Clinical Cancer Research CR Balducci Advances in Breast Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bastian, P. J.
Right arrow Articles by Nelson, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bastian, P. J.
Right arrow Articles by Nelson, W. G.
Clinical Cancer Research Vol. 11, 4037-4043, June 1, 2005
© 2005 American Association for Cancer Research


Imaging, Diagnosis, Prognosis

Preoperative Serum DNA GSTP1 CpG Island Hypermethylation and the Risk of Early Prostate-Specific Antigen Recurrence Following Radical Prostatectomy

Patrick J. Bastian1, Ganesh S. Palapattu1, Xiaohui Lin2, Srinivasan Yegnasubramanian4, Leslie A. Mangold1, Bruce Trock1, Mario A. Eisenberger1,2,5, Alan W. Partin1 and William G. Nelson1,2,3,4,5

Authors' Affiliations: 1 The James Buchanan Brady Urological Institute and Departments of Urology, 2 Oncology, 3 Pathology, and 4 Pharmacology, and 5 The Sidney Kimmel Comprehensive Cancer Center, The Johns Hopkins University School of Medicine, Baltimore, Maryland

Requests for reprints: William G. Nelson, The Johns Hopkins University School of Medicine, Room 151, Bunting Blaustein Research Building, 1650 Orleans Street, Baltimore, MD 21231-1000. Phone: 410-614-1661; Fax: 410-502-9817; E-mail: bnelson{at}jhmi.edu.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Purpose: Hypermethylation of the CpG island at the promoter region of the {pi}-class glutathione S-transferase gene (GSTP1) is the most common somatic genome abnormality in human prostate cancer. We evaluated circulating cell-free DNA GSTP1 CpG island hypermethylation as a prognostic biomarker in the serum of men with prostate cancer.

Experimental Design: Prostate cancer DNA GSTP1 CpG island hypermethylation was detected using a restriction endonuclease quantitative PCR technique. We analyzed preoperative serum from 85 men with clinically localized prostate cancer treated with radical prostatectomy and from 35 men with a negative prostate biopsy. We then assayed preoperative serum from a data set of 55 pairs of men with clinically localized prostate cancer treated with radical prostatectomy, matched for Gleason score, comprising 55 men suffering prostate-specific antigen (PSA) recurrence (median, 2 years) and 55 men who were free of disease at last follow-up (median, 3 years). The association of serum GSTP1 CpG island hypermethylation and PSA recurrence was determined.

Results: Circulating cell-free DNA with GSTP1 CpG island hypermethylation was not detected in the serum of men with a negative prostate biopsy but was detected in 12% of men with clinically localized disease and 28% of men with metastatic cancer (P = 0.003). In the matched data set, eight men (15%) who developed PSA recurrence were positive for DNA with GSTP1 CpG hypermethylation, whereas no patient who was free of disease was positive for GSTP1 CpG island hypermethylation (McNemar test, {chi}2 = 6.1, P = 0.01). In a multivariable analysis that accounted for recognized prognostic factors, the presence of serum DNA with GTSP1 CpG island hypermethylation was the most significant predictor of PSA recurrence (hazard ratio, 4.4; 95% confidence interval, 2.2, 8.8; P < 0.001).

Conclusion: Our study suggests that GSTP1 CpG island hypermethylation may be an important DNA-based prognostic serum biomarker for prostate cancer.

Key Words: prostate cancer • GSTP1 • CpG island hypermethylation • serum • PSA recurrence


Prostate cancer is the most commonly diagnosed solid organ malignancy among men in the United States, accounting for an estimated 230,000 new cases in 2004 alone (1). Primary therapy in the form of radical prostatectomy is one of the principal treatment modalities available for men with clinically localized disease. Whereas approximately two thirds of patients treated with curative intent by surgery will remain disease free 15 years following radical prostatectomy, those who experience early prostate-specific antigen (PSA) recurrence, particularly within the first 2 years of surgery, are prone to develop metastatic lesions and are likely to succumb to prostate cancer (2, 3). Preoperative identification of men at risk for early disease progression following radical prostatectomy could improve patient selection for local therapies and identify early those at risk for relapse as potential candidates for adjuvant protocols; thus, accelerating the delivery of multimodal therapies to those who may potentially benefit the most.

Somatic genome alterations (e.g., mutations, deletions, rearrangements, amplifications, and DNA methylation) are relatively frequent events in human cancers. Of these, DNA hypermethylation has been noted the most common (4, 5). Dinucleotides consisting of a cytosine preceding a guanosine (CpG) in the DNA sequence are susceptible to the actions of a class of enzymes, DNA methyltransferases, that catalyze the transfer of a methyl group to the cytosine ring, yielding 5-methyl cytosine (5mC). Clusters of CpG dinucleotides, termed CpG islands, occur with increased frequency in the promoter area of approximately half of all genes in the human genome. Hypermethylation of promoter-associated CpG islands is thought to repress transcriptional activity of the downstream gene, resulting in loss of production of mRNA and corresponding protein (6).

CpG island hypermethylation within the regulatory region of the {pi}-class glutathione S-transferase gene (GSTP1) has been observed to be the most prevalent somatic genome abnormality in human prostate cancer (7, 8). GSTP1 encodes an enzyme that acts as a carcinogen detoxifier by catalyzing conjugation reactions with reduced glutathione (7). Somatic GSTP1 CpG island hypermethylation has been noted in >90% of prostate cancer tissues, whereas it has not been observed in the normal prostate (9). It is important to note that DNA with GSTP1 CpG island hypermethylation is rarely seen elsewhere in the body, occurring with significance only in cancers of the liver and breast (10). Recently, analyses of bodily fluids from men with prostate cancer have revealed DNA containing GSTP1 CpG island hypermethylation, suggesting a possible role for this epigenetic phenomenon as a novel biomarker for prostate cancer (8, 9, 11). Using a restriction endonuclease quantitative PCR–based strategy that is capable of detecting a single hypermethylated CpG island allele, we sought to further characterize DNA-harboring GSTP1 CpG island hypermethylation in the preoperative serum of men with prostate cancer and to determine its association with PSA progression in men with initially clinically localized disease following radical prostatectomy (12).


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Sample collection and DNA isolation. All serum samples were collected before prostate biopsy and stored at –80°C. Eighty-five consecutive men who underwent radical prostatectomy in 1999 at The Johns Hopkins Hospital for localized prostate cancer served as the initial study population (Table 1). Thirty-five men without evidence of cancer on prostate biopsy served as a control population. Sera from 18 men with metastatic prostate cancer were also examined. Based on our findings from the 85 consecutive patients (initial cohort), a subsequent group of 55 matched pairs of men with clinically localized prostate cancer treated with radical prostatectomy was created (validation cohort). This group was composed of 55 men who developed PSA recurrence and 55 men who did not experience PSA recurrence at last follow-up. Men in this data set were matched on the basis of pathologic Gleason score. Pathologic stage and duration of follow-up were used as secondary matching criteria. DNA was extracted from 600 µL of archived serum from each patient using the Qiagen Blood Mini Kit (Valencia, CA).


View this table:
[in this window]
[in a new window]

 
Table 1. Patient characteristics of men with no evidence of cancer on prostate biopsy and men with clinically localized prostate cancer treated with radical prostatectomy

 
The primary end point of the study was PSA recurrence which was defined as a single post-prostatectomy PSA level of >0.2 ng/mL. Routine PSA follow-up consisted of a measurement 3 months post-operatively and annually thereafter. All of the men studied had an undetectable serum PSA level 3 months after radical prostatectomy.

To show the efficacy of our assay, DNA from prostate tissues were examined for GSTP1 CpG hypermethylation. Genomic DNA from paraffin-embedded, formalin-fixed samples (n = 2) or fresh frozen blocks (n = 19) was extracted using the Qiagen DNA Mini Kit or as described previously (13). Prostate cancer tissue samples were obtained from radical prostatectomy specimens. Benign prostates were obtained from 13 cadaveric tissue donors, none of which contained histologic evidence of malignancy. Sample preparation was done as previously described (13). All studies were conducted with the approval of the Institutional Review Board.

Restriction endonuclease quantitative PCR. A variety of techniques to detect DNA with GSTP1 CpG island hypermethylation in prostatic tissues and bodily fluids have been described (9). We used the previously described restriction endonuclease quantitative PCR method (12). This method allows the quantification of the amount of total DNA and methylated DNA in each sample and is able to detect as few as one methylated GSTP1 allele. Briefly, DNAs extracted from serum samples were subjected to restriction enzyme digestion with HpaII (NEB, Beverly, MA). HpaII cuts the sequence CCGG but does not cut the methylated form of this sequence, C5mCGG. If the CpG island does not contain C5mCGG, the DNA is cut and no product can be detected after PCR amplification. Typically, 4 µL of DNA was incubated at 37°C for 5 hours with 60 units of restriction enzyme, 2 µL of 10x restriction enzyme buffer (NEB) and the appropriate amount of DNase-free water to give a final reaction volume of 20 µL. To ensure complete digestion, an additional 30 units of restriction enzyme, 1 µL of restriction enzyme buffer and 6 µL of DNase-free water were added to each reaction and incubated at 37°C overnight. As individual sample controls, PCR amplification was done on undigested DNA and DNA digested with the restriction enzyme MspI (NEB) using the above protocol. MspI cuts both the unmethylated and methylated sequence; thus, no PCR product should be detected. All PCR reactions were carried out in an iCycler real-time thermal cycler (Bio-Rad, Hercules, CA) using a specific primer set (5' primer, ACTCACTGGTGGCGAAGACT; 3' primer, GACCTGGGAAAGAGGGAAAG; ref. 14) that brackets six HpaII/MspI recognition sites. PCR conditions were set as follows: 95°C for 15 minutes followed by 45 cycles of 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 45 seconds. Calibration curve analysis was done after each PCR. PCR was accomplished using a 25-µL reaction mixture, consisting of 4 µL template DNA, 100 nmol/L of forward and reverse primer and 12.5 µL of a 2x Sybr Green PCR Master Mix (Qiagen). In each reaction set, restriction enzyme–treated universally methylated DNA (Chemicon, Temecula, CA) served as a positive control and restriction enzyme–treated WBC DNA and a water blank served as negative controls. Each reaction was done in duplicate. A 10-fold dilution series of known DNA concentrations was used to generate a standard curve (100-0.001 ng). The total amount of DNA from each sample was calculated using the standard curve derived from the non–restriction enzyme treated control. The methylation index was calculated as: (amount of HpaII digested DNA / amount of input DNA) – (amount of MspI digested DNA / amount of input DNA) multiplied by 100 [i.e., (methylated DNA – nonspecifically amplified DNA) x 100].

Statistical analysis. Sample size for the matched pair analysis was based on detection of relative risks of ≥4, based on preliminary data. Univariate comparisons between recurrent and nonrecurrent patients consisted of {chi}2 or Fisher's exact tests for categorical variables and t tests for continuous variables. Continuous variables were evaluated for departure from a Gaussian distribution using the Kolmogorov-Smirnov test. Survival distributions were estimated using the Kaplan-Meier method, and compared using the log-rank and Gehan-Wilcoxon tests. For all analyses, serum GSTP1 CpG island hypermethylation status was taken as a dichotomous variable (i.e., positive or negative). Hazard ratios (HR) and 95% confidence intervals (95% CI) were adjusted for multiple prognostic factors using the Cox proportional hazards model. Models were developed in a manual hierarchical approach based on the likelihood ratio test and changes in the magnitude of hazard ratios.

Because the study employed both retrospective and prospective study samples, a variable was included in the model to adjust for differences between the samples. That is, in the retrospective group, half of the men (n = 55) by definition experienced PSA recurrence after surgery. When the two groups, prospective and retrospective, were combined in an analysis assessing an association with PSA recurrence, a variable, termed Dataset, was introduced to account for the much higher probability of PSA recurrence of men in the matched pair cohort.

Cross-product (interaction) terms with this variable were also evaluated in the model to determine whether the effect of prognostic factors differed between the two samples. All statistical analyses were done using SAS software, version 8.0 (SAS Institute, Cary, NC).


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Detection of DNA with GSTP1 CpG island hypermethylation in prostate cancer tissues and preoperative serum. Among the serum samples assayed, DNA with GSTP1 CpG island hypermethylation was not present in any of the men with a negative prostate biopsy, 12% (10 of 85) of men with clinically localized prostate cancer and 28% (5 of 18) of patients with hormone-refractory metastatic disease (Fig. 1). More advanced disease was associated with a higher proportion of men with GSTP1 CpG island hypermethylation detectable in the serum (P = 0.003). These results are similar to those that have been reported by others (11, 15). Ten of the 85 consecutive men with localized disease were positive for GSTP1 CpG island hypermethylation. Among these 10 positive cases, three developed PSA recurrence following surgery. Of the 75 negative cases, one experienced biochemical recurrence after surgery. As expected, we detected DNA with GSTP1 CpG island hypermethylation in 100% of prostate cancer tissues (n = 21) and in none of the normal prostate tissue controls (n = 13).



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Dot plot of the DNA GSTP1 CpG island methylation index for tissues from normal men and men with clinically localized prostate cancer and serum samples from men with a negative prostate biopsy, clinically localized prostate cancer, and metastatic prostate cancer. Single case ({square}). Due to the large number of men with a negative serum assay for GSTP1 hypermethylation in the biopsy negative and localized prostate cancer groups, {square} along the x-axis may appear solid. More advanced disease was associated with a higher proportion of men with serum DNA GSTP1 CpG island hypermethylation (P = 0.003). GSTP1 hypermethylation index was calculated = (methylated DNA – nonspecifically amplified DNA) x 100. See Materials and Methods for a more detailed description.

 
Univariate analysis and prostate-specific antigen–free survival of 85 consecutive men with clinically localized prostate cancer. In a univariate Cox proportional hazards model, the only factors significantly associated with PSA progression was DNA with GSTP1 CpG island hypermethylation in the serum (HR, 24; 95% CI, 2.5-231.2; P = 0.006) and pathologic Gleason score (HR, 10; 95% CI, 1.0-95.80; P = 0.05; Table 2). Kaplan Meier survival analysis for time to PSA progression following radical prostatectomy showed a significant PSA-free survival advantage for patients who had no detectable hypermethylated GSTP1 DNA in their serum (log-rank P < 0.001; Fig. 2A).


View this table:
[in this window]
[in a new window]

 
Table 2. Univariate Cox proportional hazards model with respect to PSA progression of 85 consecutive patients (initial cohort) with clinically localized prostate cancer treated with radical prostatectomy

 


View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. A, Kaplan-Meier survival analysis with respect to PSA recurrence of 85 consecutive men with clinically localized prostate cancer treated with radical prostatectomy, separated by preoperative serum DNA GSTP1 CpG island hypermethylation status (i.e., GSTP1 CpG island meth = methylation negative and GSTP1 CpG island meth+ = methylation positive). B, Kaplan-Meier survival analysis with respect to PSA recurrence of 55 pairs of men with clinically localized prostate cancer treated with radical prostatectomy, matched based on pathologic Gleason score, separated by preoperative serum DNA GSTP1 CpG island hypermethylation status (i.e., GSTP1 CpG island meth = methylation negative and GSTP1 CpG island meth+ = methylation positive). C, Kaplan-Meier survival analysis with respect to PSA recurrence of all men with clinically localized prostate cancer (n = 192) treated with radical prostatectomy, separated by preoperative serum DNA GSTP1 CpG island hypermethylation status (i.e., GSTP1 CpG island meth = methylation negative and GSTP1 CpG island meth+ = methylation positive). The 3-year PSA-free survival rate for men with either positive or negative serum DNA GSTP1 CpG island hypermethylation was 41% and 74%, respectively.

 
Assessment of preoperative serum DNA with GSTP1 CpG island hypermethylation in a matched cohort of men with clinically localized prostate cancer. Based on the above results and the fact that the initial consecutive cohort of men had only a small number of PSA recurrences (n = 4), a second data set was studied (validation cohort), consisting of 55 pairs of men with clinically localized prostate cancer, dichotomized by the presence or absence of PSA recurrence following radical prostatectomy (see Materials and Methods, Table 3). Eight men (15%) among the 55 who developed PSA recurrence were also positive for GSTP1 CpG island hypermethylation in the serum, whereas no patient who was free of disease at last follow-up was positive for GSTP1 CpG island hypermethylation. Thus, the odds ratio of PSA recurrence for men positive for serum GSTP1 CpG island hypermethylation in this model approached infinity (e.g., 8/0). That is, in all eight pairs (100%) with a positive assay, the recurrent patient was serum positive for GSTP1 CpG island hypermethylation whereas the nonrecurrent matched patient was negative (McNemar test, {chi}2 = 6.1, P = 0.01). Median time to PSA recurrence for the 55 men who experienced biochemical relapse was 2 years (range, 1-5) and the median follow-up time for the 55 men who were free of disease was 3 years (range, 1-7).


View this table:
[in this window]
[in a new window]

 
Table 3. Patient characteristics of a matched cohort (validation data set) of men with clinically localized prostate cancer treated with radical prostatectomy

 
Univariate analysis and prostate-specific antigen–free survival of 55 matched pairs of men. Univariate Cox proportional hazards analysis of the paired matched data set (validation cohort) identified positive serum GSTP1 CpG island hypermethylation, preoperative PSA, surgical margin status, and positive lymph nodes as factors significantly associated with PSA recurrence post-prostatectomy (Table 4). Median time to PSA recurrence following radical prostatectomy was 2 and 4 years for men who were either positive or negative, respectively, for preoperative serum GSTP1 CpG island hypermethylation (log-rank P < 0.001; Fig. 2B). No patient who was positive for serum DNA with GSTP1 CpG island hypermethylation was free of biochemical recurrence beyond 3 years from surgery. As expected in this matched data set, pathologic Gleason score was not associated with PSA recurrence.


View this table:
[in this window]
[in a new window]

 
Table 4. Univariate Cox proportional hazards model with respect to PSA progression of 55 matched pairs of men (validation cohort) with clinically localized prostate cancer treated with radical prostatectomy

 
Multivariable analysis and prostate-specific antigen–free survival of aggregate patient population. Both subject groups were then combined for subsequent analysis (n = 192; three men from the consecutive data set were also in the matched paired data set). To minimize a bias towards finding a positive association between GSTP1 CpG island hypermethylation and PSA recurrence that may have resulted from study design, we incorporated an additional variable in the multivariable Cox proportional hazards model (i.e., Dataset) that would serve to remove the artifactual effect of increased risk of PSA recurrence in the matched pair data set, where 50% by definition developed PSA recurrence. In the multivariable Cox proportional hazards model, positive serum GSTP1 CpG island hypermethylation status was the most significant predictor of PSA recurrence (HR, 4.4; 95% CI, 2.2-8.8; P < 0.001; Table 5). The effect of DNA with GSTP1 CpG island hypermethylation did not differ significantly between the two data sets (P = 0.093 for interaction). Pathologically positive lymph nodes and positive surgical margins were also significantly associated with biochemical recurrence. The 3-year PSA-free survival rate for men with either positive or negative serum GSTP1 CpG island hypermethylation was 41% and 74%, respectively (log-rank P = 0.01; Fig. 2C).


View this table:
[in this window]
[in a new window]

 
Table 5. Multivariable Cox proportional hazards model with respect to PSA progression for all men with clinically localized prostate cancer treated with radical prostatectomy (n = 192)

 
Association of preoperative serum DNA GSTP1 CpG island hypermethylation status with established prognostic factors. None of the previously defined prognostic features associated with PSA recurrence displayed a statistically significant relationship with GSTP1 CpG island hypermethylation status (Table 6; refs. 16, 17). These findings suggest that preoperative serum GSTP1 CpG island hypermethylation positivity may be an independent risk factor for biochemical relapse following radical prostatectomy.


View this table:
[in this window]
[in a new window]

 
Table 6. Association of positive serum GSTP1 CpG island hypermethylation status with established prognostic factors from aggregate patient sample (n = 192)

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we have shown that men with clinically localized prostate cancer with a positive preoperative serum analysis for GSTP1 CpG island hypermethylation, a marker of prostate cancer DNA, were at significant risk to experience PSA recurrence within the first several years following radical prostatectomy. This is the first use of a cancer-specific molecular biomarker as a blood test for prostate cancer prognosis. For all men with clinically localized disease, those with a positive preoperative serum assay for DNA GSTP1 CpG island hypermethylation were at 4.4 times greater risk to develop biochemical relapse than those with a negative test. Among the established preoperative and postoperative predictors of PSA recurrence (i.e., preoperative PSA, clinical stage, biopsy Gleason score, pathologic Gleason score, extraprostatic extension, seminal vesicle invasion, positive pathologic lymph nodes, pathologic organ confined status, and positive surgical margins), preoperative positive DNA GSTP1 CpG island hypermethylation status was the single most powerful predictor of PSA recurrence. In addition, we noted that positive GSTP1 CpG island hypermethylation was not significantly associated with any of the aforementioned variables. These results suggest that DNA with GSTP1 CpG island hypermethylation is a promising independent DNA-based prognostic serum biomarker for prostate cancer.

The presence of cell-free prostate cancer DNA in the serum of men with localized disease portended a poor prognosis. What is the source of cell-free DNA in the blood? Whereas multiple hypotheses exist, the true origins of this phenomenon remain unknown. Potential explanations include the release of DNA by normal cells undergoing apoptosis and the liberation of nucleic acids by tumor cells undergoing necrosis (18, 19). DNA released from fragile cells during the clotting process after blood sampling may be an additional source of serum cell-free DNA (20), although this contribution is thought to be negligible (18). Our finding that prostate cancer DNA, assessed by GSTP1 hypermethylation, in the preoperative serum of men with localized prostate cancer is associated with a poor prognosis may relate to previously described characteristics of more aggressive tumors (i.e., increased access to circulation, increased cell turnover, and the presence of micrometastases; refs. 2125). Any of these traits, alone or in combination, might increase the likelihood that cell-free prostate cancer DNA would be present in the serum. What is the fate of circulating cell-free DNA? The clearance of blood-borne DNA is poorly understood. Plasma nucleases as well as hepatic and renal clearance mechanisms are thought to play an important role in clearing the blood of free nucleic acids (26, 27). The half-life of tumor associated circulating DNA is estimated to be in the order of hours (28, 29).

Regardless of its origins or function, circulating cell-free DNA-based biomarkers have certain advantages over those employing RNA or protein. DNA is vastly more stable than RNA and is easier than protein to manipulate in the laboratory to identify subtle changes. As genetic mutations are very specific for neoplastic processes, their detection may seem ideal for the identification of certain cancers, such as colon cancer where over 50% of tumors contain a mutation in either K-RAS or p53 (30). Prostate cancer, however, is genetically heterogeneous both among affected men and within a diseased organ, making such a strategy problematic. The near-universal epigenetic alteration of GSTP1 CpG island hypermethylation in prostate cancer, together with the complete absence of GSTP1 CpG island hypermethylation in normal tissues, makes it an attractive DNA based biomarker for this disease (13, 31).

Previous studies have examined DNA methylation of various genes in plasma and serum as biomarkers for a number of human cancers (5). Although these investigations are in their infancy, their specificity seems high (5). Such reports have found blood-borne hypermethylated DNA in patients with advanced-stage cancer and have noted a correlation with a diminished prognosis (3237). In men with prostate cancer, Goessl et al. observed GSTP1 CpG island hypermethylation in the plasma of 56% of patients with pT2-3 disease and in 93% of men with pT4N+ disease (11). In nonpalpable, clinically localized prostate cancer (clinical stage T1c), Jeronimo et al. detected GSTP1 serum hypermethylation in 32% of patients examined (15).

The amount of cell-free DNA in the serum differs among normal and cancer patients. In healthy individuals the total amount of circulating DNA has been reported to be between 10 and 30 ng/mL (38, 39), compared with ~1,200 ng/mL in serum samples of patients with certain types of cancer (18). Recently, the amount of cell-free DNA in men with metastatic prostate cancer was reported to be ~40 ng/mL (40). Furthermore, in men with metastatic prostate cancer, serum PSA level and the amount of plasma DNA have been similarly associated with survival (40).

A few specific aspects of our study warrant further discussion. First, of the two patient groups that made up our study population, only the initial group of 85 men was prospectively collected. Based on our preliminary findings with this consecutive data set, we constructed a matched data set with enough statistical power to detect the predicted difference in PSA-free survival between paired groupings. Second, our chosen end point was time to PSA recurrence not time to metastasis or death. Sufficient follow-up time has not yet elapsed for the majority of men in the matched cohort to make either of the latter two end points meaningful. Moreover, PSA recurrence within the first 2 years of surgery has been associated with a higher probability of developing distant metastasis, a short PSA doubling time, and prostate cancer–specific mortality (3, 41).

How might serum GSTP1 CpG island hypermethylation status affect the clinical management of men with prostate cancer? To begin with, the fact that the assay described involves readily available laboratory reagents, requires only common molecular biological techniques and necessitates no extra procedure to be done other than a routine blood draw should make the clinical application of this serum test relatively straightforward. Its use may improve our ability to identify men who are less likely cured by surgery. Furthermore, renewed interest in adjuvant therapies for high-risk patients following radical prostatectomy, as well as recent advances in prostate cancer chemotherapeutic regimens, call for the identification of patients considered to be at greatest risk (4245). Men diagnosed with clinically localized prostate cancer, who are serum positive for DNA GSTP1 CpG island hypermethylation and are contemplating radical prostatectomy as primary treatment, may be appropriate candidates for adjuvant therapy. Further studies prospectively evaluating the role of GSTP1 CpG island hypermethylation as an independent prognostic factor in men with clinically localized prostate cancer are indicated. This is the first demonstration of the clinical utility of a DNA-based serum biomarker in prostate cancer.


    Footnotes
 
Grant support: NIH/National Cancer Institute grant R01 CA70196, NIH/National Cancer Institute Specialized Programs of Research Excellence grant P50 CA58236, the National Cancer Institute Early Detection Research Network grant CA86323, U.S. patent 5.552.277 titled Genetic diagnosis of prostate cancer (W.G. Nelson), and the AFUD/AUAER program (G.S. Palapattu).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: This is an original study and no part of it has been presented elsewhere.

Received 11/30/04; revised 2/10/05; accepted 3/ 3/05.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jemal A, Tiwari RC, Murray T, et al. Cancer statistics, 2004. CA Cancer J Clin 2004;54:8–29.[Abstract/Free Full Text]
  2. Han M, Partin AW, Zahurak M, et al. Biochemical (prostate specific antigen) recurrence probability following radical prostatectomy for clinically localized prostate cancer. J Urol 2003;169:517–23.[CrossRef][Medline]
  3. Pound CR, Partin AW, Eisenberger MA, et al. Natural history of progression after PSA elevation following radical prostatectomy. JAMA 1999;281:1591–7.[Abstract/Free Full Text]
  4. Herman JG, Baylin SB. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 2003;349:2042–54.[Free Full Text]
  5. Laird PW. The power and the promise of DNA methylation markers. Nat Rev Cancer 2003;3:253–66.[CrossRef][Medline]
  6. Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet 2002;3:415–28.[Medline]
  7. Lee WH, Morton RA, Epstein JI, et al. Cytidine methylation of regulatory sequences near the pi-class glutathione S-transferase gene accompanies human prostatic carcinogenesis. Proc Natl Acad Sci U S A 1994;91:11733–7.[Abstract/Free Full Text]
  8. Nelson WG, De Marzo AM, Isaacs WB. Prostate cancer. N Engl J Med 2003;349:366–81.[Free Full Text]
  9. Nakayama M, Gonzalgo ML, Yegnasubramanian S, et al. GSTP1 CpG island hypermethylation as a molecular biomarker for prostate cancer. J Cell Biochem 2004;91:540–52.[CrossRef][Medline]
  10. Esteller M, Corn PG, Baylin SB, Herman JG. A gene hypermethylation profile of human cancer. Cancer Res 2001;61:3225–9.[Abstract/Free Full Text]
  11. Goessl C, Krause H, Muller M, et al. Fluorescent methylation-specific polymerase chain reaction for DNA-based detection of prostate cancer in bodily fluids. Cancer Res 2000;60:5941–5.[Abstract/Free Full Text]
  12. Lee WH, Isaacs WB, Bova GS, Nelson WG. CG island methylation changes near the GSTP1 gene in prostatic carcinoma cells detected using the polymerase chain reaction: a new prostate cancer biomarker. Cancer Epidemiol Biomarkers Prev 1997;6:443–50.[Abstract]
  13. Yegnasubramanian S, Kowalski J, Gonzalgo ML, et al. Hypermethylation of CpG islands in primary and metastatic human prostate cancer. Cancer Res 2004;64:1975–86.[Abstract/Free Full Text]
  14. Bakker J, Lin X, Nelson WG. Methyl-CpG binding domain protein 2 represses transcription from hypermethylated pi-class glutathione S-transferase gene promoters in hepatocellular carcinoma cells. J Biol Chem 2002;277:22573–80.[Abstract/Free Full Text]
  15. Jeronimo C, Usadel H, Henrique R, et al. Quantitative GSTP1 hypermethylation in bodily fluids of patients with prostate cancer. Urology 2002;60:1131–5.[CrossRef][Medline]
  16. Kattan MW, Eastham JA, Stapleton AM, Wheeler TM, Scardino PT. A preoperative nomogram for disease recurrence following radical prostatectomy for prostate cancer. J Natl Cancer Inst 1998;90:766–71.[Abstract/Free Full Text]
  17. Partin AW, Kattan MW, Subong EN, et al. Combination of prostate-specific antigen, clinical stage, and Gleason score to predict pathological stage of localized prostate cancer. A multi-institutional update. JAMA 1997;277:1445–51.[Abstract/Free Full Text]
  18. Jahr S, Hentze H, Englisch S, et al. DNA fragments in the blood plasma of cancer patients: quantitations and evidence for their origin from apoptotic and necrotic cells. Cancer Res 2001;61:1659–65.[Abstract/Free Full Text]
  19. Vasioukhin V, Anker P, Maurice P, et al. Point mutations of the N-ras gene in the blood plasma DNA of patients with myelodysplastic syndrome or acute myelogenous leukaemia. Br J Haematol 1994;86:774–9.[Medline]
  20. Lui YY, Chik KW, Chiu RW, et al. Predominant hematopoietic origin of cell-free DNA in plasma and serum after sex-mismatched bone marrow transplantation. Clin Chem 2002;48:421–7.[Abstract/Free Full Text]
  21. Bantis A, Giannopoulos A, Gonidi M, et al. Expression of p120, Ki-67 and PCNA as proliferation biomarkers in imprint smears of prostate carcinoma and their prognostic value. Cytopathology 2004;15:25–31.[CrossRef][Medline]
  22. Ito K, Nakashima J, Mukai M, et al. Prognostic implication of microvascular invasion in biochemical failure in patients treated with radical prostatectomy. Urol Int 2003;70:297–302.[CrossRef][Medline]
  23. Ribal MJ, Fernandez PL, Lopez-Guillermo A, et al. Low p27 expression predicts biochemical relapse after radical prostatectomy in patients with clinically localised prostate cancer. Anticancer Res 2003;23:5101–6.[Medline]
  24. Jain RK. Molecular regulation of vessel maturation. Nat Med 2003;9:685–93.[CrossRef][Medline]
  25. Strohmeyer D, Rossing C, Strauss F, et al. Tumor angiogenesis is associated with progression after radical prostatectomy in pT2/pT3 prostate cancer. Prostate 2000;42:26–33.[CrossRef][Medline]
  26. Minchin RF, Carpenter D, Orr RJ. Polyinosinic acid and polycationic liposomes attenuate the hepatic clearance of circulating plasmid DNA. J Pharmacol Exp Ther 2001;296:1006–12.[Abstract/Free Full Text]
  27. Botezatu I, Serdyuk O, Potapova G, et al. Genetic analysis of DNA excreted in urine: a new approach for detecting specific genomic DNA sequences from cells dying in an organism. Clin Chem 2000;46:1078–84.[Abstract/Free Full Text]
  28. Lo YM, Zhang J, Leung TN, et al. Rapid clearance of fetal DNA from maternal plasma. Am J Hum Genet 1999;64:218–24.[CrossRef][Medline]
  29. To EW, Chan KC, Leung SF, et al. Rapid clearance of plasma Epstein-Barr virus DNA after surgical treatment of nasopharyngeal carcinoma. Clin Cancer Res 2003;9:3254–9.[Abstract/Free Full Text]
  30. Robbins DH, Itzkowitz SH. The molecular and genetic basis of colon cancer. Med Clin North Am 2002;86:1467–95.[CrossRef][Medline]
  31. Nakayama M, Bennett CJ, Hicks JL, et al. Hypermethylation of the human glutathione S-transferase-pi gene (GSTP1) CpG island is present in a subset of proliferative inflammatory atrophy lesions but not in normal or hyperplastic epithelium of the prostate: a detailed study using laser-capture microdissection. Am J Pathol 2003;163:923–33.[Abstract/Free Full Text]
  32. Eads CA, Danenberg KD, Kawakami K, et al. MethylLight: a high-thoroughput assay to measure DNA methylation. Nucleic Acids Res 2000;28:E32.
  33. Silva JM, Dominguez G, Garcia JM, et al. Presence of tumor DNA in plasma of breast cancer patients: clinicopathological correlations. Cancer Res 1999;59:3251–6.[Abstract/Free Full Text]
  34. Dominguez G, Carballido J, Silva J, et al. p14ARF promoter hypermethylation in plasma DNA as an indicator of disease recurrence in bladder cancer patients. Clin Cancer Res 2002;8:980–5.[Abstract/Free Full Text]
  35. An Q, Liu Y, Gao Y, et al. Detection of p16 hypermethylation in circulating plasma DNA of non-small cell lung cancer patients. Cancer Lett 2002;188:109–14.[CrossRef][Medline]
  36. Wong IH, Lo YM, Yeo W, Lau WY, Johnson PJ. Frequent p15 promoter methylation in tumor and peripheral blood from hepatocellular carcinoma patients. Clin Cancer Res 2000;6:3516–21.[Abstract/Free Full Text]
  37. Esteller M, Sanchez-Cespedes M, Rosell R, et al. Detection of aberrant promoter hypermethylation of tumor suppressor genes in serum DNA from non-small cell lung cancer patients. Cancer Res 1999;59:67–70.[Abstract/Free Full Text]
  38. Leon SA, Shapiro B, Sklaroff DM, Yaros MJ. Free DNA in the serum of cancer patients and the effect of therapy. Cancer Res 1977;37:646–50.[Abstract/Free Full Text]
  39. Chen XQ, Stroun M, Magnenat JL, et al. Microsatellite alterations in plasma DNA of small cell lung cancer patients. Nat Med 1996;2:1033–5.[CrossRef][Medline]
  40. Jung K, Stephan C, Lewandowski M, et al. Increased cell-free DNA in plasma of patients with metastatic spread in prostate cancer. Cancer Lett 2004;205:173–80.[CrossRef][Medline]
  41. D'Amico AV, Whittington R, Malkowicz SB, et al. Utilizing predictions of early prostate-specific antigen failure to optimize patient selection for adjuvant systemic therapy trials. J Clin Oncol 2000;18:3240–6.[Abstract/Free Full Text]
  42. Messing EM, Manola J, Sarosdy M, et al. Immediate hormonal therapy compared with observation after radical prostatectomy and pelvic lymphadenectomy in men with node-positive prostate cancer. N Engl J Med 1999;341:1781–8.[Abstract/Free Full Text]
  43. Tannock IF, de Wit R, Berry WR, et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. N Engl J Med 2004;351:1502–12.[Abstract/Free Full Text]
  44. Petrylak DP, Tangen CM, Hussain MH, et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. N Engl J Med 2004;351:1513–20.[Abstract/Free Full Text]
  45. Rosenbaum E, Kibel A, Roth BJ, et al. Adjuvant weekly docetaxel (D) for high-risk prostate cancer patients (pts) after radical prostatectomy (RP): Preliminary data of a multicenter pilot trial. J Clin Oncol (Meeting Abstracts) 2004;22:418.



This article has been cited by other articles:


Home page
JCOHome page
L. Richiardi, V. Fiano, L. Vizzini, L. De Marco, L. Delsedime, O. Akre, A. G. Tos, and F. Merletti
Promoter Methylation in APC, RUNX3, and GSTP1 and Mortality in Prostate Cancer Patients
J. Clin. Oncol., July 1, 2009; 27(19): 3161 - 3168.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
P. G. Febbo
Epigenetic Events Highlight the Challenge of Validating Prognostic Biomarkers During the Clinical and Biologic Evolution of Prostate Cancer
J. Clin. Oncol., July 1, 2009; 27(19): 3088 - 3090.
[Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
A. R. Sepulveda, D. Jones, S. Ogino, W. Samowitz, M. L. Gulley, R. Edwards, V. Levenson, V. M. Pratt, B. Yang, K. Nafa, et al.
CpG Methylation Analysis--Current Status of Clinical Assays and Potential Applications in Molecular Diagnostics: A Report of the Association for Molecular Pathology
J. Mol. Diagn., July 1, 2009; 11(4): 266 - 278.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Schwarzenbach, C. Alix-Panabieres, I. Muller, N. Letang, J.-P. Vendrell, X. Rebillard, and K. Pantel
Cell-free Tumor DNA in Blood Plasma As a Marker for Circulating Tumor Cells in Prostate Cancer
Clin. Cancer Res., February 1, 2009; 15(3): 1032 - 1038.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
Y. Korshunova, R. K. Maloney, N. Lakey, R. W. Citek, B. Bacher, A. Budiman, J. M. Ordway, W. R. McCombie, J. Leon, J. A. Jeddeloh, et al.
Massively parallel bisulphite pyrosequencing reveals the molecular complexity of breast cancer-associated cytosine-methylation patterns obtained from tissue and serum DNA
Genome Res., January 1, 2008; 18(1): 19 - 29.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Henrique, F. R. Ribeiro, D. Fonseca, M. O. Hoque, A. L. Carvalho, V. L. Costa, M. Pinto, J. Oliveira, M. R. Teixeira, D. Sidransky, et al.
High Promoter Methylation Levels of APC Predict Poor Prognosis in Sextant Biopsies from Prostate Cancer Patients
Clin. Cancer Res., October 15, 2007; 13(20): 6122 - 6129.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. J. Bastian, G. S. Palapattu, S. Yegnasubramanian, X. Lin, C. G. Rogers, L. A. Mangold, B. Trock, M. Eisenberger, A. W. Partin, and W. G. Nelson
Prognostic Value of Preoperative Serum Cell-Free Circulating DNA in Men with Prostate Cancer Undergoing Radical Prostatectomy
Clin. Cancer Res., September 15, 2007; 13(18): 5361 - 5367.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Kagan, S. Srivastava, P. E. Barker, S. A. Belinsky, and P. Cairns
Towards Clinical Application of Methylated DNA Sequences as Cancer Biomarkers: A Joint NCI's EDRN and NIST Workshop on Standards, Methods, Assays, Reagents and Tools
Cancer Res., May 15, 2007; 67(10): 4545 - 4549.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. Munson, J. Clark, K. Lamparska-Kupsik, and S. S. Smith
Recovery of bisulfite-converted genomic sequences in the methylation-sensitive QPCR
Nucleic Acids Res., May 14, 2007; 35(9): 2893 - 2903.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Urakami, H. Shiina, H. Enokida, H. Hirata, K. Kawamoto, T. Kawakami, N. Kikuno, Y. Tanaka, S. Majid, M. Nakagawa, et al.
Wnt Antagonist Family Genes as Biomarkers for Diagnosis, Staging, and Prognosis of Renal Cell Carcinoma Using Tumor and Serum DNA
Clin. Cancer Res., December 1, 2006; 12(23): 6989 - 6997.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Hanley, K. M. Rieger-Christ, D. Canes, N. R. Emara, A. P. Shuber, K. A. Boynton, J. A. Libertino, and I. C. Summerhayes
DNA Integrity Assay: A Plasma-Based Screening Tool for the Detection of Prostate Cancer
Clin. Cancer Res., August 1, 2006; 12(15): 4569 - 4574.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
A. S Perry, R. Foley, K. Woodson, and M. Lawler
The emerging roles of DNA methylation in the clinical management of prostate cancer.
Endocr. Relat. Cancer, June 1, 2006; 13(2): 357 - 377.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. K. Vanaja, K. V. Ballman, B. W. Morlan, J. C. Cheville, R. M. Neumann, M. M. Lieber, D. J. Tindall, and C. Y.F. Young
PDLIM4 Repression by Hypermethylation as a Potential Biomarker for Prostate Cancer
Clin. Cancer Res., February 15, 2006; 12(4): 1128 - 1136.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Yegnasubramanian, X. Lin, M. C. Haffner, A. M. DeMarzo, and W. G. Nelson
Combination of methylated-DNA precipitation and methylation-sensitive restriction enzymes (COMPARE-MS) for the rapid, sensitive and quantitative detection of DNA methylation
Nucleic Acids Res., February 9, 2006; 34(3): e19 - e19.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
R. M. Brena, H. Auer, K. Kornacker, B. Hackanson, A. Raval, J. C. Byrd, and C. Plass
Accurate quantification of DNA methylation using combined bisulfite restriction analysis coupled with the Agilent 2100 Bioanalyzer platform
Nucleic Acids Res., February 7, 2006; 34(3): e17 - e17.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bastian, P. J.
Right arrow Articles by Nelson, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bastian, P. J.
Right arrow Articles by Nelson, W. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online