
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Oncology, Markers, Clinical Correlates |
1 Department of Pathology, National Taiwan University Hospital; 2 Graduate Institute of Pathology and 3 Clinical Dentistry, College of Medicine, National Taiwan University; and 4 Department of General Education, National Taipei College of Nursing, Taipei, Taiwan
| ABSTRACT |
|---|
|
|
|---|
Experimental Design: Aurora-A mRNA levels were measured in 224 HCCs and 199 paired nontumorous liver tissues by reverse transcription-PCR. Aurora-A mRNA and protein levels of 8 were also measured by reverse transcription-PCR and Western blot hybridization in 8 liver cancer cell lines. Amplification of Aurora-A was determined by Southern blot hybridization in 99 cases.
Results: Aurora-A was overexpressed in 137 of 224 (61%) HCCs and all 8 of the cell lines. Overexpression of Aurora-A was associated with high-grade (grade II-IV), and high-stage (stage IIIB-IV) tumors, p53 mutation, infrequent ß-catenin mutation, and poor outcome. Aurora-A overexpression and p53 mutation acted synergistically toward poor prognosis. Amplification of Aurora-A was detected only in 3 HCCs.
Conclusion: The results show that Aurora-A is overexpressed frequently in HCC, and correlated with high grade and high stage, indicating that overexpression of Aurora-A plays a role in the development and progression of HCC.
| INTRODUCTION |
|---|
|
|
|---|
Drosophila aurora and yeast Ipl1 are serine/threonine kinases that are required for centrosome maturation and chromosome aggregation (9, 10)
. Mutations in aurora prevent centrosome separation, leading to the formation of monopolar spindles (10)
. Homologues of aurora kinase have been identified in Caenorhabditis elegans, Xenopus, mouse, and human (11)
. On the basis of the similarities in protein sequences, members of the aurora family are grouped into three classes (A, B, and C; Ref. 12
). Of the three mammalian aurora homologues, Aurora-A (also called BTAK, STK6, STK15, and Aik1) has attracted intense interest after the discovery that Aurora-A is mapped to chromosome 20q13.2, a region amplified commonly in epithelial cancers (13, 14, 15, 16)
. Amplification of Aurora-A was detected in
12% of primary breast cancers, as well as in breast, ovarian, colon, prostate, and neuroblastoma cancer cell lines (17)
. Besides, Aurora-A is overexpressed frequently at mRNA and protein levels in primary cancers without Aurora-A amplification (18, 19, 20, 21)
. Overexpression of Aurora-A transforms NIH3T3 fibroblasts, and induces centrosome abnormality and aneuploidy in near diploid breast cancer cell line (17)
, indicating that Aurora-A is oncogenic.
Hepatocellular carcinoma (HCC) is one of the most frequent malignant tumors in southern China, Taiwan, southeastern Asia, and sub-Saharan Africa. HCC is closely associated with hepatitis B and hepatitis C infections, cirrhosis of any etiology, and aflatoxin B1 exposure (22) , but the molecular mechanism for the tumorigenesis of HCC is still poorly understood. Gain of chromosome 20q, where Aurora-A is located, was observed frequently in HCC (23, 24, 25) . To determine the involvement of Aurora-A in HCC, we analyzed the overexpression and amplification of Aurora-A in HCC. Aurora-A mRNA levels were then correlated with various clinicopathological and molecular features.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-fetoprotein mRNA expression, and mutation patterns of ß-catenin and p53 genes, as described previously (26, 27, 28)
. The 224 patients included 179 males and 45 females with a mean age of 55.26 years (range, 1488 years). All of the patients had adequate liver function reserve at the time of surgery, and all of the tumors were surgically resectable. Cirrhosis was present in 83 patients (37%), including 22 patients with incomplete septal (early) cirrhosis, whereas 141 patients (63%) had no cirrhosis due to patient selection bias for surgery. None of these patients had received transhepatic arterial embolization or chemotherapy before surgery.
Histological Study and Tumor-Node-Metastasis Staging.
Tumor grade was divided into three groups, well-differentiated (grade I), moderately differentiated (grade II), and poorly differentiated (grade III and IV). The resected HCC was staged as stages I, II, IIIA, IIIB, and IV, as described previously (26
, 29)
. The staging was based on the International Union Against Cancer criteria, with slight modification. Stage I HCC included tumors that were
2 cm and showed no evidence of liver and vascular invasion. These tumors were either encapsulated with no liver invasion (stage IA) or unencapsulated with liver invasion (stage IB). Stage II HCCs included tumors that were
2 cm for which vascular invasion was limited to small vessels in the tumor capsule, as well as encapsulated tumors >2 cm with no evidence of liver or vascular invasion. Stage IIIA HCCs included invasive tumors >2 cm with invasion of small vessels in the tumor capsule and/or satellites near the tumor, but no portal vein invasion. Stage IIIB HCCs included tumors with invasion of the portal vein branch near the tumor, but not of the distant portal vein in the liver parenchyma. Stage IV included tumors with involvement of major portal vein branches, satellites extending deeply into the surrounding liver, tumor rupture, or invasion of the surrounding organs. Seven, 93, 37, 28, and 59 tumor specimens were classified as stage I, II, IIIA, IIIB, and IV HCC, respectively.
The intrahepatic tumor recurrence was based on imaging diagnosis with ultrasonography and/or computed tomography, supplemented with elevated serum
-fetoprotein. Among the 224 patients studied, 205 were eligible for the evaluation of early intrahepatic tumor recurrence (
1 year). Nineteen patients who died within 1 year after resection and had no information or were negative for intrahepatic tumor recurrence were excluded from the evaluation of early recurrence.
Reverse Transcription-PCR (RT-PCR).
RT-PCR was used to determine the expression of Aurora-A in 224 samples of HCCs and 199 corresponding nontumorous liver parenchyma, as is described elsewhere (29)
. S26 ribosomal protein mRNA, a housekeeping gene, was used as the internal control (30)
. Briefly, 2 µl reverse transcription product, 1.25 units Pro Taq polymerase (Protech Technology Enterprise, Taipei, Taiwan), Pro Taq buffer, and 200 µM (each) dATP, dCTP, dGTP, and dTTP were mixed with primer pairs for Aurora-A and S26 in a total volume of 30 µl. PCR was performed in an automatic DNA thermal cycler 480 (Perkin-Elmer Corp.), with initial heating at 94°C for 2 min, followed by the Touch Down PCR program, 22 cycles of 94°C for 30 s, annealing for 1 min (the annealing temperature is reduced by 1°C per 2 cycles from 65°C to 55°C), 72°C for 1 min, and final 72°C for 10 min. Aurora-A cDNA was amplified using Aurora-A-F (AATTGCAGATTTTGGGTGGT) and Aurora-A-R (AAACTTCAGTAGCATGTTCCTGTC) oligonucleotides. The primers for S26 are S26F (CCGTGCCTCCAAGATGACAAAG) and S26R (GTTCGGTCCTTGCGGGCTTCAC). PCR was stopped at the exponential phase of the amplified genes, 29 cycles for Aurora-A and 23 cycles for S26. The products were electrophoresed on a 2% agarose gel. The concentrations of the PCR fragments were determined with the IS-1000 digital imaging system (Alpha Innotech, San Leandro, CA). The Aurora-A mRNA levels were determined by the ratio of signal intensity of Aurora-A to that of S26 measured by 1D Image Analysis software (Kodak Digital Science, Rochester, NY) and scored as high (ratio >1.0) or low (ratio <1.0). The Aurora-A mRNA level of nontumorous liver rarely exceeded a ratio of 1.0.
For the determination of p21 and Bax levels in Aurora-A-overexpressed cells, total RNA was extracted from Aurora-A or empty vector-transfected cells and analyzed for p21 and Bax expression by RT-PCR. The primers used were p21-F (cggcctggcacctcacct), p21-R (cctctcattcaaccgcctag), Bax-F (tcatccaggatcgagcaggg), and Bax-R (ccagatggtgagtgaggcgg). PCR was performed using Touch Down program and stopped at the exponential phase of the amplified genes, 28 cycles for both genes.
Cell Culture.
All of the cell lines used in this study were maintained in DMEM plus 10% FCS supplemented with penicillin and streptomycin.
Western Blot Hybridization.
To determine the expression levels of Aurora-A in liver cancer cell lines,
5 x 106 cells were taken up in 50 µl of loading buffer and boiled for 5 min. After a 30-s vortexing step to shear the genomic DNA, 30 µl of this extract was electrophoresed through SDS-10% polyacrylamide gels. After transfer to a polyvinylidene difluoride membrane, the proteins were detected with anti-Aurora-A antibody (1:1000; Cell Signaling, Beverly, MA), followed by horseradish peroxide-conjugated secondary antibody and chemiluminescence reagents (Amersham, Piscataway, NJ). The same membrane was reprobed with anti-ß-actin (1:2000; Sigma, St. Louis, MO) as a control for equivalent protein loading.
Immunofluorescence Staining.
Cells on 18-mm coverslips were fixed in 4% paraformaldehyde for 15 min. Fixed cells were blocked in PBS/5% FCS/0.1% Triton X-100 and subsequently incubated for 2 h in primary antibodies (Aurora-A, 1:250;
-tubulin, 1:200; Sigma). Cells were washed repeatedly in PBS/0.1% Triton X-100 and incubated for 45 min with a secondary antibody diluted 1:500 in same antibody buffer. Nuclei were counterstained with 0.5 µg/ml 4',6-diamidino-2-phenylindole for 10 min and washed in PBS.
Cloning and Transfection.
The full-length Aurora-A was kindly provided by Dr. Tang K. Tang (Institute of Biomedical Science, Academia Sinica, Taipei, Taiwan). Aurora-A-pCMV-Tag2B was constructed by cloning into the BamHI-XhoI site of pCMV-Tag2B. Using LipofectAMINE (Invitrogen) according to the manufacturers protocol, HEK 293 cells were transiently transfected with Aurora-A-pCMV-Tag2B or empty vector.
Southern Hybridization.
Genomic DNA samples (515 µg) of HCC and nontumorous liver tissues were isolated using the phenol-chloroform method, digested with BglII, HindIII, or EcoRI (Life Technologies, Inc., Gaithersburg, MD), subjected to electrophoresis on a 0.8% agarose, and transferred to Zeta-probe nylon membrane (Bio-Rad Labs, Richmond, CA), as described (31)
.To avoid cross-hybridization of Aurora-A pseudogene, an Aurora-A intron 2 probe was used. The membrane was hybridized with 32P-labeled probe, washed, dried, and autoradiographed at -70°C with X-Omat AR film (Eastman Kodak Co., Rochester, NY). The membranes were rehybridized with a ß-globin probe as a control.
Analysis of p53 and ß-Catenin Mutations.
Mutations of the p53 tumor suppressor gene and ß-catenin gene were detected by direct sequencing of exon 2 to exon 11 of p53 and exon 3 of ß-catenin as described previously (26
, 32)
. Cases with incomplete study were excluded from statistical analysis.
Follow-Up Observation.
During the follow-up period up to 175 months, 178 patients (79%) had been followed for >10 years or until death. At the end of follow-up, 60 patients remained alive, 14 of whom had survived for >10 years.
Statitical Analysis.
The analyses were performed using the Statistica for Windows software (Statsoft, Inc., Chicago, IL). Two-tailed
2 was used for univariate analysis. The cumulative survival after tumor removal was calculated with the log-rank test. Ps < 0.05 were considered statistically significant.
| RESULTS |
|---|
|
|
|---|
|
|
-tubulin at centrosome at interface and at centrosome, and mitotic spindle at metaphase (Fig. 3)
|
-fetoprotein elevation (P = 0.031).
|
HCCs with Aurora-A overexpression was associated with a significantly lower 10-year survival rate than HCCs without Aurora-A overexpression (P < 0.007; Fig. 4
).
|
|
Aurora-A Overexpression and p53 Target Genes.
Because Aurora-A overexpression was closely correlated with p53 mutation and Aurora-A was known to interact directly with p53 (33)
, we then analyzed the effects of Aurora-A on p53 target genes. RT-PCR analysis of Aurora-A-overexpressed HEK 293 cells demonstrated that Aurora-A did not significantly alter the transcriptional level of p21 and Bax (Fig. 6)
.
|
|
| DISCUSSION |
|---|
|
|
|---|
To study the role of Aurora-A in HCC, we analyzed its expression level in 224 cases, and detected overexpression of Aurora-A in 61% of the cases. Aurora-A overexpression was more frequently associated with higher grade, higher stage, and worse 10-year survival. Pervious studies indicated that most cancers with aneuploidy show a more malignant phenotype than diploid cancers (42 , 43) . These observations suggest that overexpression of Aurora-A, by causing chromosomal instability, may contribute to a more malignant phenotype of HCC.
Inactivation of p53 results in centrosome hyperamplification, leading to aberrant mitosis and chromosomal instability (44 , 45) . The p53 protein interacts directly with Aurora-A, and suppresses Aurora-A-induced centrosome amplification and cellular transformation in a transactivation-independent manner (33) . Centrosome amplification and aneuploidy induced by Aurora-A overexpression are exacerbated in a p53-/- background (46) . In this study, we found that Aurora-A overexpression was correlated with p53 mutation in HCC, and tumors with both Aurora-A overexpression and p53 mutation had worse prognosis than p53 mutation alone, but Aurora-A overexpression did not significant affect the expression level of p53 target genes. These observations provide in vivo evidence that Aurora-A and p53 had a synergistic effect contributing toward tumor progression and, hence, poor prognosis.
We also showed that Aurora-A overexpression was negatively associated with ß-catenin mutation. In previous study, we showed that ß-catenin mutation in HCC was associated with lower grade, lower stage, and better 5-year survival (26) . Laurent-Puig et al. (47) classified HCC into two groups. One is characterized by chromosome stability, ß-catenin mutation, and chromosome 8p loss. The other is characterized by chromosomal instability, Axin 1, and p53 mutation. The negative association of Aurora-A overexpression with ß-catenin mutation and positive association with p53 mutation suggest that Aurora-A overexpression is associated with the latter group and may account for the genomic instability in these tumors.
Amplification of Aurora-A was detected in only 3% of HCCs examined. Although Aurora-A amplification coincided with overexpression, many more cases showed Aurora-A overexpression without amplification. Thus, the expression of Aurora-A is likely to be regulated not only by gene amplification but also by other mechanisms such as transcriptional activation. Another possibility is that Aurora-A gene amplification occurred in only a proportion of the tumor cells and is undetectable by Southern blot analysis. Discrepancy between amplification and overexpression rates has also been reported in gastric cancer (39) , bladder cancer (21) , and pancreatic cancer (40) , indicating that transcriptional activation may be a major cause of Aurora-A overexpression in human cancers.
In summary, we have demonstrated that Aurora-A is highly expressed in HCC. Overexpression of Aurora-A may have important pathogenetic and prognostic significance in HCC.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Hey-Chi Hsu, Department of Pathology, National Taiwan University Hospital, No. 7 Chung-Shan South Road, Taipei 100, Taiwan. Phone: 886-2-23123456, extension 5455; Fax: 886-2-23934172; E-mail: heychi{at}ha.mc.ntu.edu.tw
Received 7/17/03; revised 12/10/03; accepted 12/10/03.
| REFERENCES |
|---|
|
|
|---|
-fetoprotein gene in unicentric and multicentric human hepatocellular carcinomas. Hepatology, 17: 35-41, 1993.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
C.-C. Li, H.-Y. Chu, C.-W. Yang, C.-K. Chou, and T.-F. Tsai Aurora-A Overexpression in Mouse Liver Causes p53-Dependent Premitotic Arrest during Liver Regeneration Mol. Cancer Res., May 1, 2009; 7(5): 678 - 688. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. VanderPorten, P. Taverna, J. N. Hogan, M. D. Ballinger, W. M. Flanagan, and R. V. Fucini The Aurora kinase inhibitor SNS-314 shows broad therapeutic potential with chemotherapeutics and synergy with microtubule-targeted agents in a colon carcinoma model Mol. Cancer Ther., April 1, 2009; 8(4): 930 - 939. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Perugorria, J. Castillo, M. U. Latasa, S. Goni, V. Segura, B. Sangro, J. Prieto, M. A. Avila, and C. Berasain Wilms' Tumor 1 Gene Expression in Hepatocellular Carcinoma Promotes Cell Dedifferentiation and Resistance to Chemotherapy Cancer Res., February 15, 2009; 69(4): 1358 - 1367. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Shen, F.-C. Hu, Y.-M. Jeng, Y.-T. Chang, Z.-Z. Lin, M.-C. Chang, C. Hsu, and A.-L. Cheng Nuclear Overexpression of Mitotic Regulatory Proteins in Biliary Tract Cancer: Correlation with Clinicopathologic Features and Patient Survival Cancer Epidemiol. Biomarkers Prev., February 1, 2009; 18(2): 417 - 423. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wakahara, T. Ohno, M. Kimura, T. Masuda, S. Nozawa, T. Dohjima, T. Yamamoto, A. Nagano, G. Kawai, A. Matsuhashi, et al. EWS-Fli1 Up-Regulates Expression of the Aurora A and Aurora B Kinases Mol. Cancer Res., December 1, 2008; 6(12): 1937 - 1945. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Ko, H.-C. Hsu, M.-R. Shen, W.-C. Chang, and J.-M. Wang Epigenetic Silencing of CCAAT/Enhancer-binding Protein {delta} Activity by YY1/Polycomb Group/DNA Methyltransferase Complex J. Biol. Chem., November 7, 2008; 283(45): 30919 - 30932. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Klein, D. Flugel, and T. Kietzmann Transcriptional Regulation of Serine/Threonine Kinase-15 (STK15) Expression by Hypoxia and HIF-1 Mol. Biol. Cell, September 1, 2008; 19(9): 3667 - 3675. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Gautschi, J. Heighway, P. C. Mack, P. R. Purnell, P. N. Lara Jr., and D. R. Gandara Aurora Kinases as Anticancer Drug Targets Clin. Cancer Res., March 15, 2008; 14(6): 1639 - 1648. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ogawa, K. Takenaka, H. Katakura, M. Adachi, Y. Otake, Y. Toda, H. Kotani, T. Manabe, H. Wada, and F. Tanaka Perimembrane Aurora-A Expression is a Significant Prognostic Factor in Correlation with Proliferative Activity in Non-Small-Cell Lung Cancer (NSCLC) Ann. Surg. Oncol., February 1, 2008; 15(2): 547 - 554. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Carpinelli, R. Ceruti, M. L. Giorgini, P. Cappella, L. Gianellini, V. Croci, A. Degrassi, G. Texido, M. Rocchetti, P. Vianello, et al. PHA-739358, a potent inhibitor of Aurora kinases with a selective target inhibition profile relevant to cancer Mol. Cancer Ther., December 1, 2007; 6(12): 3158 - 3168. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Kulkarni, M. Loddo, E. Leo, M. Rashid, K. L. Eward, T. R. Fanshawe, J. Butcher, A. Frost, J. A. Ledermann, G. H. Williams, et al. DNA Replication Licensing Factors and Aurora Kinases are Linked to Aneuploidy and Clinical Outcome in Epithelial Ovarian Carcinoma Clin. Cancer Res., October 15, 2007; 13(20): 6153 - 6161. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. N. Landen Jr., Y. G. Lin, A. Immaneni, M. T. Deavers, W. M. Merritt, W. A. Spannuth, D. C. Bodurka, D. M. Gershenson, W. R. Brinkley, and A. K. Sood Overexpression of the Centrosomal Protein Aurora-A Kinase is Associated with Poor Prognosis in Epithelial Ovarian Cancer Patients Clin. Cancer Res., July 15, 2007; 13(14): 4098 - 4104. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-H. Su, C.-C. Chao, S.-H. Yeh, D.-S. Chen, P.-J. Chen, and Y.-S. Jou OncoDB.HCC: an integrated oncogenomic database of hepatocellular carcinoma revealed aberrant cancer target genes and loci Nucleic Acids Res., January 12, 2007; 35(suppl_1): D727 - D731. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Reiter, P. Gais, U. Jutting, M. K. Steuer-Vogt, A. Pickhard, K. Bink, S. Rauser, S. Lassmann, H. Hofler, M. Werner, et al. Aurora Kinase A Messenger RNA Overexpression Is Correlated with Tumor Progression and Shortened Survival in Head and Neck Squamous Cell Carcinoma Clin. Cancer Res., September 1, 2006; 12(17): 5136 - 5141. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Hsu, H.-H. Fu, Y.-M. Jeng, P.-H. Lee, and S.-D. Yang Proline-Directed Protein Kinase FA Is a Powerful and Independent Prognostic Predictor for Progression and Patient Survival of Hepatocellular Carcinoma J. Clin. Oncol., August 10, 2006; 24(23): 3780 - 3788. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Soncini, P. Carpinelli, L. Gianellini, D. Fancelli, P. Vianello, L. Rusconi, P. Storici, P. Zugnoni, E. Pesenti, V. Croci, et al. PHA-680632, a Novel Aurora Kinase Inhibitor with Potent Antitumoral Activity. Clin. Cancer Res., July 1, 2006; 12(13): 4080 - 4089. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lopez-Rios, S. Chuai, R. Flores, S. Shimizu, T. Ohno, K. Wakahara, P. B. Illei, S. Hussain, L. Krug, M. F. Zakowski, et al. Global Gene Expression Profiling of Pleural Mesotheliomas: Overexpression of Aurora Kinases and P16/CDKN2A Deletion as Prognostic Factors and Critical Evaluation of Microarray-Based Prognostic Prediction. Cancer Res., March 15, 2006; 66(6): 2970 - 2979. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yamashita, H. Igarashi, Y. Kitayama, T. Ozawa, S. Kiyose, H. Konno, T. Kazui, S. Ishikawa, H. Aburatani, F. Tanioka, et al. Chromosomal Numerical Abnormality Profiles of Gastrointestinal Stromal Tumors Jpn. J. Clin. Oncol., February 1, 2006; 36(2): 85 - 92. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hata, T. Furukawa, M. Sunamura, S. Egawa, F. Motoi, N. Ohmura, T. Marumoto, H. Saya, and A. Horii RNA Interference Targeting Aurora Kinase A Suppresses Tumor Growth and Enhances the Taxane Chemosensitivity in Human Pancreatic Cancer Cells Cancer Res., April 1, 2005; 65(7): 2899 - 2905. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tong, Y. Zhong, J. Kong, L. Dong, Y. Song, M. Fu, Z. Liu, M. Wang, L. Guo, S. Lu, et al. Overexpression of Aurora-A Contributes to Malignant Development of Human Esophageal Squamous Cell Carcinoma Clin. Cancer Res., November 1, 2004; 10(21): 7304 - 7310. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |