Clinical Cancer Research The Science of Cancer Health Disparities Infection and Cancer: Biology, Therapeutics, and Prevention
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chan, M. W.Y.
Right arrow Articles by Huang, T. H-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chan, M. W.Y.
Right arrow Articles by Huang, T. H-M.
Clinical Cancer Research Vol. 11, 7376-7383, October 15, 2005
© 2005 American Association for Cancer Research


Imaging, Diagnosis, Prognosis

Hypermethylation of 18S and 28S Ribosomal DNAs Predicts Progression-Free Survival in Patients with Ovarian Cancer

Michael W.Y. Chan1, Susan H. Wei1, Ping Wen2, Zailong Wang3, Daniela E. Matei4, Joseph C. Liu1, Sandya Liyanarachchi1, Robert Brown5, Kenneth P. Nephew6, Pearlly S. Yan1 and Tim H-M. Huang1

Authors' Affiliations: 1 Human Cancer Genetics Program, Department of Molecular Virology, Immunology, and Medical Genetics, Comprehensive Cancer Center; 2 Department of Pathology, School of Medicine and Public Health; and 3 Mathematical Biosciences Institute, The Ohio State University, Columbus, Ohio; 4 Division of Hematology/Oncology, Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana; 5 Centre for Oncology and Applied Pharmacology, Cancer Research UK Beatson Laboratories, University of Glasgow, Glasgow, United Kingdom; and 6 Medical Sciences Program, Indiana University School of Medicine, Bloomington, Indiana

Requests for reprints: Tim H-M. Huang, Human Cancer Genetics Program, Department of Molecular Virology, Immunology, and Medical Genetics, Comprehensive Cancer Center, The Ohio State University, 420 West 12th Avenue, Columbus, OH 43210. Phone: 614-688-8277; Fax: 614-292-5995; E-mail: Tim.Huang{at}osumc.edu.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results and Discussion
 References
 
Purpose: Repetitive ribosomal DNA (rDNA) genes are GC-rich clusters in the human genome. The aim of the study was to determine the methylation status of two rDNA subunits, the 18S and 28S genes, in ovarian tumors and to correlate methylation levels with clinicopathologic features in a cohort of ovarian cancer patients.

Experimental Design: 18S and 28S rDNA methylation was examined by quantitative methylation-specific PCR in 74 late-stage ovarian cancers, 9 histologically uninvolved, and 11 normal ovarian surface epithelial samples. In addition, methylation and gene expression levels of 18S and 28S rDNAs in two ovarian cancer cell lines were examined by reverse transcription-PCR before and after treatment with the demethylating drug 5'-aza-2'-deoxycytidine.

Results: The methylation level (amount of methylated rDNA/ß-actin) of 18S and 28S rDNAs was significantly higher (P < 0.05) in tumors than in normal ovarian surface epithelial samples. Methylation of 18S and 28S rDNA was highly correlated (R2 = 0.842). Multivariate analysis by Cox regression found that rDNA hypermethylation [hazard ratio (HR), 0.25; P < 0.01], but not age (HR, 1.29; P = 0.291) and stage (HR, 1.09; P = 0.709), was independently associated with longer progression-free survival. In ovarian cancer cell lines, methylation levels of rDNA correlated with gene down-regulation and 5'-aza-2'-deoxycytidine treatment resulted in a moderate increase in 18S and 28S rDNA gene expressions.

Conclusion: This is the first report of rDNA hypermethylation in ovarian tumors. Furthermore, rDNA methylation levels were higher in patients with long progression-free survival versus patients with short survival. Thus, rDNA methylation as a prognostic marker in ovarian cancer warrants further investigation.


Ovarian cancer is the most lethal cancer in gynecologic malignancies and is the fourth leading cause of cancer death among women (1). There are ~22,220 new cases in the United States alone and about 16,210 deaths from the disease each year. Ovarian cancer is typically asymptomatic in early stages, and more than two thirds of patients present with late-stage disease. Despite therapeutic advances, 5-year survival rates are <30% for patients diagnosed with advanced-stage ovarian cancer. Clinicopathologic variables, such as Fédération Internationale des Gynaecologistes et Obstetristes (FIGO) stage, grade, and age, are currently used as prognostic indicators but the ability of these to predict patient survival remains fairly imprecise. Thus, a better understanding of the molecular pathogenesis of ovarian cancer may lead to the development of more sensitive and reliable prognostic markers.

Aberrant DNA methylation, an epigenetic hallmark of many cancers, plays an important role in tumorigenesis (2, 3). Several groups, including ours (4, 5), have shown that tumor suppressor genes can become transcriptionally silenced by CpG island hypermethylation in many different cancer types (6, 7), including ovarian cancer (8, 9). In addition to single-copy genes, normally unexpressed repeat sequences are also subjected to this epigenetic alteration during carcinogenesis (1012). We have found that ribosomal DNA (rDNA), tandemly expressed repeats, can display altered DNA methylation patterns in cancer (13, 14). About 800 copies of rDNA, located on the short arm of acrocentric chromosomes, are present in the human genome (15). The GC-rich transcriptional domains of rDNA are generally unmethylated in normal cells and associated with active expression of 18S, 5.8S, and 28S RNA subunits (16, 17).

Previously, we showed that rDNA genes are densely methylated in breast and endometrial cancers, suggesting that rDNA hypermethylation plays an important role in tumorigenesis (13, 14). However, semiquantitative Southern blotting was used in those studies, which is labor-intensive and requires a large amount of DNA (10 µg). Therefore, in the present study, we developed a PCR-based assay for rapid, quantitative analysis of cellular rDNA methylation. We used this assay to analyze rDNA methylation levels in ovarian cancers obtained from pathology archives. Our results indicate for the first time that the level of rDNA hypermethylation is associated with prolonged progression-free survival of ovarian cancer patients. We suggest that rDNA methylation represents a novel biomarker for the prognosis of ovarian cancer.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results and Discussion
 References
 
Patient DNA samples. Seventy-four formalin-fixed, paraffin-embedded tumor blocks from patients diagnosed with advanced-stage epithelial ovarian cancer between 1990 and 2001 were obtained from the Ohio State University Medical Center (Columbus, OH). Tumor areas were reviewed and confirmed by the appointed pathologist (P.W.) who selected the best representative areas with 100% invasive papillary serous carcinoma for microdissection. Area with necrosis and benign-appearing stroma were excluded. As control references, 11 normal ovarian surface epithelia and 9 histologically normal ovarian tissue samples adjacent to tumor sites were obtained from Indiana University School of Medicine (Bloomington, IN), Cooperative Human Tissue Network (Columbus, OH), and Western Infirmary and Stobhill General Hospital (Glasgow, United Kingdom). Clinicopathologic data for the tissues samples are summarized in Table 1.


View this table:
[in this window]
[in a new window]
 
Table 1. Association of rDNA methylation and clinicopathologic features of 74 ovarian cancer patients

 
Cell culture and demethylation treatment. Ovarian cancer cell lines A2780/MCP3 and A2780/CP70 were cultured in RPMI 1640 (Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum. For demethylating experiments, 5 x 105 cells were seeded in 90-mm plates and treated with 5 µmol/L 5'-aza-2'-deoxycytidine (5-azaDC; Sigma, St. Louis, MO) for 72 hours.

DNA extraction. Archival DNA was extracted by high heat and alkaline conditions as described by Shi et al. (18). Briefly, paraffin cores were autoclaved at 120°C for 20 minutes in the presence of 500 µL of 1% SDS and 0.1 mol/L NaOH (pH ~12.5). After cooling to room temperature, the samples were extracted and purified by phenol-chloroform extraction. The DNA pellet was dissolved in 50 µL distilled water and stored at –20°C until use. Genomic DNAs of fresh-frozen normal adjacent tissues were extracted using QIAamp tissue kit (Qiagen, Valencia, CA).

Bisulfite conversion and quantitative methylation-specific PCR. Genomic DNA (1 µg) was bisulfite modified by EZ DNA Methylation Kit (Zymo Research, Orange, CA). The modified DNA was subject to real-time quantitative methylation-specific PCR using Bio-Rad iCyler (Bio-Rad, Hercules, CA). Each reaction contained 12.5 µL of 2x SYBR Green supermix (Bio-Rad), 160 nmol/L of each primers, and 2 µL of bisulfite modified DNA in a total volume of 25 µL at 95°C for 10 minutes, 35 cycles of 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds. Primers targeting the rDNA transcriptional domains were 18S forward, 5' TTTTTAGATGTTCGGGGTTGTACGC, and 18S reverse, 5' CCATCACGAATAAAATTCAACGAA (104 bp); 28S forward, TTTTAGATTAGACGTGGCGATTCG, and 28S reverse, GACGCTAAACTCTTCCCTATTCACTCG (113 bp). ß-actin was used to normalize for input DNA. A region of ß-actin, devoid of any CpG dinucleotide, was amplified using the following primer sequences: ß-actin forward, 5' TGGTGATGGAGGAGGTTTAGTAAGT, and ß-actin reverse, 5' AACCAATAAAACCTACTCCTCCCTTAA (133 bp). The amount of methylated rDNA was determined by the threshold cycle number (Ct) for each sample against a standard curve generated by SssI-treated sperm DNA (Chemicon, Temecula, CA) and expressed as the ratio of the amount of rDNA to that of ß-actin. Samples with a ratio of >0.5 were considered to have a high level of rDNA methylation (see Results).

Ribosomal DNA expression analysis by quantitative reverse transcription-PCR. Total RNA from cell lines was extracted using RNeasy Mini Kit (Qiagen). Total RNA (1 µg) was treated with DNase I (amplification grade, Invitrogen) before first-strand cDNA synthesis using reverse transcriptase (Superscript II RT, Invitrogen). PCR reactions were carried out in a final volume of 25 µL containing 12.5 µL of SYBR Green PCR master mix (Applied Biosystems, Foster city, CA), 200 ng of each primer, and 2 µL of cDNA. 18S and 28S rDNAs and ß-actin cDNA were amplified with the following condition: 95°C for 10 minutes, 35 cycles of 95°C for 15 minutes, 60°C for 30 se conds, and 72°C for 35 seconds using an ABI 7500 real-time PCR system (Applied Biosystems). The primer sequences were 18S forward, 5'-GGATGCGTGCATTTATCAGA, and reverse, 5'-GTTGATAGGGCAGACGTTCG; 28S forward, 5'GACCCGCTGAATTTAAGCAT, and reverse, 5'GCCTCGATCAGAAGGACTTG; ß-actin forward, 5'TGCGTGACATTAAGGAGAAG, and reverse, 5'GCTCGTAGCTCTTCTCCA. The amount of cDNA in a sample was determined by comparing the Ct of the sample against a standard curve generated from a cDNA pool. The amount of ß-actin in each sample was used for normalization. To validate the use of ß-actin as an internal control, ß-actin levels in both the mock-treated and 5-azaDC–treated cells were compared. No effect of the treatment on ß-actin was observed (data not shown).

Statistical analysis. Univariate survival analysis was determined using Cox proportional hazards model with rDNA methylation level as a continuous variable. The multivariate Cox proportional hazards model was done to determine the independent prognostic value of rDNA methylation level, stage, and age. Progression-free survival and overall survival were assessed by Kaplan-Meier analysis using log-rank test. Progression-free survival was defined as the duration from day of diagnosis or chemotherapy to detection of new lesions or progression of residual lesions. Overall survival was defined as the duration from day of diagnosis to death. Multiple agents including carboplatin, cisplatin, taxol, and etoposide were used as chemotherapeutic agents. rDNA methylation level at 0.5 gave the best discrimination between long- and short-survival groups and was thus used as a cutoff. Mann-Whitney U test was used to compare the clinicopathologic variables of the two patient groups. All statistical calculations were done using either statistical package SAS version 9.1 (SAS Institute, Inc., Cary, NC) or SPSS version 11.0 for windows (SPSS, Inc., Chicago, IL). P < 0.05 was considered significant.


    Results and Discussion
 Top
 Abstract
 Materials and Methods
 Results and Discussion
 References
 
Concurrent hypermethylation of 18S and 28S ribosomal genes is a frequent event in ovarian serous carcinomas. To quantitate methylation levels of 18S and 28S rDNA in ovarian cancer, we used a simple and sensitive quantitative methylation-specific PCR assay with SYBR Green as the reporting molecule for quantifying DNA methylation (19). Two primer pairs, each targeting the transcriptional domains of 18S and 28S gene clusters, were used (Fig. 1A). Dissociation curves and amplification plots from real-time PCR confirmed that the amplification reactions were highly specific for the targeted regions (Fig. 1B).



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 1. Quantitative methylation-specific PCR assay. A, schematic representation of four consecutive rDNA repeat units and the CpG plot. Top, black box, rDNA transcription unit (18S, 5.8S, and 28S); white box, internal and external transcribed spacers. Solid line, intergenic spacers. Arrows, positions of the quantitative methylation-specific PCR primers. Bottom, plot of CpG frequency and GC% of a single rDNA unit based on a window size of 1,000 bp and a step of 1 bp. 18S, 5.8S, and 28S rDNAs are located at nucleotide positions 3,657 to 5,527, 6,623 to 6,779, and 7,935 to 12,969 bp, respectively. Primers targeting 18S and 28S are located between 5,157 and 5,260 bp and between 7,941 and 8,053 bp, respectively. B, standard curve, amplification plot, and dissociation curve of 18S, 28S, and ß-actin (ACTB) genes from standard (SssI-treated DNA) with different concentrations. The low Ct achieved by 18S and 28S suggests that the assay is very sensitive (limit of ~100 pg). The primers used for the interrogated region in all three genes yielded specific PCR products and no primer-dimers, which was confirmed by 10% PAGE (data not shown).

 
Late-stage ovarian tumors (n = 74) were analyzed by quantitative methylation-specific PCR. The median age at the time of diagnosis for our patient cohort was 58 years (range, 36-81 years). Forty-seven cases (63.5%) were at FIGO stage III and 27 cases (36.5%) were at FIGO stage IV. The results of rDNA methylation analysis and the clinicopathologic features of the patients are summarized in Table 1. For control experiments, normal ovarian surface epithelia (n = 11) and histologically normal ovarian samples (n = 9) were analyzed by this quantitative assay. As shown in Table 1, the mean methylation level of 28S rDNA was significantly higher in tumor samples than in both types of control samples; however, the level of 18S rDNA methylation was only significantly higher in tumors relative to normal ovarian surface epithelia. No association between rDNA hypermethylation and age (≤60 versus >60 years) or clinical stage (stage III versus stage IV) was observed. However, 18S and 28S methylation levels were highly correlated (R2 = 0.842; Fig. 2). Concurrent methylation of multiple single-copy genes has been observed in many tumor types (20, 21), including ovarian cancer (8). Although not fully understood, this nonrandom epigenetic phenomenon, commonly called CpG island methylator phenotype, may be due to dysregulation of trans elements in cancer cells (2224). Alternatively, a defect of cis elements (or methylation centers) could occur, allowing the spread of methylation from this center to the adjacent CpG site(s) (24). To our knowledge, this is the first report of concurrent hypermethylation of 18S and 28S ribosomal genes in ovarian cancer, which are located in tandem in the rDNA cluster. Thus, a spreading phenomenon may explain the nature of concurrent hypermethylation of these two rDNA genes.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2. Scatter plot of 18S and 28S rDNA hypermethylation in 74 ovarian cancer patients. Methylation levels of rDNA genes are expressed as the ratio of the amount of hypermethylated rDNA to the amount of actin (ACTB), the control gene. Methylations of these two ribosomal genes are highly correlated (R2 = 0.842), suggesting concurrent hypermethylation.

 
Higher ribosomal DNA methylation level predicts better survival in ovarian cancer. To assess whether rDNA hypermethylation was a prognostic indicator for ovarian cancer patients, survival analyses were done. First, a methylation level of 0.5 was set as a cutoff as this level gave the best discrimination between long- and short-survival groups. Kaplan-Meier survival curves showed that patients with high 28S methylation had longer progression-free survival (P = 0.0014) and overall survival (P = 0.0196) than patients with low 28S methylation (Fig. 3B and D). Although the 18S methylation was not significantly different between these two groups of patients, patients with high 18S methylation tended to have longer survival (Fig. 3A and C). We next compared rDNA methylation levels between extreme survival groups (≤12 versus ≥84 months). Patients with long progression-free survival had significantly higher 18S and 28S methylation level (P = 0.01 and 0.001, respectively; Table 1; Fig. 4A and B). For patients with long overall survival, a higher level of 28S methylation was observed (P = 0.03) but no increase in the level of 18S methylation was seen (Table 1; Fig. 4C and D).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. Kaplan-Meier analysis of progression-free survival (A and B) and overall survival (C and D) for 18S (A and C) and 28S (B and D) methylation among 74 ovarian cancer patients. Patient groups were classified according to the rDNA methylation level of 0.5, which gave the best discrimination between long- and short-survival groups. High 28S methylation is a prognostic marker for long progression-free survival and overall survival. Log-rank P values are shown.

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Box plot of 18S (A and C) and 28S (B and D) methylation in long- and short-survival groups. A and B, progression-free survival (PFS); C and D, overall survival (OS). Short progression-free survival and overall survival groups are defined as survival of <12 months whereas long progression-free survival and overall survival groups are defined as survival of >84 months. Box, interquartile range which contains 50% of the measured variable. Thick horizontal line across the box, median value. Whiskers, maximum and minimum values.

 
To exclude the possibility that the above approaches, which were based on a cutoff value or extreme survival groups, may have biased the data analysis, a univariate analysis to analyze rDNA methylation on a continuous scale was done. The results from Cox proportional hazards model are shown in Table 2. Both 18S and 28S hypermethylation can efficiently predict progression-free survival [hazard ratios (HR) of 0.259 and 0.264; P = 0.042 and 0.008, respectively] but not overall survival (P = 0.133 and 0.086 for 18S and 28S HR, respectively). This result is essentially similar to the Kaplan-Meier finding in that higher levels of rDNA methylation were associated with longer survival. We also did multivariate analysis to assess independent predictive values of rDNA hypermethylation (as continuous variables), age at diagnosis, and clinical stage on progression-free survival and overall survival by the Cox proportional hazards model (Table 3). rDNA methylation was a significant prognostic factor in predicting progression-free survival (P = 0.018) but not significant for overall survival (P = 0.091). As expected, age was also a significant prognostic factor for overall survival (P = 0.018). Clinical stage was not significant for progression-free survival and overall survival (P = 0.709 and P = 0.415, respectively).


View this table:
[in this window]
[in a new window]
 
Table 2. Univariate analysis of survival by Cox proportional hazards model

 

View this table:
[in this window]
[in a new window]
 
Table 3. Multivariate analysis of survival by Cox proportional hazards model

 
Hypermethylated genes have been widely used as markers for early detection, diagnosis, and prognosis of cancer (25), and the methylation status of MGMT was recently shown to predict brain tumor response to chemotherapy (26). To date, most studies have associated DNA hypermethylation in single-copy tumor suppressor gene with poor prognosis. Our results, in concordance with our previous report in endometrial cancer (14), show that hypermethylation of tandem rDNA clusters in ovarian cancer has positive prognostic potential. Conversely, Cheng et al. (27), in an animal study, showed that low methylation of ribosomal genes in parental sperm cells may result in high incidence of neoplasm in their offspring. Taken together, our observations and those of Cheng et al. indicate that alterations in rDNA methylation play a role in tumorigenesis. As DNA hypermethylation has been shown to affect rDNA transcription (28), it is tempting to postulate that this methylation-dependent silencing may have a negative effect on the ribosome-associated protein synthesis essential for active tumor proliferation.

DNA hypermethylation contributes, in part, to the silencing of ribosomal DNA genes in ovarian cancer cells. Because epigenetic regulation of a ribosomal gene cluster had not been previously shown in ovarian tumors, it was of interest to examine the effect of 5-azaDC on 18S and 28S rDNA demethylation. Quantitative methylation-specific PCR and quantitative reverse transcription-PCR assays were used to determine the level of rDNA methylation and gene expression in MCP3 and CP70 ovarian cancer cell lines before and after 5-azaDC treatment. As shown in Fig. 5A, the levels of 18S and 28S methylation were partially decreased after the demethylating treatment, resulting in a moderate increase in 18S and 28S gene expressions. This initial result suggests that rDNA methylation level is inversely correlated with its gene expression (Fig. 5A and B). It also points to other types of epigenetic modifications that may work together with DNA methylation to fully modulate rDNA expression (29). Our future analysis will focus on investigating the role of other epigenetic mechanisms in regulating ribosomal gene transcription. In addition, functional analysis can be done to establish the relationship between epigenetic down-regulation and attenuation of the ribosomal protein synthesis machinery in cancer cells.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5. Treatment of ovarian cancer cell lines with a demethylating agent. Ovarian cancer cell lines MCP3 and CP70 were treated with 5 µmol/L 5-azaDC for 72 hours. DNA and RNA were extracted and rDNA methylation levels were determined by real-time quantitative methylation-specific PCR (A). B, rRNA expression levels determined by real-time reverse transcription-PCR. 18S and 28S rRNA expression levels were normalized by the expression level of ß-actin in the same sample. Relative levels (%) of rDNA methylation and expression before and after 5-azaDC treatment. All cell lines showed moderate demethylation as well as up-regulation of rRNA after treatment.

 
In conclusion, we have shown that rDNA hypermethylation is a frequent event in ovarian tumors and can serve as an independent prognostic indicator for patients. An additional study is under way to further confirm this observation in an independent cohort of ovarian cancer patients and to adapt the quantitative methylation-specific PCR assay for examining rDNA hypermethylation in serum.


    Footnotes
 
Grant support: National Cancer Institute grants R01 CA-85289 (K.P. Nephew and T.H-M. Huang) and R21 CA110475 (T.H-M. Huang and R. Brown) and by funds from The Ohio State University Comprehensive Cancer Center-Arthur G. James Cancer Hospital and Richard J. Solove Research Institute (P.S. Yan and T.H-M. Huang) and from Cancer Research, United Kingdom (R. Brown).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 5/18/05; revised 7/ 8/05; accepted 7/14/05.


    References
 Top
 Abstract
 Materials and Methods
 Results and Discussion
 References
 

  1. Jemal A, Murray T, Ward E, et al. Cancer statistics, 2005. CA Cancer J Clin 2005;55:10–30.[Abstract/Free Full Text]
  2. Jones PA, Laird PW. Cancer epigenetics comes of age. Nat Genet 1999;21:163–7.[CrossRef][Medline]
  3. Nephew KP, Huang TH. Epigenetic gene silencing in cancer initiation and progression. Cancer Lett 2003;190:125–33.[CrossRef][Medline]
  4. Leu YW, Yan PS, Fan M, et al. Loss of estrogen receptor signaling triggers epigenetic silencing of downstream targets in breast cancer. Cancer Res 2004;64:8184–92.[Abstract/Free Full Text]
  5. Yan PS, Shi H, Rahmatpanah F, et al. Differential distribution of DNA methylation within the RASSF1A CpG island in breast cancer. Cancer Res 2003;63:6178–86.[Abstract/Free Full Text]
  6. Herman JG, Baylin SB. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 2003;349:2042–54.[Free Full Text]
  7. Esteller M, Corn PG, Baylin SB, Herman JG. A gene hypermethylation profile of human cancer. Cancer Res 2001;61:3225–9.[Abstract/Free Full Text]
  8. Strathdee G, Appleton K, Illand M, et al. Primary ovarian carcinomas display multiple methylator phenotypes involving known tumor suppressor genes. Am J Pathol 2001;158:1121–7.[Abstract/Free Full Text]
  9. Yoon JH, Dammann R, Pfeifer GP. Hypermethylation of the CpG island of the RASSF1A gene in ovarian and renal cell carcinomas. Int J Cancer 2001;94:212–7.[CrossRef][Medline]
  10. Widschwendter M, Jiang G, Woods C, et al. DNA hypomethylation and ovarian cancer biology. Cancer Res 2004;64:4472–80.[Abstract/Free Full Text]
  11. Nishiyama R, Qi L, Tsumagari K, et al. A DNA repeat, NBL2, is hypermethylated in some cancers but hypomethylated in others. Cancer Biol Ther 2005;4.
  12. Nagai H, Kim YS, Yasuda T, et al. A novel sperm-specific hypomethylation sequence is a demethylation hotspot in human hepatocellular carcinomas. Gene 1999;237:15–20.[CrossRef][Medline]
  13. Yan PS, Rodriguez FJ, Laux DE, Perry MR, Standiford SB, Huang TH. Hypermethylation of ribosomal DNA in human breast carcinoma. Br J Cancer 2000;82:514–7.[CrossRef][Medline]
  14. Powell MA, Mutch DG, Rader JS, Herzog TJ, Huang TH, Goodfellow PJ. Ribosomal DNA methylation in patients with endometrial carcinoma: an independent prognostic marker. Cancer 2002;94:2941–52.[CrossRef][Medline]
  15. Worton RG, Sutherland J, Sylvester JE, et al. Human ribosomal RNA genes: orientation of the tandem array and conservation of the 5' end. Science 1988;239:64–8.[Abstract/Free Full Text]
  16. Dante R, Percy ME, Baldini A, et al. Methylation of the 5' flanking sequences of the ribosomal DNA in human cell lines and in a human-hamster hybrid cell line. J Cell Biochem 1992;50:357–62.[CrossRef][Medline]
  17. Gonzalez IL, Wu S, Li WM, Kuo BA, Sylvester JE. Human ribosomal RNA intergenic spacer sequence. Nucleic Acids Res 1992;20:5846.[Free Full Text]
  18. Shi SR, Cote RJ, Wu L, et al. DNA extraction from archival formalin-fixed, paraffin-embedded tissue sections based on the antigen retrieval principle: heating under the influence of pH. J Histochem Cytochem 2002;50:1005–11.[Abstract/Free Full Text]
  19. Chan MW, Chu ES, To KF, Leung WK. Quantitative detection of methylated SOCS-1, a tumor suppressor gene, by a modified protocol of quantitative real time methylation-specific PCR using SYBR green and its use in early gastric cancer detection. Biotechnol Lett 2004;26:1289–93.[CrossRef][Medline]
  20. Toyota M, Ahuja N, Ohe-Toyota M, Herman JG, Baylin SB, Issa JP. CpG island methylator phenotype in colorectal cancer. Proc Natl Acad Sci U S A 1999;96:8681–6.
  21. Toyota M, Ahuja N, Suzuki H, et al. Aberrant methylation in gastric cancer associated with the CpG island methylator phenotype. Cancer Res 1999;59:5438–42.[Abstract/Free Full Text]
  22. Costello JF, Fruhwald MC, Smiraglia DJ, et al. Aberrant CpG-island methylation has non-random and tumour-type-specific patterns. Nat Genet 2000;24:132–8.[CrossRef][Medline]
  23. Parrella P, Poeta ML, Gallo AP, et al. Nonrandom distribution of aberrant promoter methylation of cancer-related genes in sporadic breast tumors. Clin Cancer Res 2004;10:5349–54.[Abstract/Free Full Text]
  24. Issa JP. CpG island methylator phenotype in cancer. Nat Rev Cancer 2004;4:988–93.[CrossRef][Medline]
  25. Widschwendter M, Jones PA. The potential prognostic, predictive, and therapeutic values of DNA methylation in cancer. Commentary re: Kwong J, et al. Clin Cancer Res 2002;8:131–7 and Zou H-Z, et al. Clin Cancer Res 2002;8:188–91. Clin Cancer Res 2002;8:17–21.[Abstract/Free Full Text]
  26. Esteller M, Garcia-Foncillas J, Andion E, et al. Inactivation of the DNA-repair gene MGMT and the clinical response of gliomas to alkylating agents. N Engl J Med 2000;343:1350–4.[Abstract/Free Full Text]
  27. Cheng RY, Hockman T, Crawford E, Anderson LM, Shiao YH. Epigenetic and gene expression changes related to transgenerational carcinogenesis. Mol Carcinog 2004;40:1–11.[CrossRef][Medline]
  28. Santoro R, Grummt I. Molecular mechanisms mediating methylation-dependent silencing of ribosomal gene transcription. Mol Cell 2001;8:719–25.[CrossRef][Medline]
  29. Santoro R, Li J, Grummt I. The nucleolar remodeling complex NoRC mediates heterochromatin formation and silencing of ribosomal gene transcription. Nat Genet 2002;32:393–6.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chan, M. W.Y.
Right arrow Articles by Huang, T. H-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chan, M. W.Y.
Right arrow Articles by Huang, T. H-M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online