
Clinical Cancer Research Vol. 11, 5956-5964, August 15, 2005
© 2005 American Association for Cancer Research
Cancer Therapy: Preclinical |
Radiation and Transforming Growth Factor-ß Cooperate in Transcriptional Activation of the Profibrotic Plasminogen Activator Inhibitor-1 Gene
Jurre Hageman1,
Bart J. Eggen3,
Tom Rozema1,2,
Kevin Damman1,
Harm H. Kampinga1 and
Robert P. Coppes1,2
Authors' Affiliations: Departments of 1 Radiation and Stress Cell Biology and 2 Radiation Oncology, University Medical Center Groningen, University of Groningen, Groningen, the Netherlands; 3 Department of Developmental Genetics, Biological Center, Haren, the Netherlands
Requests for reprints: Robert P. Coppes, Department of Radiation and Stress Cell Biology, University Medical Center Groningen, University of Groningen, 5th Floor, Building 3215, Ant. Deusinglaan 1, 9713 AV Groningen, the Netherlands. Phone: 31-50-3632709; Fax: 31-50-3632913; E-mail: r.p.coppes{at}med.umcg.nl.
 |
Abstract
|
|---|
Radiation-induced fibrosis is an important side effect in the treatment of cancer. Profibrotic proteins, such as plasminogen activator inhibitor-1 (PAI-1), transforming growth factor-ß (TGF-ß), and tissue type inhibitor of metalloproteinases-1 (Timp-1), are thought to play major roles in the development of fibrosis via the modulation of extracellular matrix integrity. We did a detailed analysis of transcriptional activation of these profibrotic genes by radiation and TGF-ß. Irradiation of HepG2 cells led to a high increase in PAI-1 mRNA levels and a mild increase in Timp-1 mRNA levels. In contrast, TGF-ß1 and Smad7 were not increased. Radiation and TGF-ß showed strong cooperative effects in transcription of the PAI-1 gene. The TGF-ß1 gene showed a mild cooperative activation, whereas Timp-1 and Smad7 were not cooperatively activated by radiation and TGF-ß. Analysis using the proximal 800 bp of the human PAI-1 promoter revealed a dose-dependent increase of PAI-1 levels between 2 and 32 Gy
-rays that was independent of latent TGF-ß activation. Subsequent site-directed mutagenesis of the PAI-1 promoter revealed that mutation of a p53-binding element abolished radiation-induced PAI-1 transcription. In line with this, PAI-1 was not activated in p53-null Hep3B cells, indicating that p53 underlies the radiation-induced PAI-1 activation and the cooperativity with the TGF-ß/Smad pathway. Together, these data show that radiation and TGF-ß activate PAI-1 via partially nonoverlapping signaling cascades that in concert synergize on PAI-1 transcription. This may play a role in patient-to-patient variations in susceptibility toward fibrosis after radiotherapy.
Radiation induced fibrosis, an important side effect of cancer treatment, is characterized by a progressive and excessive accumulation of extracellular matrix (ECM; ref. 1), which may eventually severely compromise tissue function. Factors that play a role in remodeling of the ECM include structural ECM proteins, inhibitors of ECM breakdown, and cytokines influencing transcription of profibrotic genes (2). Two main degrading extracellular protease systems play a crucial role: the plasminogen-activating system with plasminogen activator inhibitor-1 (PAI-1) as negative regulator and the matrix metalloproteinase system with tissue type inhibitors of metalloproteinases (3, 4). Together, these two systems form a highly complex and tight regulation of ECM degradation. Dysregulation of factors implicated in these systems may result in an alteration of degrading capacity (5, 6). To date, many different cytokines have been identified that regulate the transcription of genes implicated in the regulation of the ECM integrity. Of these, transforming growth factor-ß1 (TGF-ß1) has been shown to be a potent transcriptional activator of ECM regulators, such as PAI-1 and tissue type inhibitor of metalloproteinases-1 (Timp-1; refs. 79). TGF-ß is ubiquitously expressed and secreted as a latent complex in the connective tissues (10). Upon activation, the TGF-ß1 homodimer binds to a cell surface receptor complex that activates cytosolic Smads that translocate to the nucleus, bind DNA, and facilitate gene-specific transcription (11). Optimal binding is achieved with the four-nucleotide sequence AGAC or its reverse complement GTCT (12, 13). Smads have a relatively weak affinity for DNA (13) and use other transcription factors to form a robust complex with high affinity and specificity to cognate DNA sequences in regulatory regions of genes. These include many profibrotic genes, such as Col1a2, PAI-1, and the TGF-ß1 gene itself (14, 15).
Several studies show that radiation can induce transcription of some profibrotic genes consistent with its induction of fibrosis. However, the transcriptional activation of most of these genes by radiation is often only weak and conflicting reports on activation of some of these genes exist in the literature (1618). Moreover, the molecular mechanism underlying activation of profibrotic genes by radiation remains to be elucidated. Interestingly, studies done by Barcellos-Hoff et al. (19) showed a rapid activation of latent TGF-ß by radiation-induced reactive oxygen species in mouse mammary glands. This implies that radiation-induced profibrotic gene transcription might be mediated via the TGF-ß/Smad signaling pathway. It seems, however, likely that other transcription factors need to be activated by radiation concurrently to explain the strong profibrotic effects. Indeed, radiation can induce the activation of a subset of transcription factors, such as p53, AP-1, NF-
B, SP1, EGR-1, and Oct-1 (20). Interestingly, binding sites of some of these transcription-factors are reported in a number of profibrotic genes, including Timp-1, TGF-ß1, and PAI-1 (7, 9, 17, 21).
The PAI-1 gene is rapidly activated by radiation (22, 23). However, transcription factor(s) conferring the radiation response have not been identified. Several putative binding sites of radiation-responsive transcription factors, such as SP1, AP1, NF-
B, and p53 (7, 21, 24, 25), are present in this promoter as well as Smad-binding elements (SBE). The radiation responsiveness of this gene may thus be mediated via activation of latent TGF-ß followed by Smad-mediated transcriptional activation and/or by activation of other radiation-responsive transcription factors.
Here, we investigated the radiation responsiveness of a number of profibrotic genes. Specifically, we show that PAI-1 responded to either radiation or TGF-ß alone, but importantly that radiation and TGF-ß synergized in PAI-1 gene activation. The radiation-mediated induction of PAI-1 was independent of latent TGF-ß activation/Smad signaling and the cis-element conferring the radiation response was mapped at the proximal 800 bp promoter part. Site-directed mutagenesis revealed the requirement of a conserved DNA element with a p53-binding motif. In agreement with this, a related p53-null cell line showed a severely reduced radiation response and the cooperative effect with TGF-ß was completely abolished, indicating that Smad/p53 cooperativity underlies the molecular mechanism of TGF-ß/radiation synergy.
 |
Materials and Methods
|
|---|
Cell culture and transfections. Mv1Lu (CCL-64), HepG2 (HB-8065), and Hep3B (HB-8064) cells were obtained from the American Type Culture Collection (Manassas, VA) and were maintained in DMEM (complete medium) supplemented with 10% fetal bovine serum. Cells were stably transfected using the calcium phosphate transfection method. Briefly, 10 µg plasmid was cotransfected with 1 µg pSV2neo to 5 x 105 cells seeded on 9 cm plates. Twenty-four hours after transfection, the medium was replaced with a complete medium containing geneticin (400 µg/mL). Approximately 2 weeks after transfection, colonies were picked, expanded, and screened for luciferase activity. Luciferase-positive clones were expanded and assayed as described further. Results shown are representative effects of a minimum of at least three independent, luciferase-positive clones tested to minimize the effect of clonal variation. In all cases, a qualitatively similar induction pattern after radiation, TGF-ß, or both stimuli was found for all clones tested. Transient transfection was done using LipofectAMINE (Invitrogen, Carlsbad, CA) according to the protocol of the manufacturer.
Plasmid construction and manipulations. The PAI-Luc plasmid containing 800 bp of the human PAI-1 promoter was a generous gift of Prof. Loskutoff (The Scripps Research Institute, La Jolla, CA) and was described previously (26). The SBE-Luc plasmid was also previously described (27). Site-directed mutagenesis was done using the QuickChange Site-Directed mutagenesis kit (Stratagene, LaJolla, CA) according to the protocol of the manufacturer by using the PAI-Luc plasmid as a template unless otherwise specified. The following oligonucleotides (Isogen, Maarssen, The Netherlands) were used: AP1-1-for: CAGACAAGGTTGTTGCAGCAAGAGAGCCCTCAG, AP1-1-rev: CTGAGGGCTCTCTTGCTGCAACAACCTTGTCTG; AP1-2-for: CTGGACACGTGGGGACACAGCCGTGTATCATC, AP1-2-rev: GATGATACACGGCTGTGTCCCCACGTGTCCAG; AP1-3-for: GAGTCAGCCGTGCAGCATCGGAGGCGGCC, AP1-3-rev: GGCCGCCTCCGATGCTGCACGGCTGACTC; AP1-3-for2: GGACACAGCCGTGCAGCATCGGAGGCGG (template AP1-2 mutated), AP1-3-rev2: CCGCCTCCGATGCTGCACGGCTGTGTCC (template AP1-2 mutated); AP1-4-for: GGGTGGGGCTGGAACATGCAAACATCTATTTCCTGCCCACATC, AP1-4-rev: GATGTGGGCAGGAAATAGATGTTTGCATGTTCCAGCCCCACCC; p53-for: CACACATGCCTCAGAAATTCCCAGAGAGGGAGGT, p53-rev: ACCTCCCTCTCTGGGAATTTCTGAGGCATGTGTG. All mutations were sequence verified (Base-Clear, Leiden, the Netherlands). AP1-1,2 mutated was constructed using AP1-1 mutated as a template. AP1-1,2,3 mutated was constructed using AP1-1,2 as a template with primers AP1-3-for2 and AP1-3-rev2 that harbored the necessary mutated AP1-2 sites due to close proximity of these two AP1-sites. AP1-1,2,3,4 mutated was constructed by transferring a SphI fragment from AP1-1,2,3 mutated to AP1-4 mutated. Sequence analysis was done to verify the mutations and the orientation. A p53 overexpression plasmid was constructed as follows; the p53 coding sequence was amplified from HepG2 cDNA using primers p53-cds-for: ACCAACAAGCTTACCATGGAGGAGCCGCAGTCAGA and p53-cds-rev: ACCAACGAATTCTCAGTCTGAGTCAGGCCCTT and cloned in the EcoRI and HindIII sites of the pCDNA3.1(+) vector (Invitrogen).
Luciferase reporter assay. Stable clones were seeded (50,000 cells) in coated tubes in tetra-replicates in 500 µL medium. After 24 hours, they were either sham-irradiated or irradiated using a 137Cs irradiation device. Directly after irradiation, cells were left untreated or were stimulated with recombinant derived active TGF-ß (1 ng/mL; R&D Systems, Minneapolis, MN). For a fractionated radiation regime, cells were irradiated for 4 subsequent days with a dose of 2 Gy. The medium was replaced daily before irradiation. Directly after irradiation, the medium with or without TGF-ß (1 ng/mL) was added. TGF-ßneutralizing antibodies (1 µg/mL) were added 1 hour before irradiation where indicated. Latent TGF-ß was activated by adding HCl (80 mmol/L) to the medium and incubated for 1 hour at 4°C. Thereafter, the solution was neutralized by the addition of NaOH (80 mmol/L) to the medium. Serum deprivation experiments were done by seeding the cells on day 1. The same day, cells were washed twice with DMEM without serum and incubated for 18 hours. Thereafter, cells were treated with irradiation and/or TGF-ß as described above. In all cases, after administration of different stimuli, the cells were incubated for another 24 hours and lysed. Cell lysis and luciferase activity measurements were done as previously described (28). Luciferase activity was corrected for cell number and plotted as relative increases compared with the (untreated) control.
Quantitative PCR. HepG2 or Hep3B cells were seeded and after 24 hours they were either sham-irradiated or irradiated using a 137Cs irradiation device. Three, 6, or 9 hours after treatment, total RNA was isolated using the Absolutely RNA isolation kit (Stratagene). Subsequently, the RNA was validated using primers corresponding to genomic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sequences for the presence of genomic DNA contamination by regular PCR. Thereafter, 1 µg of total RNA was transcribed in first-strand cDNA using M-MLV reverse transcriptase (Invitrogen). The cDNA synthesis was primed by oligo(dT)12-18 (Invitrogen). Relative changes in transcript level were determined on the Icycler (Bio-Rad, Hercules, CA) using SYBR green supermix (Bio-Rad). Calculations were done using the comparative CT method according to User Bulletin 2 (Applied Biosystems, Foster City, CA). For each set of primers, the PCR efficiency was determined. Primer sequences used in this study were as follows: GAPDH-for: TGCACCACCAACTGCTTAGC, GAPDH rev: GGCATGGACTGTGGTCATGAG; hypoxanthine phosphoribosyltransferase (HPRT)-for: TGGCGTCGTGATTAGTGATG, HPRT-rev: GATGTAATCCAGCAGGTCAG; PAI-1-for: GGAATGACCGACATGTTCAG, PAI-1-rev: ACTCTCGTTCACCTCGATCT; TGF-ß1-for: CCGCTTCACCAGCTCCATGT, TGF-ß1-rev: TGCTACCGCTGCTGTGGCTA; Timp-1-for: GATGCCGCTGACATCCGGTT, Timp-1-rev: AACTCCTCGCTGCGGTTGTG; Smad7-for: CCAGGACGCTGTTGGTACAC, Smad7-rev: CGTCCACGGCTGCTGCATAA. The PCR efficiencies for all primers used were between 89% and 96%. A derivative of the comparative CT method was used to validate reference gene alteration by irradiation or TGF-ß as described elsewhere (29). Neither GAPDH nor HPRT was significantly affected (<1.3-fold induction for HPRT and <1.1-fold induction for GAPDH) by either radiation (15 Gy), TGF-ß (1 ng/mL), or both stimuli. Data are expressed as fold induction corrected for GAPDH.
Western blot analysis. Standard Western blot procedures were used as previously described (28). p53 was detected with the monoclonal DO-1 p53 antibody purchased from Santa Cruz Biotechnology (Santa Cruz, CA). GAPDH was detected using a monoclonal antibody purchased from RDI Research Diagnostics (Concord, CA).
 |
Results
|
|---|
Radiation and TGF-ß show cooperative effects on PAI-1 and TGF-ß1 promoter activation. Both radiation and TGF-ß are known to activate a number of profibrotic genes. The mechanisms of radiation-induced activation, however, still remains to be resolved. We initiated the present study to investigate in detail the transcriptional activation of a number of profibrotic genes by radiation and TGF-ß. We used quantitative PCR to investigate the induction of the PAI-1, TGF-ß1, and Timp-1 genes by radiation (15 Gy) and/or TGF-ß (1 ng/mL) in HepG2 cells. In addition, the induction of the putative antifibrotic gene Smad7 was examined. Total RNA was harvested at 3, 6, and 9 hours after stimulation and reverse transcribed in first-strand cDNA. Validation of the normalization genes revealed that neither GAPDH nor HPRT transcript levels were significantly affected by radiation, TGF-ß, or both stimuli (data not shown). Subsequently, relative PAI-1, TGF-ß1, Timp-1, or Smad7 transcript levels were determined and normalized to GAPDH transcript levels. We found that both radiation and TGF-ß activated the human PAI-1 gene (Fig. 1A). Interestingly, radiation and TGF-ß stimulation were found to have a cooperative effect on PAI-1 transcription. This cooperative effect increased in time and resulted in a very strong increase in PAI-1 transcription after 9 hours. The TGF-ß1 gene showed very low, if any, responsiveness toward irradiation (Fig. 1B) but a relatively mild synergistic activation in response to radiation and TGF-ß was observed (Fig. 1B). The Timp-1 gene did not respond to TGF-ß and showed a weak induction by radiation (Fig. 1C). The Smad7 gene showed a TGF-ß response but not a radiation response (Fig. 1D). These data show that radiation and TGF-ß cause a very strong cooperative effect on PAI-1 transcription. This effect was also observed for the TGF-ß1 gene although the inductions were mild compared with the PAI-1 gene. Because the effects were strongest on PAI-1 transcription and because this gene is clearly implemented in tissue fibrosis as shown by previous studies (30, 31), we decided to concentrate on the radiation-induced transcriptional activation of this gene.

View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Radiation and/or TGF-ß causes activation of genes implicated in ECM remodeling. Quantitative PCR analysis of PAI-1 (A), TGF-ß1 (B), Timp-1 (C), and Smad7 (D) transcript levels. HepG2 cells were treated with 15 Gy -radiation and/or active TGF-ß (1 ng/mL). Cells were harvested 3, 6, and 9 hours poststimulation. Neither GAPDH nor HPRT responded significantly to these stimuli. mRNA levels are corrected for GAPDH. Columns, mean; bars, SE (n = 2).
|
|
Radiation dose dependence and kinetics of radiation and TGF-ßinduced PAI-1 transcription. To study the radiation responsiveness of PAI-1 in more detail, we transfected a luciferase gene-reporter construct containing the major regulatory part of the human PAI-1 promoter (Fig. 2A) stable in Mv1Lu cells. Several stable clones were selected and irradiated with a dose ranging from 2 to 32 Gy. Twenty-four hours after irradiation, a dose-dependent increase of the PAI-1 promoter was found as shown by a representative stable clone (Fig. 3A). Furthermore, a radiation dosedependent increase of the cooperative effect was found after cells were treated with both radiation (2-32 Gy) and TGF-ß (1 ng/mL; Fig. 3A). Thus, similar to the quantitative PCR data obtained in HepG2 cells, stimulation of Mv1Lu PAI-Luc cells with both irradiation and TGF-ß resulted in cooperative effects on PAI-1 promoter activation, resulting in a highly increased PAI-1 promoter activity. These results indicate that the regulatory region mediating the radiation response and the cooperation with TGF-ß is located within the 800 bp proximal promoter part. One could argue, however, that the relatively high irradiation conditions that were used do not reflect the effects that may occur under clinically relevant irradiation regimes (20). In these regimes, the total dose is usually delivered in a fractionated daily dose of 2 Gy. Although a clear dose response was observed for the entire dose range applied, a single dose of 2 Gy did not show a significant PAI-1 promoter activation on its own (Fig. 3A). Therefore, we investigated whether fractionated doses of 2 Gy have the potency to activate the PAI-1 promoter and to cooperate with TGF-ß. Hereto, Mv1Lu PAI-Luc cells were stimulated with a daily dose of 2 Gy for 4 subsequent days. Medium with or without TGF-ß was refreshed daily before irradiation. After 4 days, we found that the PAI-1 promoter was activated and that TGF-ß and irradiation cooperated under these conditions (Fig. 3B). The fractionated radiation scheme used (4x 2 Gy) in fact resulted in a stronger level of gene transcription than after the corresponding 8 Gy single-dose irradiation (compare Fig. 3A and B). This is likely due to the longer time allowed for mRNA and subsequent protein formation in the fractionated experiment compared with single-dose experiments (96 versus 24 hours) allowing accumulation of luciferase. Furthermore, the classic concept of split dose recovery between fractions may not apply to the transcriptional activation in our experimental set-up. In any case, our data show that the cooperative effects of radiation and TGF-ß are found under clinically relevant irradiation schemes at least as efficient as after (higher) single doses of radiation. For practical reasons, however, all further experiments were done with a single dose of 15 Gy.

View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Schematic representation of the PAI-Luc (A) and the SBE-Luc (B) reporter constructs. Putative transcription factor binding sites are indicated. The PAI-Luc construct contains 800 bp of the human PAI-1 promoter and the natural transcription initiation site. The SBE-Luc contains several SBEs in front of an artificial minimal promoter that initiates transcription. Arrow, luciferase coding sequence.
|
|

View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. A, radiation and TGF-ß cooperate on PAI-Luc activation and these effects are radiation dose dependent. Doses from 2 to 32 Gy were applied on PAI-Luccontaining Mv1Lu cells with or without administration of TGF-ß (1 ng/mL). Cell extracts were prepared 24 hours posttreatment and luciferase activity was determined. Activity is expressed as fold above control. B, fractionated radiation doses of 2 Gy activates the PAI-1 promoter and synergizes with TGF-ß. PAI-Luccontaining Mv1Lu cells were treated with a daily dose of 2 Gy -radiation for 4 subsequent days. To those cells that were treated with TGF-ß, 1 ng/mL TGF-ß was added daily after radiation. C, cooperation of PAI-1 activation by radiation and TGF-ß is temporal. PAI-Luccontaining Mv1Lu cells were treated with 15 Gy -radiation and/or 1 ng/mL TGF-ß. Cell extracts were prepared 3, 6, 12, 24, and 48 hours poststimulation. Luciferase activity is expressed as fold above control. Columns, mean; bars, SE (n = 4).
|
|
To determine the rate of radiation and TGF-ßinduced PAI-1 promoter activation, a time course luciferase reporter experiment was done using the PAI-Luc cell line. Cell extracts were prepared 3, 6, 12, 24, and 48 hours after treatment followed by determination of luciferase activity. Cooperative effects of radiation and TGF-ß were found to be maximal between 12 and 48 hours poststimulation, where both radiation and TGF-ß also individually activated the PAI-1 promoter. The cooperative effects declined at 48 hours poststimulation (Fig. 3C). All subsequent experiments were therefore done at 24 hours poststimulation.
In vitro activation of the human PAI-1 promoter by radiation is independent of latent TGF-ß activation. The possibility that the observed radiation-induced activation of the PAI-1 promoter is dependent on extracellular TGF-ß activation and, therefore, purely Smad dependent was tested using TGF-ßneutralizing antibodies. These antibodies were added to the medium of PAI-Luctransfected cells before irradiation or TGF-ß stimulation to inactivate any potentially radiation-activated TGF-ß. As shown in Fig. 4A, the addition of TGF-ßneutralizing antibodies completely blocked TGF-ßinduced PAI-1 reporter activation but did not block the radiation-induced PAI-1 promoter activation. Moreover, the addition of TGF-ßneutralizing antibodies to cells stimulated with a combined treatment of radiation and TGF-ß resulted in a block of the TGF-ß response, as expected, leaving an activation of PAI-1 promoter activity as found with radiation alone (Fig. 4A). Thus, whereas the TGF-ß antibodies completely neutralized TGF-ß signaling, the radiation response was not affected, indicating that the radiation response was independent of latent TGF-ß activation. However, it could be possible that the antibodies did not block TGF-ß activated in the close vicinity of target cells. To exclude this possibility, we used Mv1Lu cells stably transfected with an artificial reporter construct containing eight SBE repeats in front of a minimal promoter (Fig. 2B). The advantage of using such a reporter system is that any TGF-ß activation, including activation in close vicinity of target cells, would be detected. No radiation-induced activation of the SBE promoter was found (Fig. 4B). Addition of 1 ng/mL of active TGF-ß showed that the SBE promoter was induced >50-fold over basal activity, demonstrating that this construct was very responsive to TGF-ß. Also, no cooperative effect was found after a combined treatment of radiation and TGF-ß, indicating that the radiation effect on PAI-1 promoter activation is TGF-ß/Smad independent.

View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. No latent TGF-ß activation upon irradiation was detected. A, administration of TGF-ß neutralizing antibodies did not abrogate the radiation effect. Two micrograms of TGF-ß neutralizing antibodies were added to the medium 1 hour before irradiation (15 Gy) and/or TGF-ß stimulation (1 ng/mL). After 24 hours, the cells were lysed and assayed for luciferase activity. B, SBE-Lucharboring Mv1Lu cells were treated with radiation (15 Gy) and/or TGF-ß (1 ng/mL); 24 hours later, cells were lysed and luciferase activity was measured. C, serum depletion did not result in an abrogation of the radiation response. PAI-Lucharboring Mv1Lu cells were serum depleted for 18 hours. Thereafter, they were treated with radiation (15 Gy) and/or TGF-ß (1 ng/mL). D and E, the serum contains large amounts of latent TGF-ß. Medium was acid activated, neutralized, and placed on PAI-Lucharboring Mv1Lu (D) or SBE-Lucharboring Mv1lu (E) cells. After 24 hours, the cells were lysed and luciferase activity was measured. Two micrograms per milliliter of TGF-ßneutralizing antibodies were added where indicated. F and G, irradiation of the serum-containing medium with a dose up to 50 Gy did not result in detectable latent TGF-ß activation. Medium was irradiated, placed on PAI-Lucharboring Mv1Lu (F) or SBE-Lucharboring Mv1Lu cells (G) and luciferase activity was assayed 24 hours postirradiation. Columns, mean; bars, SE (n = 4). Note that irradiation was conducted directly on cells in medium in (A), (B), and (C), whereas in (F) and (G) serum-containing medium without cells was irradiated and subsequently placed on PAI-Luc or SBE-Lucharboring cells.
|
|
To investigate whether serum components played a role in radiation-induced PAI-1 activation, cells were cultured without serum for 18 hours and subsequently treated with radiation, TGF-ß, or both stimuli. Radiation effects were still observed, which indicates that serum components do not contribute to the radiation effects (Fig. 4C). We were, however, still interested whether latent TGF-ß activation could be observed in this cell system. First, we used acid treatment to induce dissociation of active TGF-ß from the latency-associated peptide complex of serum-containing medium (32). Medium with serum was acidactivated, pH-neutralized, and added to PAI-Luc Mv1Lu cells. After 24 hours, we found that the acid-activated serum induced PAI-1 promoter activity (Fig. 4D). This effect could be blocked by TGF-ßneutralizing antibodies, which confirmed that the acid-activated compound that activated the PAI-1 promoter was indeed TGF-ß (Fig. 4D). Similar data were obtained when we added acid-activated medium to SBE-Luctransfected cells (Fig. 4E). No activation effects were observed after treating medium without serum with acid (data not shown). From this, we concluded that the serum contains high amounts of latent TGF-ß. In the next experiments, we investigated whether this latent TGF-ß from serum can be activated by the applied irradiation doses. Serum-containing medium without cells was irradiated and added directly to the PAI-Lucharboring Mv1Lu cells. Despite the presence of latent TGF-ß in the serum, irradiation of the medium without cells with doses up to 50 Gy did not lead to any detectable PAI-1 promoter activation (Fig. 4F) or SBE-Luc activation (Fig. 4G).
Altogether, these data show that PAI-1 promoter activation by radiation in our in vitrocultured cells takes place independently of extracellular latent TGF-ß activation. Despite the presence of latent TGF-ß in the medium, irradiation up to 50 Gy did not result in any detectable activation. This implies that the radiation-mediated PAI-1 activation is dependent on another signal transduction route than the TGF-ß/Smad signaling pathway and other factors than the Smad family of transcriptional activators.
A p53-binding element is involved in the radiation-induced activation of PAI-1. The finding that radiation activates the PAI-1 promoter in a Smad-independent manner indicates that another signaling route must be involved in this activation process. Therefore, we searched the literature for known binding sites of radiation-activated/induced transcription factors in the proximal 800 bp of the human PAI-1 promoter. We found that AP-1, SP1, and p53 are all involved in PAI-1 activation. Furthermore, they can be activated, induced, or stabilized by radiation and have experimentally verified binding sites in the proximal part of the human PAI-1 promoter (17, 20, 21, 25). Mithramycin, an inhibitor of SP1 binding, did not block the radiation response that makes it unlikely that this transcription factor is involved (data not shown). The proximal part of the PAI-1 promoter contains three AP1-like sites located at positions 716, 670, and 659 bp from transcriptional start albeit none of them matches the exact consensus site (7). Furthermore, a CRE-like element is positioned at 58 (Fig. 5A; ref. 33). CRE elements are 8 bp in length in contrast to the 7 bp AP-1like sites and are preferentially bound by heterodimers composed of Jun and activating transcription factor members (34). We mutated each AP-1 site according to previous literature (Fig. 5B). Mv1Lu cells were transfected stably with the respective mutated plasmids whereafter a minimum of three independent clones were tested. The results of representative clones are shown in Fig. 5C. Although the magnitude of the responses was variable, probably due to clonal variations, the patterns were similar and showed that mutation of individual AP1/CRE-like sites or the combined mutation of all four sites did not abolish the radiation effect or its cooperative effect with TGF-ß (Fig. 5C).

View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. p53 is required for radiation induced PAI-1 activation. A, schematic representation of binding positions of different transcription factors (not to scale). B, site-directed mutagenesis of the PAI-1 promoter. Introduced mutations are underlined. Positions are indicated relative to the transcriptional start site. C, luciferase analysis of Mv1Lu cells, stably transfected with the mutated constructs according to (B). Induction patterns displayed are of a representative clone of at least three independent investigated clones. Luciferase activities were measured 24 hours poststimulation. Columns, mean; bars, SE (n = 4).
|
|
A p53-binding element was shown to be involved in PAI-1 transcription induced by the DNA-damaging agent N-methyl-N'-nitro-N-nitrosoguanidine (25). Binding of p53 to this element has been shown in two studies (25, 35) using gel-shift assays. Therefore, we disrupted this p53-like element according to these reports (two-nucleotide substitution; Fig. 5B; refs. 25, 35). Mutation of the p53 element completely abolished the irradiation response as well as the synergy observed with simultaneous TGF-ß treatment (MUT E; Fig. 5C). To further eliminate the risk of clonal effects, we analyzed pooled transfected clones. No radiation effect was detected for the PAI-Luc construct with a mutated p53-binding element in this pooled population, not even after using a dose as high as 30 Gy (data not shown).
It is interesting to see that the induction by TGF-ß was reduced but not abolished (MUT E; Fig. 5C). The latter suggests that p53 is needed as coactivator of Smads in TGF-ßinduced PAI-1 transcription, which is in agreement with a previous report (36).
p53 is required for radiation-induced PAI-1 activation. Because the p53-binding site was essential for radiation-induced PAI-1 transactivation, we tested whether p53 was required for the radiation-induced PAI-1 induction. First, we tried knockdown of p53 in HepG2 cells by small interfering RNA. Although we found a
70% knockdown of p53 protein levels, it did not result in any detectable change on PAI-1 transcript induction by radiation, TGF-ß, or both stimuli (data not shown). We reasoned that 70% knockdown might not be enough and that activation of the remaining 30% by radiation might be sufficient to confer a full radiation response. Therefore, we analyzed PAI-1 induction in Hep3B cells, a human hepatoma p53-deficient cell line closely related to HepG2 (Fig. 6A; ref. 37). As shown in Fig. 6B, quantitative PCR analysis indicated that the induction of PAI-1 by radiation was completely abrogated and by TGF-ß was severely reduced in Hep3B cells. Furthermore, no synergistic effect on PAI-1 induction by a treatment of both irradiation and TGF-ß was observed (Fig. 6B). We next complemented the Hep3B cells with wild-type p53. This experiment was technically hampered by the fact that p53 expression is toxic for Hep3B cells leading to massive apoptosis at 48 hours (37). Therefore, stable expression cell lines could not be generated and fluorescence-activated cell sorting isolation of green fluorescent protein cotransfected cells did not result in a viable fraction. Nevertheless, transient expression of wild-type p53 in Hep3B cells partially restored PAI-1 mRNA induction by either radiation or both TGF-ß and radiation (Fig. 6C). Fluorescence-activated cell sorting analysis of cotransfected green fluorescent protein showed that 5% of the cells were transfected (data not shown). According to Western blot analysis, this fraction contained a high amount of p53 (Fig. 6A). Summarizing these data, we show that p53-null cells show an impaired response to PAI-1 transcription by either radiation, TGF-ß, or both stimuli and introducing p53 in a fraction of these cells partially restored these responses. In agreement with the mutagenesis data, these results suggest that p53 is involved in both the radiation-induced transcription of the human PAI-1 gene as well as the cooperation with the TGF-ß/Smad signaling pathway.

View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 6. p53 is involved in radiation-induced PAI-1 transcription. A, Western blot analysis of p53 in HepG2-, Hep3B-, and p53-transfected Hep3B cells. B, quantitative PCR analysis of PAI-1 levels in HepG2 (p53-wild type) or Hep3B (p53-null). Cells were treated with irradiation (15 Gy) and/or active TGF-ß (1 ng/mL) as indicated. C, transfection of transient p53 expression partially restored the radiation effect in Hep3B cells. PAI-1 transcript levels were analyzed using quantitative PCR. Columns, mean; bars, SE (n = 2).
|
|
 |
Discussion
|
|---|
Radiation is known to activate gene transcription of several profibrotic genes. To date, molecular mechanisms underlying this phenomenon remain largely unknown. In this study, we investigated the induction of transcription of a small set of genes that have been implicated in fibrotic disease. Of these, we found that the PAI-1 gene shows a rapid and dose-dependent activation by radiation. Importantly, we found that costimulation with TGF-ß resulted in a strong cooperative effect on PAI-1 transcription. The same results, although less dramatic, were found for the TGF-ß1 gene. These data may have important implications for understanding the development of radiation-induced tissue fibrosis because several studies provided direct evidence that PAI-1 plays a pivotal role in the pathogenesis of tissue fibrosis (5). The observation that PAI-1 knockout mice are significantly protected from the development of bleomycin-induced lung fibrosis stresses the clinical importance of this gene in the development of fibrotic disease (30, 31). In addition, PAI-1 knockout mice showed a rapid removal of a fibrin-rich matrix compared with wild-type mice, resulting in reduced fibrotic tissue accumulation (38). This observation implies that PAI-1 is particularly important at the onset of fibrotic disease, and indicates that it may be an important target for future therapeutic approaches. In line with this, we found that the PAI-1 gene is rapidly and temporarily activated by either radiation or TGF-ß. Therefore, the rapid and dose-dependent PAI-1 induction might be of therapeutic value in the prevention of radiation side effects and stresses the need to elucidate the molecular mechanism underlying the transcriptional synergy by radiation and TGF-ß.
Radiation-induced activation of PAI-1 is unrelated to activation of latent TGF-ß. A possible mechanism for radiation-induced activation of PAI-1 involves the activation of latent TGF-ß by radiation followed by receptor-mediated activation of Smad signaling. Using immunohistochemical analysis with an antibody against active TGF-ß, Barcellos-Hoff et al. (19) showed that radiation (5 Gy) could activate latent TGF-ß in situ. However, they also found that activation of recombinant derived latent TGF-ß in vitro was inefficient and required strikingly high doses of 50 to 200 Gy (39). Here, we found that latent TGF-ß indeed is present in the serum, but this could not be activated with radiation doses as high as 50 Gy. Therefore, radiation-induced PAI-1 activation does not require latent TGF-ß activation. However, our data do not exclude the possibility that activation of latent TGF-ß may differ in vitro from that in tissues.
Radiation-induced activation of PAI-1 and synergy with TGF-ß/Smad signaling is p53 mediated. Despite the lack of latent TGF-ß activation in serum, we found that radiation up-regulates PAI-1 transcription. The lack of an effect on a reporter construct containing SBE elements, the absence of an effect of antiTGF-ß as well as the lack of a radiation effect on the TGF-ßresponsive Smad7 gene clearly showed that another signal transduction route must be involved in mediating this event. Mutation of a p53-binding element completely abolished the radiation effect on PAI-1 transcription. Cordenonsi et al. (36) were the first to show that Smads and p53 cooperate on PAI-1 transcription. They found that knockdown of p53 abrogated the induction of PAI-1 by the TGF-ß family member activin. This is consistent with our observation that induction of PAI-1 by TGF-ß was severely reduced by mutating the p53-binding element of the PAI-1 promoter and in p53-null cells. Moreover, we observed that radiation effects were severely reduced in the Hep3B cell line and that the cooperative effects were completely abrogated. Complementation of these cells with p53 partially restored the radiation effects with respect to PAI-1 transcription. These results all strongly suggest that p53 is involved in conferring the radiation-induced activation of the human PAI-1 promoter.
Implications for radiation-induced fibrosis. Transcriptional synergy is a relatively common phenomenon in eukaryotes (40). It enables the organism to adapt quickly to changes in the environment. Interestingly, transcriptional cooperation of Smads and other transcription factors have been reported in previous studies (15, 21, 36, 4144) and the cooperation with p53, in particular, has been recently reviewed (45). To our knowledge, we are the first to show that radiation and TGF-ß, both known to activate a number of profibrotic genes individually, cooperate in activation of PAI-1 transcription in vitro. Yet, future in vivo experiments are warranted to confirm our findings.
If extrapolated to the in vivo situation, our data would support correlative evidence from some clinical studies in which circulating levels of latent TGF-ß (produced by tumors) were linked to a higher risk of radiation-induced fibrosis. Our data imply that, if indeed radiation would activate this latent TGF-ß in situ (of which the molecular mechanism remains unclear) and simultaneously activate a synergizing other pathway, patients bearing such a tumor may be predisposed for developing radiation fibrosis. It needs to be realized, however, that whereas some clinical studies looking at plasma TGF-ß levels indeed have suggested such a predisposition (46, 47), others have not confirmed this (48, 49). However, measuring overall plasma TGF-ß levels may not be accurate enough for this purpose and local concentrations in the tissue surrounding the tumor and within the radiation field may be more relevant. Furthermore, promoter polymorphisms (e.g., in the PAI-1 promoter) have been described in a number of profibrotic genes (50) and it would be interesting to investigate if polymorphisms exist that alters the response to either radiation or TGF-ß on a patient-to-patient basis (50). Therefore, it is necessary to know the individual variations in responsiveness of profibrotic genes to TGF-ß and/or radiation next to the local concentrations of (tumor-produced) TGF-ß to be able to develop reliable predictive tests for the chance of patients to develop radiation-induced fibrosis.
 |
Acknowledgments
|
|---|
We thank Prof. Loskutoff (The Scripps Research Institute, La Jolla, CA) for providing us with the PAI-Luc construct.
 |
Footnotes
|
|---|
Grant support: Interuniversitair Instituut voor Radiopathologie en Stralenbescherming grant IRS 9.0.18 and University of Groningen.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 2/25/05;
revised 5/19/05;
accepted 5/20/05.
 |
References
|
|---|
- Morgan GW, Breit SN. Radiation and the lung: a reevaluation of the mechanisms mediating pulmonary injury. Int J Radiat Oncol Biol Phys 1995;31:3619.[CrossRef][Medline]
- Rodemann HP, Bamberg M. Cellular basis of radiation-induced fibrosis. Radiother Oncol 1995;35:8390.[CrossRef][Medline]
- Dobrovolsky AB, Titaeva EV. The fibrinolysis system: regulation of activity and physiologic functions of its main components. Biochemistry (Mosc) 2002;67:99108.[CrossRef][Medline]
- Lijnen HR. Matrix metalloproteinases and cellular fibrinolytic activity. Biochemistry (Mosc) 2002;67:928.[CrossRef][Medline]
- Loskutoff DJ, Quigley JP. PAI-1, fibrosis, and the elusive provisional fibrin matrix. J Clin Invest 2000;106:14413.[Medline]
- Martin M, Lefaix J, Delanian S. TGF-ß1 and radiation fibrosis: a master switch and a specific therapeutic target? Int J Radiat Oncol Biol Phys 2000;47:27790.[CrossRef][Medline]
- Keeton MR, Curriden SA, van Zonneveld AJ, Loskutoff DJ. Identification of regulatory sequences in the type 1 plasminogen activator inhibitor gene responsive to transforming growth factor ß. J Biol Chem 1991;266:2304852.[Abstract/Free Full Text]
- Dennler S, Itoh S, Vivien D, ten Dijke P, Huet S, Gauthier JM. Direct binding of Smad3 and Smad4 to critical TGF ß-inducible elements in the promoter of human plasminogen activator inhibitor-type 1 gene. EMBO J 1998;17:3091100.[CrossRef][Medline]
- Hall MC, Young DA, Waters JG et al. The comparative role of activator protein 1 and Smad factors in the regulation of Timp-1 and MMP-1 gene expression by transforming growth factor-ß1. J Biol Chem 2003;278:1030413.[Abstract/Free Full Text]
- Gleizes PE, Munger JS, Nunes I, et al. TGF-ß latency: biological significance and mechanisms of activation. Stem Cells 1997;15:1907.[Abstract/Free Full Text]
- Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-ß family signalling. Nature 2003;425:57784.[CrossRef][Medline]
- Zawel L, Dai JL, Buckhaults P, et al. Human Smad3 and Smad4 are sequence-specific transcription activators. Mol Cell 1998;1:6117.[CrossRef][Medline]
- Shi Y, Wang YF, Jayaraman L, Yang H, Massague J, Pavletich NP. Crystal structure of a Smad MH1 domain bound to DNA: insights on DNA binding in TGF-ß signaling. Cell 1998;94:58594.[CrossRef][Medline]
- Zhang W, Ou J, Inagaki Y, Greenwel P, Ramirez F. Synergistic cooperation between Sp1 and Smad3/Smad4 mediates transforming growth factor ß1 stimulation of
2(I)-collagen (COL1A2) transcription. J Biol Chem 2000;275:3923745.[Abstract/Free Full Text]
- Zhang Y, Feng XH, Derynck R. Smad3 and Smad4 cooperate with c-Jun/c-Fos to mediate TGF-ß-induced transcription. Nature 1998;394:90913.[CrossRef][Medline]
- Gault N, Vozenin-Brotons MC, Calenda A, Lefaix JL, Martin MT. Promoter sequences involved in transforming growth factor ß1 gene induction in HaCaT keratinocytes after
irradiation. Radiat Res 2002;157:24955.[CrossRef][Medline]
- Martin M, Vozenin MC, Gault N, Crechet F, Pfarr CM, Lefaix JL. Coactivation of AP-1 activity and TGF-ß1 gene expression in the stress response of normal skin cells to ionizing radiation. Oncogene 1997;15:9819.[CrossRef][Medline]
- Boerma M, Bart CI, Wondergem J. Effects of ionizing radiation on gene expression in cultured rat heart cells. Int J Radiat Biol 2002;78:21925.[CrossRef][Medline]
- Barcellos-Hoff MH, Derynck R, Tsang ML, Weatherbee JA. Transforming growth factor-ß activation in irradiated murine mammary gland. J Clin Invest 1994;93:8929.
- Criswell T, Leskov K, Miyamoto S, Luo G, Boothman DA. Transcription factors activated in mammalian cells after clinically relevant doses of ionizing radiation. Oncogene 2003;22:581327.[CrossRef][Medline]
- Datta PK, Blake MC, Moses HL. Regulation of plasminogen activator inhibitor-1 expression by transforming growth factor-ß-induced physical and functional interactions between smads and Sp1. J Biol Chem 2000;275:400149.[Abstract/Free Full Text]
- Zhao W, O'Malley Y, Wei S, Robbins ME. Irradiation of rat tubule epithelial cells alters the expression of gene products associated with the synthesis and degradation of extracellular matrix. Int J Radiat Biol 2000;76:391402.[CrossRef][Medline]
- Zhao W, Spitz DR, Oberley LW, Robbins ME. Redox modulation of the pro-fibrogenic mediator plasminogen activator inhibitor-1 following ionizing radiation. Cancer Res 2001;61:553743.[Abstract/Free Full Text]
- Hou B, Eren M, Painter CA, et al. TNF
activates the human plasminogen activator inhibitor-1 through a distal NF
B site. J Biol Chem 2004;279:1812736.[Abstract/Free Full Text]
- Parra M, Jardi M, Koziczak M, Nagamine Y, Munoz-Canoves P. p53 phosphorylation at serine 15 is required for transcriptional induction of the plasminogen activator inhibitor-1 (PAI-1) gene by the alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine. J Biol Chem 2001;276:3630310.[Abstract/Free Full Text]
- van Zonneveld AJ, Curriden SA, Loskutoff DJ. Type 1 plasminogen activator inhibitor gene: functional analysis and glucocorticoid regulation of its promoter. Proc Natl Acad Sci U S A 1988;85:55259.[Abstract/Free Full Text]
- Jonk LJ, Itoh S, Heldin CH, ten Dijke P, Kruijer W. Identification and functional characterization of a Smad binding element (SBE) in the JunB promoter that acts as a transforming growth factor-ß, activin, and bone morphogenetic protein-inducible enhancer. J Biol Chem 1998;273:2114552.[Abstract/Free Full Text]
- Michels AA, Nguyen VT, Konings AW, Kampinga HH, Bensaude O. Thermostability of a nuclear-targeted luciferase expressed in mammalian cells. Destabilizing influence of the intranuclear microenvironment. Eur J Biochem 1995;234:3829.[Medline]
- Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(

C(T)) method. Methods 2001;25:4028.[CrossRef][Medline]
- Eitzman DT, McCoy RD, Zheng X, et al. Bleomycin-induced pulmonary fibrosis in transgenic mice that either lack or overexpress the murine plasminogen activator inhibitor-1 gene. J Clin Invest 1996;97:2327.[Medline]
- Hattori N, Degen JL, Sisson TH, et al. Bleomycin-induced pulmonary fibrosis in fibrinogen-null mice. J Clin Invest 2000;106:134150.[Medline]
- van Waarde MA, van Assen AJ, Kampinga HH, Konings AW, Vujaskovic Z. Quantification of transforming growth factor-ß in biological material using cells transfected with a plasminogen activator inhibitor-1 promoter-luciferase construct. Anal Biochem 1997;247:4551.[CrossRef][Medline]
- Olman MA, Hagood JS, Simmons WL, Fuller GM, Vinson C, White KE. Fibrin fragment induction of plasminogen activator inhibitor transcription is mediated by activator protein-1 through a highly conserved element. Blood 1999;94:202938.[Abstract/Free Full Text]
- Reddy SP, Mossman BT. Role and regulation of activator protein-1 in toxicant-induced responses of the lung. Am J Physiol Lung Cell Mol Physiol 2002;283:L116178.[Abstract/Free Full Text]
- Kunz C, Pebler S, Otte J, der Ahe D. Differential regulation of plasminogen activator and inhibitor gene transcription by the tumor suppressor p53. Nucleic Acids Res 1995;23:37107.[Abstract/Free Full Text]
- Cordenonsi M, Dupont S, Maretto S, Insinga A, Imbriano C, Piccolo S. Links between tumor suppressors: p53 is required for TGF-ß gene responses by cooperating with Smads. Cell 2003;113:30114.[CrossRef][Medline]
- Stahler F, Roemer K. Mutant p53 can provoke apoptosis in p53-deficient Hep3B cells with delayed kinetics relative to wild-type p53. Oncogene 1998;17:350712.[CrossRef][Medline]
- Chuang-Tsai S, Sisson TH, Hattori N, et al. Reduction in fibrotic tissue formation in mice genetically deficient in plasminogen activator inhibitor-1. Am J Pathol 2003;163:44552.[Abstract/Free Full Text]
- Barcellos-Hoff MH, Dix TA. Redox-mediated activation of latent transforming growth factor-ß1. Mol Endocrinol 1996;10:107783.[Abstract/Free Full Text]
- Wagner A. Genes regulated cooperatively by one or more transcription factors and their identification in whole eukaryotic genomes. Bioinformatics 1999;15:77684.[Abstract/Free Full Text]
- Verrecchia F, Vindevoghel L, Lechleider RJ, Uitto J, Roberts AB, Mauviel A. Smad3/AP-1 interactions control transcriptional responses to TGF-ß in a promoter-specific manner. Oncogene 2001;20:333240.[CrossRef][Medline]
- Hua X, Miller ZA, Benchabane H, Wrana JL, Lodish HF. Synergism between transcription factors TFE3 and Smad3 in transforming growth factor-ß-induced transcription of the Smad7 gene. J Biol Chem 2000;275:332058.[Abstract/Free Full Text]
- Hua X, Liu X, Ansari DO, Lodish HF. Synergistic cooperation of TFE3 and smad proteins in TGF-ß-induced transcription of the plasminogen activator inhibitor-1 gene. Genes Dev 1998;12:308495.[Abstract/Free Full Text]
- Lopez-Rovira T, Chalaux E, Rosa JL, Bartrons R, Ventura F. Interaction and functional cooperation of NF-
B with Smads. Transcriptional regulation of the junB promoter. J Biol Chem 2000;275:2893746.[Abstract/Free Full Text]
- Dupont S, Zacchigna L, Adorno M, et al. Convergence of p53 and TGF-ß signaling networks. Cancer Lett 2004;213:12938.[CrossRef][Medline]
- Anscher MS, Kong FM, Andrews K, et al. Plasma transforming growth factor ß1 as a predictor of radiation pneumonitis. Int J Radiat Oncol Biol Phys 1998;41:102935.[CrossRef][Medline]
- Anscher MS, Marks LB, Shafman TD, et al. Risk of long-term complications after TFG-ß1-guided very-high-dose thoracic radiotherapy. Int J Radiat Oncol Biol Phys 2003;56:98895.[CrossRef][Medline]
- Novakova-Jiresova A, Van Gameren MM, Coppes RP, Kampinga HH, Groen HJ. Transforming growth factor-ß plasma dynamics and post-irradiation lung injury in lung cancer patients. Radiother Oncol 2004;71:1839.[CrossRef][Medline]
- De Jaeger K, Seppenwoolde Y, Kampinga HH, Boersma LJ, Belderbos JS, Lebesque JV. Significance of plasma transforming growth factor-ß levels in radiotherapy for non-small-cell lung cancer. Int J Radiat Oncol Biol Phys 2004;58:137887.[CrossRef][Medline]
- Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S, Henney AM. The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem 1993;268:1073945.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
F. Milliat, J.-C. Sabourin, G. Tarlet, V. Holler, E. Deutsch, V. Buard, R. Tamarat, A. Atfi, M. Benderitter, and A. Francois
Essential Role of Plasminogen Activator Inhibitor Type-1 in Radiation Enteropathy
Am. J. Pathol.,
March 1, 2008;
172(3):
691 - 701.
[Abstract]
[Full Text]
[PDF]
|
 |
|