| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Human Cancer Biology |
Authors' Affiliation: Department of Ophthalmology and Visual Sciences, Washington University School of Medicine, St. Louis, Missouri
Requests for reprints: J. William Harbour, Box 8096, 660 South Euclid Avenue, St. Louis, MO 63110. Phone: 314-362-3315; Fax: 314-747-5073; E-mail: harbour{at}wustl.edu.
| Abstract |
|---|
|
|
|---|
Experimental Design: Gene expression microarray analysis was done on 25 primary uveal melanomas. Microarray comparative genomic hybridization (CGH), quantitative PCR, and immunohistochemistry were done on a subset of these tumors. Cell motility was measured using a wound-healing assay.
Results: In melanomas analyzed for microarray gene expression and CGH, gain of chromosome 8q correlated most strongly with expression of DDEF1, a gene located at 8q24. In contrast, the nearby MYC oncogene exhibited no significant change in expression. Confirming the microarray findings, DDEF1 mRNA levels and protein expression were significantly higher in high-grade melanomas. Furthermore, ectopic expression of DDEF1 in low-grade melanoma cells resulted in a significant increase in cell motility, a feature of high-grade metastasizing cells.
Conclusions: These findings suggest that DDEF1 overexpression may be a pathogenetically relevant consequence of chromosome 8q amplification, which commonly occurs in high-grade uveal melanomas. We conclude that DDEF1 may act as an oncogene in this cancer, and it may be a useful diagnostic marker and therapeutic target.
Key Words: DDEF1 MYC chromosome 8 uveal melanoma eye cancer
We recently described a novel molecular classification of uveal melanoma based on gene expression profile that distinguishes low-grade (class 1) from high-grade (class 2) tumors (5). This gene expression profile predicts metastatic death with greater accuracy than other clinical-pathologic factors, and it reveals a cluster of genes on chromosome 8q that is significantly overexpressed in high-grade tumors. These findings corroborate the earlier cytogenetic data and support the notion that one or more oncogenes residing in this region may be overexpressed during melanoma progression.
This microarray gene expression database provided an opportunity for us to search for candidate oncogenes on chromosome 8q in uveal melanoma. Such a discovery could provide a new diagnostic marker, lead to the development of targeted anticancer therapy, and provide new insights into the pathogenesis of this cancer. We show here that DDEF1, located at chromosome 8q24, exhibits several features that suggest that it may function as an oncogene during uveal melanoma progression.
| Materials and Methods |
|---|
|
|
|---|
Comparative genomic hybridization microarray analysis. These experiments were done as previously described (5). Briefly, genomic DNA was prepared from six uncultured tumor specimens using the DNEasy kit (Qiagen, Valencia, CA). Microarray comparative genomic hybridization (CGH) was done and the log 2 average raw ratio (a measure of DNA copy number with normal 2N = 0) was calculated by the Microarray Shared Resource at the Comprehensive Cancer Center University of California San Francisco, as previously described (7).
Real-time PCR. Quantitative real-time PCR was done on eight tumor samples using the Invitrogen Lux primer system (Invitrogen, Carlsbad, CA) according to the instructions of the manufacturer for the Biorad I-cycler (Bio-Rad Laboratories, Hercules, CA). Primers for DDEF1 cDNA were TCCTCAGTGTCAGGGCACAT and Fam-labeled CACCAAGTTCCTCATGCTCTGTTTGG5G, and primers for glyceraldehyde-3-phosphate dehydrogenase were GTGCAGGAGGCATTGCTGAT and Fam-labeled GACGTATGCTGGCGCTGAGTACG5C. Complimentary DNA was generated using the Ambion Retroscript kit (Ambion, Austin, TX) with the Invitrogen Superscript Reverse Transcriptase. The results were analyzed using the I-cycler software, setting a user-defined baseline from 2 to 15 cycles and a user-defined threshold of 50. Values were then normalized to glyceraldehyde-3-phosphate dehydrogenase for sample comparison.
Quantitative immunohistochemistry. Formalin-fixed, paraffin-embedded sections from 17 uveal melanomas were immunostained with a 1:500 dilution of anti-DDEF1 antibody (gift from Dr. Paul Randazzo, Division of Basic Sciences, National Cancer Institute, Bethesda, MA) using the streptavidin-biotin method with the Vector ABC Elite kit (Vector Laboratories, Inc., Burlingame, CA) as previously described (8). Blue stain was used to eliminate confusion with melanoma-associated brown pigment. Nuclear fast red was used for counterstain. Images were obtained at x40 magnification and processed in a standardized manner to eliminate red counterstain using Adobe Photoshop software (Adobe, San Jose, CA). Resulting images were analyzed in a masked fashion with ImageJ software (available at http://rsb.info.nih.gov/ij) using the polygon tool and measure function to determine the average intensity per unit area. Cytoplasmic measurements were obtained from 10 random areas and 5 random background fields derived from four separate images. After subtracting the mean background measurement, the mean intensity and SE were calculated for the tumor cells.
Wound-healing assay. Mel202 uveal melanoma cells (maintained in RPMI 1640 10% fetal bovine serum) express low levels of endogenous DDEF1 and cluster with low-grade (class 1) uveal melanomas in our gene expression profile (data not shown). These cells were transfected with a DDEF1 mRNA expression vector or a control empty vector, both in pcDNA3.1neo (gifts of Dr. Thomas Roberts, Department of Cancer Biology, Dana Farber Cancer Institute, Harvard Medical School, Boston, MA) using Effectene (Qiagen) according to the instructions of the manufacturer. To measure cell motility in these transfected cells, we used the wound-healing assay that is widely accepted for this purpose (9). Selection was initiated 24 hours after transfection with G418 (Sigma, St. Louis, MO). Forty-eight hours later, cells were replated at 2 x 105/35-mm dish and grown for 24 hours. Then, a 500-µm-wide "wound" was made on each p35 with a sterile plastic loop. Three digital photos were taken of each wound at 0, 24, 48, and 72 hours. The plates were marked to ensure consistent photodocumentation. Using the ImageJ software, the area of each wound was calculated at each time point. The experiment was conducted in triplicate.
| Results |
|---|
|
|
|---|
|
Quantitative PCR and immunohistochemistry. To validate these findings, we analyzed DDEF1 mRNA expression in uncultured tumor tissue from four class 1 tumors and four class 2 tumors using real-time PCR. DDEF1 mRNA expression by PCR strongly correlated with microarray results (Pearson correlation, r = 0.93, P < 0.001; Fig. 2A) and exhibited a mean DDEF1 up-regulation of 16-fold in class 2 tumors (P = 0.005; Fig. 2B). We then used 17 paraffin-embedded tumors to evaluate DDEF1 protein expression using quantitative immunohistochemistry. There was a strong correlation between microarray mRNA expression and cytoplasmic immunostaining intensity (Pearson coefficient, r = 0.81, P < 0.0001), and the DDEF1 protein was significantly up-regulated in class 2 tumors (P < 0.0001; Fig. 2C).
|
|
| Discussion |
|---|
|
|
|---|
Development and differentiation enhancing factor 1 (DDEF1), also known as Arf-GAP containing SH3, ankyrin repeats and pleckstrin domain (ASAP1), is an ADP ribosylation factor-GTPase activating protein that interacts with signal transduction proteins involved in growth and differentiationsuch as SRK, FAK, phosphatidylinositol 4,5-biphosphate, and CRKand regulates actin cytoskeletal remodeling that is necessary for cell motility (1215). Cell motility involves an inhibition of cell spreading followed by extension of peripheral elastic lamellae in the direction of locomotion, which requires the continual remodeling of the actin cytoskeleton and assembly/disassembly of focal adhesions at the leading and trailing edges, respectively, of the motile cell (16). DDEF1 protein localizes to newly forming focal complexes at the cell periphery and regulates these cyclical changes in the cytoskeleton and focal adhesions (13). Overexpression of DDEF1 protein disrupts focal adhesion turnover, thereby blocking cell spreading and promoting cell motility (17). Hence, oncogenic up-regulation of DDEF1 may explain, at least in part, the increased invasion and metastatic potential of high-grade uveal melanoma.
These findings may provide new insights into uveal melanoma pathogenesis and suggest that DDEF1 may be an effective therapeutic target in high-grade uveal melanomas and other cancers. Further, DDEF1 may be a useful diagnostic marker to identify uveal melanoma patients at high risk of metastasis.
| Footnotes |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 9/21/04; revised 2/ 8/05; accepted 2/21/05.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Zhu, Y. Wu, J. I. Kim, Z. Wang, Y. Daaka, and Z. Nie Arf GTPase-activating Protein AGAP2 Regulates Focal Adhesion Kinase Activity and Focal Adhesion Remodeling J. Biol. Chem., May 15, 2009; 284(20): 13489 - 13496. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Onken, L. A. Worley, and J. W. Harbour A Metastasis Modifier Locus on Human Chromosome 8p in Uveal Melanoma Identified by Integrative Genomic Analysis Clin. Cancer Res., June 15, 2008; 14(12): 3737 - 3745. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lin, A. Watahiki, J. Bayani, F. Zhang, L. Liu, V. Ling, M. D. Sadar, J. English, L. Fazli, A. So, et al. ASAP1, a Gene at 8q24, Is Associated with Prostate Cancer Metastasis Cancer Res., June 1, 2008; 68(11): 4352 - 4359. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L. Ha, S. Bharti, H. Inoue, W. C. Vass, F. Campa, Z. Nie, A. de Gramont, Y. Ward, and P. A. Randazzo ASAP3 Is a Focal Adhesion-associated Arf GAP That Functions in Cell Migration and Invasion J. Biol. Chem., May 30, 2008; 283(22): 14915 - 14926. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Klijn, H. Holstege, J. de Ridder, X. Liu, M. Reinders, J. Jonkers, and L. Wessels Identification of cancer genes using a statistical framework for multiexperiment analysis of nondiscretized array CGH data Nucleic Acids Res., February 2, 2008; 36(2): e13 - e13. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Ehlers, L. Worley, M. D. Onken, and J. W. Harbour Integrative Genomic Analysis of Aneuploidy in Uveal Melanoma Clin. Cancer Res., January 1, 2008; 14(1): 115 - 122. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bharti, H. Inoue, K. Bharti, D. S. Hirsch, Z. Nie, H.-Y. Yoon, V. Artym, K. M. Yamada, S. C. Mueller, V. A. Barr, et al. Src-Dependent Phosphorylation of ASAP1 Regulates Podosomes Mol. Cell. Biol., December 1, 2007; 27(23): 8271 - 8283. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Nishikawa, M. Toyota, H. Suzuki, T. Honma, T. Fujikane, T. Ohmura, T. Nishidate, M. Ohe-Toyota, R. Maruyama, T. Sonoda, et al. Gene Amplification and Overexpression of PRDM14 in Breast Cancers Cancer Res., October 15, 2007; 67(20): 9649 - 9657. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Yamamoto-Furusho, N. Barnich, R. Xavier, T. Hisamatsu, and D. K. Podolsky Centaurin beta1 Down-regulates Nucleotide-binding Oligomerization Domains 1- and 2-dependent NF-{kappa}B Activation J. Biol. Chem., November 24, 2006; 281(47): 36060 - 36070. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Harbour Eye Cancer: Unique Insights into Oncogenesis The Cogan Lecture Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 1737 - 1745. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |