
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Imaging, Diagnosis, Prognosis |
Authors' Affiliations: Departments of 1 Surgery and Oncology and 2 Anatomic Pathology, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan
Requests for reprints: Kazuhiro Mizumoto, Department of Surgery and Oncology, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Fukuoka 812-8582, Japan. Phone: 81-92-642-5440; Fax: 81-92-642-5458; E-mail: mizumoto{at}med.kyushu-u.ac.jp.
| Abstract |
|---|
|
|
|---|
Microarray analysis allows simultaneous monitoring of the expression of thousands of genes and is a powerful tool for identifying genes associated with pancreatic carcinoma. Microarray analyses recently showed expression of S100A2 and S100A6 to be up-regulated in pancreatic cancer (68). S100 family proteins are small Ca2+, Zn2+, and Cu2+ binding proteins of the EF-hand type and have been implicated in regulation of a variety of intracellular and extracellular processes, including cell proliferation, differentiation, cell-cell communication, cell structure, energy metabolism, motility, contraction, and intracellular signaling. In addition, protein chip analyses showed up-regulation of S100A6 in pancreatic cancer (9) and overexpression of S100A2 was observed in nonsmall cell lung cancer with metastasis (10). Taken together, the data suggest that S100A2 and S100A6 are promising diagnostic markers and/or therapeutic targets for pancreatic cancer.
In the present study, we quantitatively measured the expression of S100A2 and S100A6 mRNAs in pancreatic cancer cell lines, pancreatic tissues, and pancreatic juice by real-time PCR. S100A6 mRNA levels in tumor specimens from pancreas and pancreatic juice samples from patients with pancreatic cancer were increased significantly compared with levels in nonneoplastic tissues or pancreatic juice from patients with nonneoplastic diseases. The preoperative diagnostic accuracy of quantitative analysis of S100A2 and S100A6 mRNAs in pancreatic juice was compared by receiver operating characteristic (ROC) curve analysis (11). To investigate the role of S100A6 in carcinogenesis and the usefulness of quantitative analysis of S100A6 mRNA for detection of early pancreatic cancer, immunohistochemical studies and microdissection-based quantitative analysis of mRNA were done in normal ducts, pancreatic intraepithelial neoplasias, and invasive ductal carcinomas (IDC). In addition, to evaluate the functional role of S100A6 and its possible therapeutic implications, we inhibited expression of S100A6 mRNA using RNA interference (RNAi) and investigated its effect on proliferation and invasiveness of pancreatic cancer cells in vitro. Finally, we screened oligonucleotide microarrays to identify transcripts influenced by S100A6 and found several cancer-related genes whose expression was up-regulated or down-regulated by inhibition of S100A6.
| Materials and Methods |
|---|
|
|
|---|
The diagnosis of pancreatic ductal adenocarcinoma was confirmed by histologic examination of resected specimens or by the presence of liver metastasis. The diagnosis of pancreatitis or cholelithiasis was made based on either histologic examination of resected specimens or clinical observation with conventional diagnostic imaging for at least 6 months. Written informed consent was obtained from all patients, and the study was conducted according to the Helsinki Declaration.
Quantitative assessment of S100A2 and S100A6 mRNA levels by real-time PCR. Total RNA was extracted from cell pellets of pancreatic juice, cultured cells, and isolated cells by a microdissection technique with a PicoPure RNA Isolation Kit (Arcturus, Mountain View, CA) or High Pure RNA Isolation Kit (Roche Diagnostics, Mannheim, Germany) with DNase I (Roche Diagnostics) treatment according to the manufacturer's instructions. We designed specific primers (S100A2 forward primer, AGCTTTGTGGGGGAGAAAGT and reverse primer, CAGTGATGAGTGCCAGGAAA; S100A6 forward primer, AAGCTGCAGGATGCTGAAAT and reverse primer, CCCTTGAGGGCTTCATTGTA; ß-actin forward primer, AAATCTGGCACCACACCTTC and reverse primer, GGGGTGTTGAAGGTCTCAAA) and did BLAST searches to ensure the specificity of these primers. Quantitative reverse transcription-PCR was done with a QuantiTect SYBR Green Reverse Transcription-PCR kit (Qiagen, Tokyo, Japan) with a LightCycler Quick System 350S (Roche Diagnostics) as described previously (15). Each sample was run twice, and all samples showing >10% deviation of reverse transcription-PCR measurements were tested a third time. The level of expression of mRNA for each gene was calculated on a standard curve constructed from values of total RNA from the Capan-1 pancreatic cancer cell line. Expression of each gene was given as the ratio of expression of each target gene mRNA to that of ß-actin mRNA.
Immunohistochemical studies. Thirty-three tumoral tissues containing IDC cells were obtained from patients who underwent surgery for pancreatic cancer. Forty-two nontumoral tissues containing normal ducts and 18 tissues containing pancreatic intraepithelial neoplasia lesions were obtained, some from these patients who underwent surgery for pancreatic cancer and some from other patients with pancreatic cancer or with other diseases. Sections of formalin-fixed, paraffin-embedded specimens were deparaffinized in xylene and dehydrated in graded alcohol. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide in PBS. Sections were incubated for 20 minutes with a protein-blocking solution consisting of PBS containing 1.5% normal goat serum (DAKO, Glostrup, Denmark) and then incubated with the appropriate dilution of mouse monoclonal S100A6 (Sigma, St. Louis, MO) antibody overnight at 4°C. Sections were then incubated with the appropriate dilution of biotinylated anti-mouse IgG (Vectastain Elite Avidin-Biotin Complex kit, Vector Labs, Burlingame, CA) for 30 minutes. Immunocomplexes were visualized with stable 3,3'-diaminobenzidine tetrahydrochloride (Dojin, Kumamoto, Japan). The sections were rinsed with distilled water and counterstained with hematoxylin for 10 seconds.
Evaluation of degree of antibody reactivity. The degree of monoclonal anti-S100A6 reactivity with each tissue section was scored as the percentage of stained normal or neoplastic epithelial cells in the section (0 points for no cells stained, 1 point for <20%, 2 points for 20-75%, and 3 points for >75% of cells stained), and the intensity of immunoreactivity was graded on a scale of 0 to 3. The total score was the product of the scores for the intensity and extent of staining. Negative cases had a score of 0, weakly positive cases had a score of 1 to 3, moderately positive cases had a score of 4 to 6, and strongly positive cases had a final score of >6, as described previously (7). Pathologists who judged the intensity and extent of staining were blinded to the results of the other study.
Microdissection-based quantitative analysis of S100A6 mRNA. Frozen tissue samples were cut into 8-µm sections. One section was stained with H&E for histologic examination. IDC cells, pancreatic intraepithelial neoplasia cells, and normal pancreatic ductal epithelial cells were isolated selectively with a laser microdissection and pressure catapulting system (PALM Microlaser Technologies, Bernried, Germany) in accordance with the manufacturer's protocol. After microdissection, total RNA was extracted from the selected cells and subjected to real-time PCR for quantitative measurement of S100A6 as described previously (16).
Inhibition of S100A6 mRNA by small interfering RNA. Inhibition of S100A6 expression was achieved by RNAi. We designed two S100A6-targeting small interfering RNAs (siRNA: target sequence, AAGCCCTCAAGGGCTGAAAAT for siRNA-K1 and AAGCTGCAGGATGCTGAAATT for siRNA-K2) and did BLAST searches to ensure the specificity of these siRNAs. To verify the specificity of the knockdown effect, we used control siRNA provided by Qiagen. Panc-1, CFPAC-1, and ASPC-1 cells were transfected with the indicated 100 pmol siRNA with Nucleofector (Amaxa Biosystems GmbH, Köln, Germany) according to the manufacturer's instructions. Cells were harvested at the indicated time after transfection. Total RNA was extracted from each sample, and the expression of target mRNA was evaluated by real-time PCR.
Cell proliferation assay. Cells were transfected with the indicated 100 pmol siRNA and seeded in 24-well plates at a density of 5 x 104 per well. The number of cells was investigated at the indicated time by measuring the fluorescence intensity of propidium iodide as described previously (17).
Invasion assay. Invasiveness of cancer cells was evaluated by counting the number of cells invading through a Matrigel-coated transwell as reported previously (12). Briefly, transwell inserts with 8-µm pores were coated with Matrigel (40 or 20 µg/well). Cancer cells were transfected with the indicated siRNA and seeded in the Matrigel-coated transwell inserts. After 48 or 72 hours of incubation, cells invading to the lower surface of the Matrigel-coated membrane were counted under a light microscope.
Oligonucleotide array hybridization and data analysis. Global gene expression profiling was done with oligonucleotide microarrays (Human Genome U133 Plus 2.0 Chips, Affymetrix, Santa Clara, CA). Briefly, total RNA (10 µg) was reverse transcribed with the One-Cycle cDNA Synthesis Kit (Affymetrix). The cDNA was in vitro transcribed with the GeneChip Expression 3'-amplification reagents for IVT Labeling (Affymetrix). The cRNA (20 µg) was fragmented and hybridized to an HG-U133 Plus 2.0 GeneChip (Affymetrix) with a standard procedure (45°C, 16 hours). Washing and staining were done in a Fluidics Station 450 (Affymetrix) with protocol EukGE-WS2v4 and scanning in an Affymetrix GeneChip 3000 scanner. Signal intensity for each transcript (background subtracted and adjusted for noise) and detection call (present, absent, or marginal) were determined with Microarray Suite Software 5.0 (Affymetrix).
Statistical analysis. Data for clinical samples were analyzed by Mann-Whitney U test, because normal distribution was not obtained. To evaluate the ability of measurement of S100A6 expression to differentiate carcinoma from nonneoplastic diseases, we constructed ROC curves by calculating the sensitivities and specificities of data for each marker at several predetermined cutoff points using the MedCalc statistical software package, version 7.6 (MedCalc, Mariakerke, Belgium; ref. 18). We used MedCalc software to do a statistical analysis of the difference in ROC curves, according to the method described by Hanley and McNeil (19). Differences in immunohistochemistry data were analyzed by Kruskal-Wallis test if comparisons involved three groups and by Mann-Whitney U test if comparisons involved two groups. For in vitro experiments, values are expressed as mean ± SD. One-way ANOVA was used to analyze differences among three groups, and Student's t test was used for differences between two groups. P < 0.05 was considered statistically significant for all tests.
| Results |
|---|
|
|
|---|
|
Quantitative analysis of S100A2 and S100A6 mRNA levels in pancreatic juice. We measured S100A2 and S100A6 mRNA levels in pancreatic juice samples from 56 patients with different pancreatic diseases (pancreatic carcinoma, n = 22; nonneoplastic disease, n = 34: pancreatitis, n = 28 and cholelithiasis, n = 6). Expression of S100A6 mRNA was significantly higher in carcinoma samples than in nonneoplastic samples (P < 0.0001), whereas there was no significant difference in S100A2 mRNA expression (P = 0.6749; Fig. 2A and B).
|
These data are not consistent with data obtained by analysis of pancreatic tissues. The use of bulky tissue consisting of various cell types including stromal cells and acinar cells for tissue analysis may have contributed to these conflicting results (20). The difference in S100A6 expression may be greater in analysis of pancreatic juice than in analysis of bulky tissues because most cells in pancreatic juice are epithelial cells. Conversely, the difference in S100A2 expression was less in pancreatic juices than in bulky tissues. In the analysis of pancreatic juice, most pancreatic juice samples used as normal counterparts were derived from patients with chronic pancreatitis. These chronic pancreatitis-affected pancreatic juice samples include massive numbers of hyperplastic epithelial cells. These cells, in addition to the carcinoma cells, may express high levels of S100A2 and lead to false-positive results.
Differential expression of S100A6 in invasive ductal carcinomas, high-grade pancreatic intraepithelial neoplasias, and normal ducts. To confirm that quantification of S100A6 mRNA in pancreatic juice may be a valid method for detecting early pancreatic cancer, we compared expression of S100A6 mRNA and protein in high-grade pancreatic intraepithelial neoplasias with expression in normal ducts or IDCs. Representative immunohistochemistry data obtained with the anti-S100A6 antibody are shown in Fig. 3A. S100A6 was expressed diffusely at moderate or high levels in 84.8% of IDCs, whereas S100A6 immunoreactivity was negative in >80% of normal ducts (Table 1). In high-grade pancreatic intraepithelial neoplasias, S100A6 staining was weak or moderate, with granular staining localized in the supranuclear regions (Fig. 3A; Table 1).
|
|
S100A6 mRNA expression in 14 pancreatic cancer cell lines. To confirm expression of S100A6 mRNA in pancreatic cancer cell lines and to select cell lines appropriate for in vitro RNAi experiments, S100A6 mRNA expression was measured in 14 pancreatic cancer cell lines. As shown in Fig. 4A, all 14 pancreatic cancer cell lines expressed S100A6 mRNA. The median value of expression was 2.4. For subsequent experiments, we selected Panc-1, ASPC-1, and CFPAC-1 cells because they expressed moderate levels of S100A6 and because conditions for siRNA transfection with Nucleofector had been established.
|
We then investigated the effect of inhibition of S100A6 mRNA on the invasive potential of pancreatic cancer cells. A photograph of Panc-1 cells, which were invading through the Matrigel (40 µg)coated membrane 48 hours after transfection of control siRNA or siRNA against S100A6, is shown in Fig. 5A. The number of invading cells was significantly reduced in an inhibition rate-dependent manner when the cells were transfected with siRNAs against S100A6. When siRNA-K2 against S100A6 was transfected, the number of invading cells was decreased to 31.8% that of control siRNA-transfected cells (Fig. 5B). We did the same analyses (Matrigel, 20 µg; incubation time, 72 hours) with CFPAC-1 cells and obtained similar results (Fig. 5C). The proliferation assay revealed that there was no significant difference in proliferation of Panc-1 cells 2 days after transfection and of CFPAC-1 cells 3 days after transfection of siRNA against S100A6 (Fig. 4C). Therefore, it is unlikely that decreased invasiveness caused by transfection of siRNA against S100A6 merely reflects a decreased number of cells in the siRNA-treated cultures. The invasive behavior of cancer cells in the in vitro invasion assay is thought to be independent of proliferative activity (21, 22).
|
2-fold decrease in expression in S100A6-targeting siRNA-transfected cells compared with that of control siRNA-transfected cells. Only 130 (0.64%) transcripts showed a
2-fold increase in S100A6-targeting siRNA-transfected cells. Most of the genes identified as differentially expressed have not been reported previously in association with S100A6 expression. Fifteen known genes up-regulated or down-regulated by inhibition of S100A6 are listed in Tables 2 and 3. Notably, several genes down-regulated by inhibition of S100A6 are associated with the proliferative properties or apoptosis of cancer cells. In particular, a never in mitosis gene a (NIMA)related kinase 2, serine/threonine kinase 6 (Aurora A), and centromere protein A are involved in cell proliferation, especially in mitotic regulation (2325). Human ovarian ß-A inhibin, which forms a homodimer, activin A, and cytokine gro-ß were up-regulated by inhibition of S100A6, These genes are known to be negative regulators of cell proliferation (2629). In addition, activating transcription factor 3 and protocadherin ß2 are reported to be involved in cancer invasion (3033). Therefore, up-regulation of these genes may lead to inhibition of motility or invasion of cancer cells. These findings suggest that proliferation or invasion/metastasis-promoting genes and growth or tumor suppressor genes may be direct or indirect targets of S100A6 activity.
|
|
| Discussion |
|---|
|
|
|---|
The sensitivity of cytology to detect cancerous cells in pancreatic juice varies from 30% to 80%, even in the hands of experienced cytologists (34, 35). Many investigators have reported qualitative analyses of alterations, such as K-ras or p53 mutations, in pancreatic juice (3639). However, qualitative analyses of DNA mutations are problematic because of the frequent presence of K-ras or p53 mutations in pancreatic intraepithelial neoplasias or hyperplastic duct (4042). It has been reported that quantitative analysis of Ras mutations is a useful strategy for diagnosis of pancreatic carcinoma (43). However, quantitation of DNA mutations merely reflects the component ratio of cells with mutations against cells without mutations, meaning that this is not a suitable method for differentiating mutated malignant cells from mutated nonmalignant cells, such as atypical hyperplasia and pancreatic intraepithelial neoplasias. However, quantitation of target mRNA expression reflects the component ratio of cells expressing target mRNA to cells that do not express the target mRNA; it also reflects the difference in expression of the target mRNA between malignant cells and nonmalignant cells, even if both cell types express the target mRNA. This suggests that quantitative analysis of mRNA is a promising diagnostic tool for identifying pancreatic cancer in clinical specimens, provided that target mRNA expression levels differ sufficiently between malignant and nonmalignant cells.
Stulik et al. (44) and Komatsu et al. (45) observed differential expression of S100A6 in normal, preneoplastic, and neoplastic colonic mucosa by immunohistochemistry, consistent with results of our present immunohistochemistry and microdissection-based mRNA analyses of normal pancreatic ductal cells, high-grade pancreatic intraepithelial neoplasias, and IDCs. High-grade pancreatic intraepithelial neoplasias are regarded histologically as precancerous or noninvasive cancerous lesions (46). Therefore, differential expression of S100A6 during carcinogenesis suggests that quantitative analysis of S100A6 mRNA levels in pancreatic juice may be a promising modality not only to distinguish pancreatic cancer from nonneoplastic disease but also to detect early pancreatic cancer. In the present study, we used the whole cell pellet from pancreatic juice, which consisted of atypical cells and normal epithelial cells. There is still room to improve the sensitivity and specificity of this testing strategy. For example, to improve accuracy of the quantitative analysis, microdissection should be used to isolate atypical cells from pancreatic juice for testing. The study of cells microdissected from pancreatic juice is now in progress in our laboratory.
Although analysis of S100A6 expression has been reported, the role of S100A6 is not well understood. In the present study, RNAi experiments clearly showed that S100A6 is involved not only in cell proliferation but also in invasion of pancreatic cancer cells. Our oligonucleotide microarray data revealed that inhibition of S100A6 affects expression of some genes, such as activin A and activating transcription factor 3, that are involved in cell proliferation and invasion. Tonini et al. (47) and Breen and Tang (48) showed that S100A6 regulates cell cycle progression or proliferation, in keeping with our proliferation assay data. We show that inhibition of S100A6 expression suppresses invasive potential as well as proliferation. Komatsu et al. (45) reported that, in colorectal adenocarcinoma with or without metastasis, differential expression of S100A6 was observed by immunohistochemistry. The data suggest that S100A6 is clinically applicable for diagnosis and staging of pancreatic cancer and for determining prognosis. Interference with the multiple activities of S100A6 is an attractive strategy for therapeutic intervention.
In conclusion, results of our expression analyses suggest that S100A6 is up-regulated during the early phase of carcinogenesis of pancreatic cancer and that quantification of S100A6 mRNA may be useful for diagnosis and possibly for early detection of pancreatic cancer. Our data also indicate that S100A6 is associated with both progression and invasion of pancreatic cancer. Although these results need to be verified in an independent set of experiments, our findings suggest that S100A6 may be a promising diagnostic marker and therapeutic target for pancreatic cancer.
| Footnotes |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 4/ 1/05; revised 7/25/05; accepted 8/ 9/05.
| References |
|---|
|
|
|---|
-A11 in astrocytomas. Neoplasia 2005;7:1939.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
T. Moriyama, K. Ohuchida, K. Mizumoto, J. Yu, N. Sato, T. Nabae, S. Takahata, H. Toma, E. Nagai, and M. Tanaka MicroRNA-21 modulates biological functions of pancreatic cancer cells including their proliferation, invasion, and chemoresistance Mol. Cancer Ther., May 1, 2009; 8(5): 1067 - 1074. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Cervera, N. Apostolova, F. L. Crespo, M. Mata, and K. J. McCreath Cells Silenced for SDHB Expression Display Characteristic Features of the Tumor Phenotype Cancer Res., June 1, 2008; 68(11): 4058 - 4067. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Ning, S. Sun, L. Hong, J. Liang, L. Liu, S. Han, Z. Liu, Y. Shi, Y. Li, W. Gong, et al. Calcyclin-Binding Protein Inhibits Proliferation, Tumorigenicity, and Invasion of Gastric Cancer Mol. Cancer Res., December 1, 2007; 5(12): 1254 - 1262. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Orre, M. Pernemalm, J. Lengqvist, R. Lewensohn, and J. Lehtio Up-regulation, Modification, and Translocation of S100A6 Induced by Exposure to Ionizing Radiation Revealed by Proteomics Profiling Mol. Cell. Proteomics, December 1, 2007; 6(12): 2122 - 2131. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Whiteman, M. E. Weeks, S. E. Dowen, S. Barry, J. F. Timms, N. R. Lemoine, and T. Crnogorac-Jurcevic The Role of S100P in the Invasion of Pancreatic Cancer Cells Is Mediated through Cytoskeletal Changes and Regulation of Cathepsin D Cancer Res., September 15, 2007; 67(18): 8633 - 8642. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ohuchida, K. Mizumoto, J. Yu, H. Yamaguchi, H. Konomi, E. Nagai, K. Yamaguchi, M. Tsuneyoshi, and M. Tanaka S100A6 Is Increased in a Stepwise Manner during Pancreatic Carcinogenesis: Clinical Value of Expression Analysis in 98 Pancreatic Juice Samples Cancer Epidemiol. Biomarkers Prev., April 1, 2007; 16(4): 649 - 654. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ohuchida, K. Mizumoto, T. Egami, H. Yamaguchi, K. Fujii, H. Konomi, E. Nagai, K. Yamaguchi, M. Tsuneyoshi, and M. Tanaka S100P Is an Early Developmental Marker of Pancreatic Carcinogenesis. Clin. Cancer Res., September 15, 2006; 12(18): 5411 - 5416. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ohuchida, K. Mizumoto, S. Ohhashi, H. Yamaguchi, H. Konomi, E. Nagai, K. Yamaguchi, M. Tsuneyoshi, and M. Tanaka S100A11, A Putative Tumor Suppressor Gene, Is Overexpressed in Pancreatic Carcinogenesis. Clin. Cancer Res., September 15, 2006; 12(18): 5417 - 5422. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |