage IV included tumors with involvement of major portal vein branches, satellites extending deeply into the surrounding liver, tumor rupture, or invasion of the surrounding organs. Seven, 93, 37, 28, and 59 tumor specimens were classified as stage I, II, IIIA, IIIB, and IV HCC, respectively.

The intrahepatic tumor recurrence was based on imaging diagnosis with ultrasonography and/or computed tomography, supplemented with elevated serum {alpha}-fetoprotein. Among the 224 patients studied, 205 were eligible for the evaluation of early intrahepatic tumor recurrence (<=1 year). Nineteen patients who died within 1 year after resection and had no information or were negative for intrahepatic tumor recurrence were excluded from the evaluation of early recurrence.

Reverse Transcription-PCR (RT-PCR).
RT-PCR was used to determine the expression of Aurora-A in 224 samples of HCCs and 199 corresponding nontumorous liver parenchyma, as is described elsewhere (29) . S26 ribosomal protein mRNA, a housekeeping gene, was used as the internal control (30) . Briefly, 2 µl reverse transcription product, 1.25 units Pro Taq polymerase (Protech Technology Enterprise, Taipei, Taiwan), Pro Taq buffer, and 200 µM (each) dATP, dCTP, dGTP, and dTTP were mixed with primer pairs for Aurora-A and S26 in a total volume of 30 µl. PCR was performed in an automatic DNA thermal cycler 480 (Perkin-Elmer Corp.), with initial heating at 94°C for 2 min, followed by the Touch Down PCR program, 22 cycles of 94°C for 30 s, annealing for 1 min (the annealing temperature is reduced by 1°C per 2 cycles from 65°C to 55°C), 72°C for 1 min, and final 72°C for 10 min. Aurora-A cDNA was amplified using Aurora-A-F (AATTGCAGATTTTGGGTGGT) and Aurora-A-R (AAACTTCAGTAGCATGTTCCTGTC) oligonucleotides. The primers for S26 are S26F (CCGTGCCTCCAAGATGACAAAG) and S26R (GTTCGGTCCTTGCGGGCTTCAC). PCR was stopped at the exponential phase of the amplified genes, 29 cycles for Aurora-A and 23 cycles for S26. The products were electrophoresed on a 2% agarose gel. The concentrations of the PCR fragments were determined with the IS-1000 digital imaging system (Alpha Innotech, San Leandro, CA). The Aurora-A mRNA levels were determined by the ratio of signal intensity of Aurora-A to that of S26 measured by 1D Image Analysis software (Kodak Digital Science, Rochester, NY) and scored as high (ratio >1.0) or low (ratio <1.0). The Aurora-A mRNA level of nontumorous liver rarely exceeded a ratio of 1.0.

For the determination of p21 and Bax levels in Aurora-A-overexpressed cells, total RNA was extracted from Aurora-A or empty vector-transfected cells and analyzed for p21 and Bax expression by RT-PCR. The primers used were p21-F (cggcctggcacctcacct), p21-R (cctctcattcaaccgcctag), Bax-F (tcatccaggatcgagcaggg), and Bax-R (ccagatggtgagtgaggcgg). PCR was performed using Touch Down program and stopped at the exponential phase of the amplified genes, 28 cycles for both genes.

Cell Culture.
All of the cell lines used in this study were maintained in DMEM plus 10% FCS supplemented with penicillin and streptomycin.

Western Blot Hybridization.
To determine the expression levels of Aurora-A in liver cancer cell lines, ~5 x 106 cells were taken up in 50 µl of loading buffer and boiled for 5 min. After a 30-s vortexing step to shear the genomic DNA, 30 µl of this extract was electrophoresed through SDS-10% polyacrylamide gels. After transfer to a polyvinylidene difluoride membrane, the proteins were detected with anti-Aurora-A antibody (1:1000; Cell Signaling, Beverly, MA), followed by horseradish peroxide-conjugated secondary antibody and chemiluminescence reagents (Amersham, Piscataway, NJ). The same membrane was reprobed with anti-ß-actin (1:2000; Sigma, St. Louis, MO) as a control for equivalent protein loading.

Immunofluorescence Staining.
Cells on 18-mm coverslips were fixed in 4% paraformaldehyde for 15 min. Fixed cells were blocked in PBS/5% FCS/0.1% Triton X-100 and subsequently incubated for 2 h in primary antibodies (Aurora-A, 1:250; {gamma}-tubulin, 1:200; Sigma). Cells were washed repeatedly in PBS/0.1% Triton X-100 and incubated for 45 min with a secondary antibody diluted 1:500 in same antibody buffer. Nuclei were counterstained with 0.5 µg/ml 4',6-diamidino-2-phenylindole for 10 min and washed in PBS.

Cloning and Transfection.
The full-length Aurora-A was kindly provided by Dr. Tang K. Tang (Institute of Biomedical Science, Academia Sinica, Taipei, Taiwan). Aurora-A-pCMV-Tag2B was constructed by cloning into the BamHI-XhoI site of pCMV-Tag2B. Using LipofectAMINE (Invitrogen) according to the manufacturer’s protocol, HEK 293 cells were transiently transfected with Aurora-A-pCMV-Tag2B or empty vector.

Southern Hybridization.
Genomic DNA samples (5–15 µg) of HCC and nontumorous liver tissues were isolated using the phenol-chloroform method, digested with BglII, HindIII, or EcoRI (Life Technologies, Inc., Gaithersburg, MD), subjected to electrophoresis on a 0.8% agarose, and transferred to Zeta-probe nylon membrane (Bio-Rad Labs, Richmond, CA), as described (31) .To avoid cross-hybridization of Aurora-A pseudogene, an Aurora-A intron 2 probe was used. The membrane was hybridized with 32P-labeled probe, washed, dried, and autoradiographed at -70°C with X-Omat AR film (Eastman Kodak Co., Rochester, NY). The membranes were rehybridized with a ß-globin probe as a control.

Analysis of p53 and ß-Catenin Mutations.
Mutations of the p53 tumor suppressor gene and ß-catenin gene were detected by direct sequencing of exon 2 to exon 11 of p53 and exon 3 of ß-catenin as described previously (26 , 32) . Cases with incomplete study were excluded from statistical analysis.

Follow-Up Observation.
During the follow-up period up to 175 months, 178 patients (79%) had been followed for >10 years or until death. At the end of follow-up, 60 patients remained alive, 14 of whom had survived for >10 years.

Statitical Analysis.
The analyses were performed using the Statistica for Windows software (Statsoft, Inc., Chicago, IL). Two-tailed {chi}2 was used for univariate analysis. The cumulative survival after tumor removal was calculated with the log-rank test. Ps < 0.05 were considered statistically significant.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of Aurora-A in HCC, Liver, and Liver Cancer Cell Lines.
We used RT-PCR for large-scale analysis of Aurora-A mRNA expression in HCC. Among 224 unifocal primary HCCs, Aurora-A was overexpressed in 137 tumors (61%; Fig. 1Citation ). Of these 224 HCCs, RNA samples of nontumorous liver parenchyma were available for 199 patients. In the nontumorous liver, Aurora-A mRNA was overexpressed in 10 cases (5%). Aurora-A was overexpressed in all 8 of the liver cancer cell lines at the mRNA and protein levels (Fig. 2)Citation . The protein expression level of Aurora-A in the liver cancer cell lines was parallel with the mRNA expression level, indicating that the expression of Aurora-A is regulated at transcription level, and mRNA level can represent the protein expression level.



View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Aurora-A mRNA expression in paired hepatocellular carcinoma (T) and nontumorous liver parenchyma (N). Quantitative reverse transcription-PCR measurement of Aurora-A mRNA during the exponential phase of reverse transcription-PCR amplification of mRNA showed Aurora-A overexpression in 5 of 6 hepatocellular carcinoma specimens.

 


View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Overexpression of Aurora-A in liver cancer cell lines. Protein lysates from nontumorous liver tissue and 8 liver cancers cell lined were analyzed by immunoblotting. All 8 liver cancer cell lines show overexpression of Aurora-A at protein level (top panel). The blots were reprobed with ß-actin as a control for protein loading. The protein expression levels were correlated with mRNA level (bottom panel).

 
To determine the subcellular localization of Aurora-A in HCC, immunofluorescent staining was performed on Hep3B cell lines. Aurora-A colocalized with {gamma}-tubulin at centrosome at interface and at centrosome, and mitotic spindle at metaphase (Fig. 3)Citation , as was reported in other cells (11) .



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Localization of Aurora-A at interphase and metaphase Hep3B cell lines. A, Aurora-A was visualized with anti-aurora-A antibody and Rhodamine-conjugated secondary antibody (red). DNA was labeled with 4',6-diamidino-2-phenylindole staining (blue). Aurora-A shows perinuclear dot-like staining in interphase cells and located at mitotic spindle in metaphase cells. B, {gamma}-tubulin, a marker of centrosome, was stained with anti-{gamma}-tubulin antibody and FITC-conjugated secondary antibody. C, merge of A and B. Aurora-A and {gamma}-tubulin colocalized at centrosome and mitotic spindle.

 
Clinicopathologic Correlation of Aurora-A Expression in HCC.
To elucidate the role of Aurora-A in HCC, we correlated the Aurora-A expression with clinicopathologic features of HCC. As shown in Table 1Citation , Aurora-A overexpression in HCC did not correlate with age, gender, and chronic hepatitis B virus infection, but was associated with serum {alpha}-fetoprotein elevation (P = 0.031).


View this table:
[in this window]
[in a new window]

 
Table 1 Aurora-A mRNA expression status in relation to selected clinicopathologic features in 224 patients with resected unifocal primary hepatocellular carcinoma

 
Histologically, HCCs with Aurora-A overexpression were more frequently grade II-IV than those without Aurora-A overexpression (P < 0.0001). Aurora-A overexpression was associated with portal vein tumor invasion (stage IIIB and IV HCC; P = 0.025), regardless of tumor size.

HCCs with Aurora-A overexpression was associated with a significantly lower 10-year survival rate than HCCs without Aurora-A overexpression (P < 0.007; Fig. 4Citation ).



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Cumulative survival curve for 224 patients with primary unifocal hepatocellular carcinoma (HCC). HCC with Aurora-A mRNA overexpression, designated Aurora-A (+), had a significantly worse 10-year survival rate than HCC without Aurora-A mRNA overexpression, designated Aurora-A (-).

 
Correlation and Synergy between Aurora-A Expression, and p53 and ß-Catenin Mutations.
p53 and ß-catenin are the two most frequently mutated genes in HCC (26 , 32) . To identify the potential interplay between these oncogenic events, we analyzed the relation of mutations of these two genes and Aurora-A overexpression. In this study, p53 mutation was found in 88 (49%) of 178 HCCs examined. Overexpression of Aurora-A correlated with p53 mutation (P = 0.04; Table 1Citation ). Moreover, HCCs with Aurora-A overexpression and p53 mutation had the worst survival than those with p53 mutation or Aurora-A overexpression alone (Fig. 5)Citation .



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Cumulative survival curve for 178 patients with primary unifocal hepatocellular carcinoma in relation to increased (+) or normal (-) expression of Aurora-A and the presence (+) or absence of p53 mutation. Hepatocellular carcinoma with Aurora-A overexpression and p53 mutation had the worst survival rate.

 
Mutations of exon 3 of ß-catenin were identified in 32 (15%) of 214 HCCs examined. In contrast to the association of Aurora-A overexpression with p53 mutation, Aurora-A was more frequently overexpressed in HCCs without ß-catenin mutation (P = 0.024).

Aurora-A Overexpression and p53 Target Genes.
Because Aurora-A overexpression was closely correlated with p53 mutation and Aurora-A was known to interact directly with p53 (33) , we then analyzed the effects of Aurora-A on p53 target genes. RT-PCR analysis of Aurora-A-overexpressed HEK 293 cells demonstrated that Aurora-A did not significantly alter the transcriptional level of p21 and Bax (Fig. 6)Citation .



View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Overexpression of Aurora-A into HEK 293 cells did not affect the expression level of p53 target genes p21 and Bax.

 
Amplification of Aurora-A in HCC.
Southern blot analysis demonstrated amplification of Aurora-A only in 3 of 99 tumors (3%; Fig. 7Citation ). Overexpression of Aurora-A was detected in all of these tumors.



View larger version (53K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Southern blot hybridization demonstrated amplification of Aurora-A in 3 tumors (T, tumor; N, nontumorous liver parenchyma). ß-Globin served as a control for DNA quantity.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Genetic instability, by generating mutations in oncogenes and tumor-suppressor genes, provide cancer cells with a selective growth advantage, thereby leading to clonal outgrowth, and, hence, is a major driving force for malignant transformation and tumor progression (34, 35, 36) . Two forms of genetic instability have been described in cancers, chromosomal instability and microsatellite instability (37) . Microsatellite instability involves the inactivation of DNA mismatch repair genes and is present in only a minor subset of tumors. Chromosomal instability is much more frequent in cancer, but its mechanism is poorly understood. Inactivation of mitotic spindle checkpoint genes, such as BUB and MAD2, have been implicated in aneuploidy formation, but BUB mutation and MAD2 down-regulation can only be detected in a small fraction of aneuploidy cancer (38 , 39) . Amplification and overexpression of Aurora-A are more frequent in human cancer (17, 18, 19, 20, 21 , 40 , 41) . By causing centrosome abnormalities and chromosomal instability, overexpression of Aurora-A can promote tumor formation and progression (17)

To study the role of Aurora-A in HCC, we analyzed its expression level in 224 cases, and detected overexpression of Aurora-A in 61% of the cases. Aurora-A overexpression was more frequently associated with higher grade, higher stage, and worse 10-year survival. Pervious studies indicated that most cancers with aneuploidy show a more malignant phenotype than diploid cancers (42 , 43) . These observations suggest that overexpression of Aurora-A, by causing chromosomal instability, may contribute to a more malignant phenotype of HCC.

Inactivation of p53 results in centrosome hyperamplification, leading to aberrant mitosis and chromosomal instability (44 , 45) . The p53 protein interacts directly with Aurora-A, and suppresses Aurora-A-induced centrosome amplification and cellular transformation in a transactivation-independent manner (33) . Centrosome amplification and aneuploidy induced by Aurora-A overexpression are exacerbated in a p53-/- background (46) . In this study, we found that Aurora-A overexpression was correlated with p53 mutation in HCC, and tumors with both Aurora-A overexpression and p53 mutation had worse prognosis than p53 mutation alone, but Aurora-A overexpression did not significant affect the expression level of p53 target genes. These observations provide in vivo evidence that Aurora-A and p53 had a synergistic effect contributing toward tumor progression and, hence, poor prognosis.

We also showed that Aurora-A overexpression was negatively associated with ß-catenin mutation. In previous study, we showed that ß-catenin mutation in HCC was associated with lower grade, lower stage, and better 5-year survival (26) . Laurent-Puig et al. (47) classified HCC into two groups. One is characterized by chromosome stability, ß-catenin mutation, and chromosome 8p loss. The other is characterized by chromosomal instability, Axin 1, and p53 mutation. The negative association of Aurora-A overexpression with ß-catenin mutation and positive association with p53 mutation suggest that Aurora-A overexpression is associated with the latter group and may account for the genomic instability in these tumors.

Amplification of Aurora-A was detected in only 3% of HCCs examined. Although Aurora-A amplification coincided with overexpression, many more cases showed Aurora-A overexpression without amplification. Thus, the expression of Aurora-A is likely to be regulated not only by gene amplification but also by other mechanisms such as transcriptional activation. Another possibility is that Aurora-A gene amplification occurred in only a proportion of the tumor cells and is undetectable by Southern blot analysis. Discrepancy between amplification and overexpression rates has also been reported in gastric cancer (39) , bladder cancer (21) , and pancreatic cancer (40) , indicating that transcriptional activation may be a major cause of Aurora-A overexpression in human cancers.

In summary, we have demonstrated that Aurora-A is highly expressed in HCC. Overexpression of Aurora-A may have important pathogenetic and prognostic significance in HCC.


    FOOTNOTES
 
Grant support: National Taiwan University Hospital (NTUH-92-S28) and National Health Research Institute, Taiwan (NHRI-GT-EX89B701L)

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Hey-Chi Hsu, Department of Pathology, National Taiwan University Hospital, No. 7 Chung-Shan South Road, Taipei 100, Taiwan. Phone: 886-2-23123456, extension 5455; Fax: 886-2-23934172; E-mail: heychi{at}ha.mc.ntu.edu.tw

Received 7/17/03; revised 12/10/03; accepted 12/10/03.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kinzler KW, Vogelstein B Cancer-susceptibility genes. Gatekeepers and caretakers. Nature, 386: 761-3, 1997.[CrossRef][Medline]
  2. Lengauer C, Kinzler KW, Vogelstein B Genetic instabilities in human cancers. Nature, 396: 643-9, 1998.[CrossRef][Medline]
  3. Barlogie B, Raber MN, Schumann J, et al Flow cytometry in clinical cancer research. Cancer Res, 43: 3982-97, 1983.[Abstract/Free Full Text]
  4. Shih IM, Zhou W, Goodman SN, Lengauer C, Kinzler KW, Vogelstein B Evidence that genetic instability occurs at an early stage of colorectal tumorigenesis. Cancer Res, 61: 818-22, 2001.[Abstract/Free Full Text]
  5. Zimmerman W, Sparks CA, Doxsey SJ Amorphous no longer: the centrosome comes into focus. Curr Opin Cell Biol, 11: 122-8, 1999.[CrossRef][Medline]
  6. Carroll PE, Okuda M, Horn HF, et al Centrosome hyperamplification in human cancer: chromosome instability induced by p53 mutation and/or Mdm2 overexpression. Oncogene, 18: 1935-44, 1999.[CrossRef][Medline]
  7. Pihan GA, Purohit A, Wallace J, et al Centrosome defects and genetic instability in malignant tumors. Cancer Res, 58: 3974-85, 1998.[Abstract/Free Full Text]
  8. Brinkley BR Managing the centrosome numbers game: from chaos to stability in cancer cell division. Trends Cell Biol, 11: 18-21, 2001.[CrossRef][Medline]
  9. Francisco L, Wang W, Chan CS Type 1 protein phosphatase acts in opposition to IpL1 protein kinase in regulating yeast chromosome segregation. Mol Cell Biol, 14: 4731-40, 1994.[Abstract/Free Full Text]
  10. Glover DM, Leibowitz MH, McLean DA, Parry H Mutations in aurora prevent centrosome separation leading to the formation of monopolar spindles. Cell, 81: 95-105, 1995.[CrossRef][Medline]
  11. Katayama H, Brinkley WR, Sen S The aurora kinases: role in cell transformation and tumorigenesis Kumar R eds. . Cancer and metastasis reviews, Vol. 22: p. 451-64, Kluwer Academic Publishers Dordrecht, The Netherlands 2003.
  12. Nigg EA Mitotic kinases as regulators of cell division and its checkpoints. Nat Rev Mol Cell Biol, 2: 21-32, 2001.[CrossRef][Medline]
  13. Jazaeri AA, Lu K, Schmandt R, et al Molecular determinants of tumor differentiation in papillary serous ovarian carcinoma. Mol Carcinog, 36: 53-9, 2003.[CrossRef][Medline]
  14. Forozan F, Mahlamaki EH, Monni O, et al Comparative genomic hybridization analysis of 38 breast cancer cell lines: a basis for interpreting complementary DNA microarray data. Cancer Res, 60: 4519-25, 2000.[Abstract/Free Full Text]
  15. Schlegel J, Stumm G, Scherthan H, et al Comparative genomic in situ hybridization of colon carcinomas with replication error. Cancer Res, 55: 6002-5, 1995.[Abstract/Free Full Text]
  16. Reznikoff CA, Belair CD, Yeager TR, et al A molecular genetic model of human bladder cancer pathogenesis. Semin Oncol, 23: 571-84, 1996.[Medline]
  17. Zhou H, Kuang J, Zhong L, et al Tumour amplified kinase STK15/BTAK induces centrosome amplification, aneuploidy and transformation. Nat Genet, 20: 189-93, 1998.[CrossRef][Medline]
  18. Tanaka T, Kimura M, Matsunaga K, Fukada D, Mori H, Okano Y Centrosomal kinase AIK1 is overexpressed in invasive ductal carcinoma of the breast. Cancer Res, 59: 2041-4, 1999.[Abstract/Free Full Text]
  19. Bischoff JR, Anderson L, Zhu Y, et al A homologue of Drosophila aurora kinase is oncogenic and amplified in human colorectal cancers. EMBO J, 17: 3052-65, 1998.[CrossRef][Medline]
  20. Gritsko TM, Coppola D, Paciga JE, et al Activation and overexpression of centrosome kinase BTAK/Aurora-A in human ovarian cancer. Clin Cancer Res, 9: 1420-6, 2003.[Abstract/Free Full Text]
  21. Sen S, Zhou H, Zhang RD, et al Amplification/ overexpression of a mitotic kinase gene in human bladder cancer. J Natl Cancer Inst, 94: 1320-9, 2002.[Abstract/Free Full Text]
  22. El-Serag HB Hepatocellular carcinoma: an epidemiologic view. J Clin Gastroenterol, 35: S72-8, 2002.
  23. Kim GJ, Cho SJ, Won NH, et al Genomic imbalances in Korean hepatocellular carcinoma. Cancer Genet Cytogenet, 142: 129-33, 2003.[CrossRef][Medline]
  24. Niketeghad F, Decker HJ, Caselmann WH, et al Frequent genomic imbalances suggest commonly altered tumour genes in human hepatocarcinogenesis. Br J Cancer, 85: 697-704, 2001.[CrossRef][Medline]
  25. Collonge-Rame MA, Bresson-Hadni S, Koch S, et al Pattern of chromosomal imbalances in non-B virus related hepatocellular carcinoma detected by comparative genomic hybridization. Cancer Genet. Cytogenet, 127: 49-52, 2001.[CrossRef][Medline]
  26. Hsu HC, Jeng YM, Mao TL, Chu JS, Lai PL, Peng SY ß-Catenin mutations are associated with a subset of low-stage hepatocellular carcinoma negative for hepatitis B virus and with favorable prognosis. Am J Pathol, 157: 763-70, 2000.[Abstract/Free Full Text]
  27. Peng SY, Lai PL, Chu JS, et al Expression and hypomethylation of {alpha}-fetoprotein gene in unicentric and multicentric human hepatocellular carcinomas. Hepatology, 17: 35-41, 1993.[CrossRef][Medline]
  28. Hsu HC, Chiou TJ, Chen JY, Lee CS, Lee PH, Peng SY Clonality and clonal evolution of hepatocellular carcinoma with multiple nodules. Hepatology, 13: 923-8, 1991.[CrossRef][Medline]
  29. Liu SH, Lin CY, Peng SY, et al Down-regulation of annexin A10 in hepatocellular carcinoma is associated with vascular invasion, early recurrence, and poor prognosis in synergy with p53 mutation. Am J Pathol, 160: 1831-7, 2002.[Abstract/Free Full Text]
  30. Vincent S, Marty L, Fort P S26 ribosomal protein RNA: an invariant control for gene regulation experiments in eucaryotic cells and tissues. Nucleic Acids Res, 21: 1498 1993.[Free Full Text]
  31. Southern E Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol, 98: 503-17, 1975.[CrossRef][Medline]
  32. Hsu HC, Huang AM, Lai PL, Chien WM, Peng SY, Lin SW Genetic alterations at the splice junction of p53 gene in human hepatocellular carcinoma. Hepatology, 19: 122-8, 1994.[CrossRef][Medline]
  33. Chen SS, Chang PC, Cheng YW, Tang FM, Lin YS Suppression of the STK15 oncogenic activity requires a transactivation-independent p53 function. EMBO J, 21: 4491-9, 2002.[CrossRef][Medline]
  34. Cahill DP, Kinzler KW, Vogelstein B, Lengauer C Genetic instability and darwinian selection in tumours. Trends Cell Biol, 9: M57-60, 1999.[CrossRef][Medline]
  35. Pihan GA, Doxsey SJ The mitotic machinery as a source of genetic instability in cancer. Semin Cancer Biol, 9: 289-302, 1999.[CrossRef][Medline]
  36. Lengauer C, Kinzler KW, Vogelstein B Genetic instabilities in human cancers. Nature, 396: 643-9, 1998.
  37. Boland CR, Sato J, Saito K, et al Genetic instability and chromosomal aberrations in colorectal cancer: a review of the current models. Cancer Detect. Prev, 22: 377-82, 1998.[CrossRef][Medline]
  38. Cahill DP, Lengauer C, Yu J, et al Mutations of mitotic checkpoint genes in human cancers. Nature, 392: 300-3, 1998.[CrossRef][Medline]
  39. Li Y, Benezra R Identification of a human mitotic checkpoint gene: hsMAD2. Science, 274: 246-8, 1996.[Abstract/Free Full Text]
  40. Sakakura C, Hagiwara A, Yasuoka R, et al Tumour-amplified kinase BTAK is amplified and overexpressed in gastric cancers with possible involvement in aneuploidy. Br J Cancer, 84: 824-31, 2001.[CrossRef][Medline]
  41. Li D, Zhu J, Firozi PF, et al Overexpression of oncogenic STK15/BTAK/Aurora A kinase in human pancreatic cancer. Clin Cancer Res, 9: 991-7, 2003.[Abstract/Free Full Text]
  42. Oriyama T, Yamanaka N, Fujimoto J, Ichikawa N, Okamoto E Progression of hepatocellular carcinoma as reflected by nuclear DNA ploidy and cellular differentiation. J Hepatol, 28: 142-9, 1998.[Medline]
  43. Ng IO, Lai EC, Ho JC, Cheung LK, Ng MM, So MK Flow cytometric analysis of DNA ploidy in hepatocellular carcinoma. Am J Clin Pathol, 102: 80-6, 1994.[Medline]
  44. Tarapore P, Fukasawa K Loss of p53 and centrosome hyperamplification. Oncogene, 21: 6234-40, 2002.[CrossRef][Medline]
  45. Carroll PE, Okuda M, Horn HF, et al Centrosome hyperamplification in human cancer: chromosome instability induced by p53 mutation and/or Mdm2 overexpression. Oncogene, 18: 1935-44, 1999.
  46. Meraldi P, Honda R, Nigg EA Aurora-A overexpression reveals tetraploidization as a major route to centrosome amplification in p53-/- cells. EMBO J, 21: 483-92, 2002.[CrossRef][Medline]
  47. Laurent-Puig P, Legoix P, Bluteau O, et al Genetic alterations associated with hepatocellular carcinomas define distinct pathways of hepatocarcinogenesis. Gastroenterology, 120: 1763-73, 2001.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
C.-C. Li, H.-Y. Chu, C.-W. Yang, C.-K. Chou, and T.-F. Tsai
Aurora-A Overexpression in Mouse Liver Causes p53-Dependent Premitotic Arrest during Liver Regeneration
Mol. Cancer Res., May 1, 2009; 7(5): 678 - 688.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
E. C. VanderPorten, P. Taverna, J. N. Hogan, M. D. Ballinger, W. M. Flanagan, and R. V. Fucini
The Aurora kinase inhibitor SNS-314 shows broad therapeutic potential with chemotherapeutics and synergy with microtubule-targeted agents in a colon carcinoma model
Mol. Cancer Ther., April 1, 2009; 8(4): 930 - 939.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. J. Perugorria, J. Castillo, M. U. Latasa, S. Goni, V. Segura, B. Sangro, J. Prieto, M. A. Avila, and C. Berasain
Wilms' Tumor 1 Gene Expression in Hepatocellular Carcinoma Promotes Cell Dedifferentiation and Resistance to Chemotherapy
Cancer Res., February 15, 2009; 69(4): 1358 - 1367.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
Y.-C. Shen, F.-C. Hu, Y.-M. Jeng, Y.-T. Chang, Z.-Z. Lin, M.-C. Chang, C. Hsu, and A.-L. Cheng
Nuclear Overexpression of Mitotic Regulatory Proteins in Biliary Tract Cancer: Correlation with Clinicopathologic Features and Patient Survival
Cancer Epidemiol. Biomarkers Prev., February 1, 2009; 18(2): 417 - 423.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
K. Wakahara, T. Ohno, M. Kimura, T. Masuda, S. Nozawa, T. Dohjima, T. Yamamoto, A. Nagano, G. Kawai, A. Matsuhashi, et al.
EWS-Fli1 Up-Regulates Expression of the Aurora A and Aurora B Kinases
Mol. Cancer Res., December 1, 2008; 6(12): 1937 - 1945.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-Y. Ko, H.-C. Hsu, M.-R. Shen, W.-C. Chang, and J.-M. Wang
Epigenetic Silencing of CCAAT/Enhancer-binding Protein {delta} Activity by YY1/Polycomb Group/DNA Methyltransferase Complex
J. Biol. Chem., November 7, 2008; 283(45): 30919 - 30932.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. Klein, D. Flugel, and T. Kietzmann
Transcriptional Regulation of Serine/Threonine Kinase-15 (STK15) Expression by Hypoxia and HIF-1
Mol. Biol. Cell, September 1, 2008; 19(9): 3667 - 3675.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
O. Gautschi, J. Heighway, P. C. Mack, P. R. Purnell, P. N. Lara Jr., and D. R. Gandara
Aurora Kinases as Anticancer Drug Targets
Clin. Cancer Res., March 15, 2008; 14(6): 1639 - 1648.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
E. Ogawa, K. Takenaka, H. Katakura, M. Adachi, Y. Otake, Y. Toda, H. Kotani, T. Manabe, H. Wada, and F. Tanaka
Perimembrane Aurora-A Expression is a Significant Prognostic Factor in Correlation with Proliferative Activity in Non-Small-Cell Lung Cancer (NSCLC)
Ann. Surg. Oncol., February 1, 2008; 15(2): 547 - 554.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
P. Carpinelli, R. Ceruti, M. L. Giorgini, P. Cappella, L. Gianellini, V. Croci, A. Degrassi, G. Texido, M. Rocchetti, P. Vianello, et al.
PHA-739358, a potent inhibitor of Aurora kinases with a selective target inhibition profile relevant to cancer
Mol. Cancer Ther., December 1, 2007; 6(12): 3158 - 3168.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. A. Kulkarni, M. Loddo, E. Leo, M. Rashid, K. L. Eward, T. R. Fanshawe, J. Butcher, A. Frost, J. A. Ledermann, G. H. Williams, et al.
DNA Replication Licensing Factors and Aurora Kinases are Linked to Aneuploidy and Clinical Outcome in Epithelial Ovarian Carcinoma
Clin. Cancer Res., October 15, 2007; 13(20): 6153 - 6161.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. N. Landen Jr., Y. G. Lin, A. Immaneni, M. T. Deavers, W. M. Merritt, W. A. Spannuth, D. C. Bodurka, D. M. Gershenson, W. R. Brinkley, and A. K. Sood
Overexpression of the Centrosomal Protein Aurora-A Kinase is Associated with Poor Prognosis in Epithelial Ovarian Cancer Patients
Clin. Cancer Res., July 15, 2007; 13(14): 4098 - 4104.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
W.-H. Su, C.-C. Chao, S.-H. Yeh, D.-S. Chen, P.-J. Chen, and Y.-S. Jou
OncoDB.HCC: an integrated oncogenomic database of hepatocellular carcinoma revealed aberrant cancer target genes and loci
Nucleic Acids Res., January 12, 2007; 35(suppl_1): D727 - D731.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Reiter, P. Gais, U. Jutting, M. K. Steuer-Vogt, A. Pickhard, K. Bink, S. Rauser, S. Lassmann, H. Hofler, M. Werner, et al.
Aurora Kinase A Messenger RNA Overexpression Is Correlated with Tumor Progression and Shortened Survival in Head and Neck Squamous Cell Carcinoma
Clin. Cancer Res., September 1, 2006; 12(17): 5136 - 5141.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
Y.-C. Hsu, H.-H. Fu, Y.-M. Jeng, P.-H. Lee, and S.-D. Yang
Proline-Directed Protein Kinase FA Is a Powerful and Independent Prognostic Predictor for Progression and Patient Survival of Hepatocellular Carcinoma
J. Clin. Oncol., August 10, 2006; 24(23): 3780 - 3788.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Soncini, P. Carpinelli, L. Gianellini, D. Fancelli, P. Vianello, L. Rusconi, P. Storici, P. Zugnoni, E. Pesenti, V. Croci, et al.
PHA-680632, a Novel Aurora Kinase Inhibitor with Potent Antitumoral Activity.
Clin. Cancer Res., July 1, 2006; 12(13): 4080 - 4089.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Lopez-Rios, S. Chuai, R. Flores, S. Shimizu, T. Ohno, K. Wakahara, P. B. Illei, S. Hussain, L. Krug, M. F. Zakowski, et al.
Global Gene Expression Profiling of Pleural Mesotheliomas: Overexpression of Aurora Kinases and P16/CDKN2A Deletion as Prognostic Factors and Critical Evaluation of Microarray-Based Prognostic Prediction.
Cancer Res., March 15, 2006; 66(6): 2970 - 2979.
[Abstract] [Full Text] [PDF]


Home page
Jpn J Clin OncolHome page
K. Yamashita, H. Igarashi, Y. Kitayama, T. Ozawa, S. Kiyose, H. Konno, T. Kazui, S. Ishikawa, H. Aburatani, F. Tanioka, et al.
Chromosomal Numerical Abnormality Profiles of Gastrointestinal Stromal Tumors
Jpn. J. Clin. Oncol., February 1, 2006; 36(2): 85 - 92.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Hata, T. Furukawa, M. Sunamura, S. Egawa, F. Motoi, N. Ohmura, T. Marumoto, H. Saya, and A. Horii
RNA Interference Targeting Aurora Kinase A Suppresses Tumor Growth and Enhances the Taxane Chemosensitivity in Human Pancreatic Cancer Cells
Cancer Res., April 1, 2005; 65(7): 2899 - 2905.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Tong, Y. Zhong, J. Kong, L. Dong, Y. Song, M. Fu, Z. Liu, M. Wang, L. Guo, S. Lu, et al.
Overexpression of Aurora-A Contributes to Malignant Development of Human Esophageal Squamous Cell Carcinoma
Clin. Cancer Res., November 1, 2004; 10(21): 7304 - 7310.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jeng, Y.-M.
Right arrow Articles by Hsu, H.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jeng, Y.-M.
Right arrow Articles by Hsu, H.-C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online