Clinical Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cohen, E. E.W.
Right arrow Articles by Bell, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cohen, E. E.W.
Right arrow Articles by Bell, D. W.
Clinical Cancer Research Vol. 11, 8105-8108, November 15, 2005
© 2005 American Association for Cancer Research

Cancer Therapy: Clinical

Response of Some Head and Neck Cancers to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors May Be Linked to Mutation of ERBB2 rather than EGFR

Ezra E.W. Cohen1, Mark W. Lingen1,2,3, Leslie E. Martin2, Patricia L. Harris4, Brian W. Brannigan4, Sara M. Haserlat4, Ross A. Okimoto4, Dennis C. Sgroi4,5, Sonika Dahiya4,5, Beth Muir4,5, John R. Clark4, James W. Rocco4,6, Everett E. Vokes1,3, Daniel A. Haber4 and Daphne W. Bell4

Authors' Affiliations: Departments of 1 Medicine, 2 Pathology, and 3 Radiation and Cellular Oncology, University of Chicago, Chicago, Illinois; 4 Cancer Center and 5 Department of Pathology, Massachusetts General Hospital, Charlestown, Massachusetts; and 6 Massachusetts Eye and Ear Infirmary, Boston, Massachusetts

Requests for reprints: Daniel A. Haber, Massachusetts General Hospital Cancer Center, CNY7, 149 13th Street, Charlestown, MA 02129. Phone: 617-724-7805; Fax: 617-724-6919; E-mail: haber{at}helix.mgh.harvard.edu.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Purpose: Small-molecule tyrosine kinase inhibitors (TKI) of the epidermal growth factor receptor (EGFR) have shown modest yet reproducible response rates in patients with squamous cell carcinoma of the head and neck (SCCHN). Somatic mutations in EGFR have recently been shown to be predictive of a clinical response in patients with non–small cell lung cancer (NSCLC) treated with these inhibitors. The objective of this study was to determine if such mutations, or recently reported mutations in ERBB2, also underlie EGFR-TKI responsiveness in SCCHN patients.

Experimental Design: We sequenced the kinase domain of EGFR and exon 20 of ERBB2 in tumor specimens from eight responsive patients. In addition, mutational analysis was done on tumor specimens from nine gefitinib nonresponders and 65 unselected cases of SCCHN.

Results: None of eight TKI-responsive specimens had mutations within the kinase domain of EGFR. EGFR amplification was also not associated with drug responsiveness. However, a single responsive case had a somatic missense mutation within exon 20 of ERBB2.

Conclusion: Our data indicate that unlike NSCLC, EGFR kinase mutations are rare in unselected cases of SCCHN within the United States and are not linked to gefitinib or erlotinib responses in SCCHN. Alternative mechanisms, including ERBB2 mutations, may underlie responsiveness in this tumor type.

Squamous cell carcinoma of the head and neck (SCCHN) is diagnosed annually in ~40,000 individuals in the United States (1). Despite current therapeutic modalities, as many as half these will recur, or develop metastases, and eventually succumb to their disease, highlighting the need for alternative forms of therapeutic intervention. Because epidermal growth factor receptor (EGFR: ERBB1 and HER1) is almost universally expressed in SCCHN and high levels of expression have been correlated with a poor clinical prognosis (2–6), clinical trials were undertaken to assess the efficacy of kinase inhibitors that target this growth factor, including gefitinib and erlotinib (7), reporting significant responses in up to 11% of patients refractory to other therapies (8).

Although the response rate of SCCHN to gefitinib and erlotinib is comparable with that seen in non–small cell lung cancer (NSCLC), the demographic and histologic variables associated with responsive cases differ remarkably. In lung cancer, drug responses are characteristically seen in adenocarcinomas arising in nonsmokers, with an increased frequency among women and Asians (9, 10). In contrast, responsive cases of SCCHN were indistinguishable from nonresponsive cases in terms of their histology or associated history of tobacco exposure (8).

In NSCLC, clinical responses to gefitinib or erlotinib have recently been ascribed to the presence of activating mutations within the kinase domain of EGFR (11–16). Experimentally, cells expressing these mutant receptors seem dependent upon altered survival signals transduced by these receptors, which themselves also display increased sensitivity to inhibition by gefitinib (17). Thus, at least in a subset of NSCLC, somatic mutations in EGFR seem to drive tumorigenesis and provide a biologically relevant target for therapeutic intervention. Clinically, these mutations are associated with dramatic responses to EGFR tyrosine kinase inhibitors (TKI) and may define a biological subset of NSCLC patients. To determine if this molecular mechanism extends to SCCHN, we sequenced the kinase domain of EGFR (exons 18-24) in tumors from gefitinib or erlotinib responsive cases as well as untreated cases from the United States.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Tissue samples. Tissue samples were collected from patients treated at the University of Chicago or Massachusetts General Hospital. Three groups of patient samples were analyzed: those with tumors responding to EGFR-TKI, those with tumors not responding to EGFR-TKI, and randomly selected patients not previously treated with EGFR-TKI. Samples from patients who were treated with EGFR-TKI were collected before therapy with either gefitinib (500 or 250 mg) or erlotinib (150 mg in combination with 15 mg/kg bevacizumab; Table 1). The Response Evaluation Criteria in Solid Tumors were used to evaluate response in all cases. Consent to obtain, store, and analyze tissue was obtained on all patients according to institutional review board guidelines.


View this table:
[in this window]
[in a new window]

  		Table 1. Characteristics of patients on EGFR inhibitor clinical trials who demonstrated an objective response

 
Mutational analysis of EGFR and ERBB2. H&E-stained sections of formalin-fixed, paraffin-embedded tissue or of snap-frozen tissue were reviewed by a pathologist to estimate the overall tumor cell content. In cases where tumor cells comprised <70% of the tissue, laser capture microdissection was employed to isolate a homogenous tumor cell population. DNA was isolated by standard phenol-chloroform extraction and ethanol precipitated using glycogen as a carrier followed by resuspension in 30 µL TE buffer.

Exons 18 to 24 of EGFR and exon 20 of ERBB2 were amplified using nested PCR consisting of an initial primary PCR followed by a secondary PCR. Primer pairs (sense and antisense) used in the initial amplification of EGFR were as follows: exon 18, CAAGTGCCGTGTCCTGGCACCCAAGC and CCAAACACTCAGTGAAACAAAGAG; exon 19, GCAATATCAGCCTTAGGTGCGGCTC and CATAGAAAGTGAACATTTAGGATGTG; exon 20, CCATGAGTACGTATTTTGAAACTC and CATATCCCCATGGCAAACTCTTGC; exon 21, CTAACGTTCGCCAGCCATAAGTCC and GCTGCGAGCTCACCCAGAATGTCTGG; exon 22, GAGCAGCCCTGAACTCCGTCAGACTG and CTCAGTACAATAGATAGACAGCAATG; exon 23, CAGGACTACAGAAATGTAGGTTTC and GTGCCTGCCTTAAGTAATGTGATGAC; exon 24, GACTGGAAGTGTCGCATCACCAATG and GGTTTAATAATGCGATCTGGGACAC. The primer pair (CTGTGGGCCATGGCT GTGGTTTG and GGAATGGGAAGCACCCATGTAGACC) was used in an initial amplification of exon 20 of ERBB2. Primary reactions contained 2 µL genomic DNA as a template in a 25-µL reaction consisting of 1x buffer, 50 µmol/L deoxynucleotide triphosphate, 200 nmol/L sense primer, 200 nmol/L antisense primer, and 0.8 unit Expand Taq (Roche Diagnostics, Mannheim, Germany).

Nested primers pairs used in secondary amplification of EGFR were exon 18, GCACCCAAGCCCATGCCGTGGCTGC and GAAACAAAGAGTAAAGTAGATGATGG; exon 19 CCTTAGGTGCGGCTCCACAGC and CATTTAGGATGTGGAGATGAGC; exon 20, GAAACTCAAGATCGCATTCATGC and GCAAACTCTTGCTATCCCAGGAG; exon 21, CAGCCATAAGTCCTCGACGTGG and CATCCTCCCC TGCATGTGTTAAAC; exon 22, GACGGGTCCTGGGGTGATCTGGCTC and CTCAGTACAATAGATAGACAGCAATG; exon 23, GTAGGTTTCTAAACATCAAGAAAC and GTGATGACATTTCTCCAGGGATGC; exon 24, CATCACCAATGCCTTCTTTAAGC and GCTGGAGGGTTTAATAATGCGATC. Exon 20 of ERBB2 was amplified using nested primers CTGTGGGCCATGGCTGTGGTTTG and GGAAGCACCCATGTAGACCTTCTGG. Nested reactions contained 2 µL primary PCR product as a template in a 25-µL reaction consisting of 1x buffer, 50 µmol/L deoxynucleotide triphosphate, 200 nmol/L sense primer, 200 nmol/L antisense primer, and 0.8 unit Expand Taq (Roche Diagnostics). Cycling conditions for both primary and secondary PCR reactions were 95°C for 15 minutes followed by 40 cycles consisting of 95°C for 30 seconds, 58°C for 30 seconds, 72°C for 45seconds followed by 72°C for 5 minutes. PCR amplicons were purified using exonuclease I (U.S. Biochemical, Cleveland, OH) and shrimp alkaline phosphatase (U.S. Biochemical) and diluted in water before bidirectional capillary sequencing, which was done using BigDye Terminator v1.1 chemistry (Applied Biosystems, Foster City, CA) in combination with an ABI3100 instrument according to the manufacturer's instructions. Electropherograms were aligned and reviewed using Sequence Navigator software.

Determination of EGFR copy number. EGFR copy number was determined by Taqman real-time quantitative PCR with Taqman Universal PCR mastermix and an ABI Prism 7900HT sequence detection system (Applied Biosystems). The primers (5'-3') and fluorogenic probe used for EGFR were CAATTGCCAGTTAACGTCTTCCTT (sense primer), TTTCTCACCTTCTGGGATCCA (antisense primer), and TCTCTCTGTCATAGGGAC (probe). For the control gene, PCDH7, these were GCTGCAATCTCCTCCCTGAA (sense primer), TGCCTTTTCTCACCTGCATTC (antisense primer), and CCACTGCTCCGACATG (probe).


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
The kinase domain of EGFR (exons 18-24) was sequenced in tumors from eight gefitinib or erlotinib responsive cases of SCCHN (Table 1) treated at the University of Chicago (seven cases) or at Massachusetts General Hospital (one case). Of these, two cases had a complete response, and others had partial responses. We also sequenced the EGFR kinase domain in nine tumors from gefitinib nonresponders. No somatic mutations were detected in any of these TKI-treated cases of SCCHN (Table 2). To determine whether such mutations are present in unselected cases of SCCHN, we genotyped 50 cases of characteristic SCCHN cancers from the Massachusetts Eye and Ear Infirmary tumor bank and an additional 15 cases of SCCHN arising in never smokers (Table 2). None of these cases had detectable mutations within the kinase domain of EGFR. Given the recent report of EGFR gene amplification in some NSCLC cases responsive to gefitinib (18), as well as the occurrence of EGFR amplification in a subset of untreated cases (19, 20), we also determined the copy number of EGFR in treated SCCHN cases using quantitative PCR. No amplification of EGFR was detected among five responsive cases, whereas a single nonresponsive case had low level (2- to 4-fold) amplification (data not shown).


View this table:
[in this window]
[in a new window]

  		Table 2. Number of cases analyzed from each clinical cohort

 
In addition to specific mutations in the kinase domain of EGFR, similar mutations have recently been reported in the related growth factor ERBB2 (HER2) within a subset of NSCLC (21, 22). ERBB2 heterodimerizes with EGFR, such that inhibition of EGFR kinase activity by TKI is expected to reduce ERBB2-dependent signaling. Furthermore, although both gefitinib and erlotinib have high specificity for EGFR, they also exhibit some in vitro activity towards ERBB2 (gefitinib IC50 = 3,700 nmol/L; erlotinib IC50 = 350 nmol/L). We therefore tested for mutations in the reported ERBB2 hotspot (exon 20) in our cohort of TKI-responsive cases of SCCHN. Of four evaluable cases of responsive SCCHN, one (case 2, treated with gefitinib 500 mg oral dose) harbored a heterozygous mutation within ERBB2, which was not present in surrounding normal stromal tissue (Fig. 1). The variant resulted in a nucleotide alteration from T to C at position 2318 leading to an amino acid substitution of alanine for valine at codon 773. Importantly, this residue forms part of the recurrent insertions (ins774AYVM and ins776YVMA) previously described in untreated NSCLC (21, 22), raising the possibility that such mutations may be linked to EGFR-TKI responsiveness. No somatic mutations of ERBB2 were identified in tumors from nine unresponsive SCCHN cases (P = 0.307) or among 56 untreated cases resected from smokers (50 cases) or never smokers (six cases).



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Mutation of ERBB2 within a gefitinib-responsive tumor. A single base substitution of C for T at nucleotide 2318 (arrow) leads to an amino acid substitution of alanine for valine at codon 773 in the tumor from case 2. A wild-type sequence is shown for comparison.

 

   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
We have found that neither EGFR kinase domain mutations nor gene amplification explain the response of a subset of SCCHN to erlotinib and gefitinib, and that EGFR mutations are rare among cases of SCCHN within the U.S. population. While this work was in progress, Lee et al. reported the presence of EGFR kinase domain mutations in ~7% of unselected cases of SCCHN from Korea (23). The fact that we did not observe such mutations among 65 cases of unselected SCCHN from the United States, 17 cases of patients treated with EGFR-TKI, nor among seven SCCHN cell lines reported previously (11), suggests that the frequency of EGFR mutations in SCCHN cancer may differ among ethnic groups. Such a difference in the prevalence of EGFR mutations between East Asian and European populations is now well established for NSCLC (12, 14–16, 24–26), and its extension to SCCHN is of considerable interest in searching for genetic and environmental risk factors. It will be important to determine whether EGFR mutations in Eastern Asian SCCHN patients are associated with response to EGFR-TKIs.

Our findings further suggest that ERBB2 mutations may be linked to EGFR-TKI sensitivity in at least some of these responsive cases. Although ERBB2 mutations within this region of the gene have been described in NSCLC their functional relevance to gefitinib or erlotinib responsiveness, or dual inhibitors of EGFR/ERBB2, such as lapatinib or HKI-272, has not yet been evaluated. This observation has clinical significance, as EGFR mutational testing enters the clinical arena as a predictor of therapeutic response to TKI in lung cancer. Alternative mechanisms must be sought to explain the majority of responses in SCCHN.

The absence of EGFR mutations in TKI-responsive SCCHN studied here is perhaps not surprising, given the unique subset of lung cancers defined by such mutations (i.e., adenocarcinomas arising in never smokers), with apparent modulation by both sex and ethnic factors (11–16, 24–26). In our study, no such distinct phenotype was evident in responsive cases of SCCHN. In this context, it is interesting to note that a dose-response effect for gefitinib may exist in SCCHN cancers (response rates of 1% in a study using 250-mg daily dosing, versus 11% in a second study using a 500-mg dose; refs. 8, 27). Thus, in contrast to the exquisite sensitivity of tumors with mutant EGFR to gefitinib and the absence of different responses at these two doses (9, 10), inhibition of EGFR-dependent signaling even in responsive cases of SCCHN may require higher drug levels.

In conclusion, we note that most SCCHN cases responsive to gefitinib or erlotinib do not seem to have mutations in EGFR or ERBB2, as does a small subset of responsive NSCLC. Further studies are required to determine whether a unifying molecular mechanism may underlie TKI responsiveness in such cases and potentially in other tumor types where occasional gefitinib and erlotinib responses have been reported.


   Acknowledgments
 
We thank Janet Dancey, M.D. for her assistance in conducting the clinical trials and Cyndy Bajda and Rosalyn Williams for their assistance with data management.


   Footnotes
 
Grant support: National Cancer Institute/NIH federal funds under contract nos. N01-CM-17102 and P30-CA14599-30 (clinical trials from which tissue samples were derived), University of Chicago Cancer Research Center, AstraZeneca Pharmaceuticals, grant PO1 95281 (D.W. Bell and D.A. Haber), and Doris Duke Charitable Foundation (D.A. Haber).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 4/29/05; revised 6/20/05; accepted 8/23/05.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jemal A, Tiwari RC, Murray T, et al. Cancer statistics, 2004. CA Cancer J Clin 2004;54:8–29.[Abstract/Free Full Text]
  2. Grandis JR, Tweardy DJ. TGF-{alpha} and EGFR in head and neck cancer. J Cell Biochem 1993;17F:188–91.[CrossRef]
  3. Ang KK, Berkey BA, Tu X, et al. Impact of epidermal growth factor receptor expression on survival and pattern of relapse in patients with advanced head and neck carcinoma. Cancer Res 2002;62:7350–6.[Abstract/Free Full Text]
  4. Chen BK, Ohtsuki Y, Furihata M, et al. Co-overexpression of p53 protein and epidermal growth factor receptor in human papillary thyroid carcinomas correlated with lymph node metastasis, tumor size and clinicopathologic stage. Int J Oncol 1999;15:893–8.[Medline]
  5. Rubin Grandis J, Melhem MF, Gooding WE, et al. Levels of TGF-{alpha} and EGFR protein in head and neck squamous cell carcinoma and patient survival. J Natl Cancer Inst 1998;90:824–32.[Abstract/Free Full Text]
  6. Etienne MC, Pivot X, Formento JL, et al. A multifactorial approach including tumoural epidermal growth factor receptor, p53, thymidylate synthase and dihydropyrimidine dehydrogenase to predict treatment outcome in head and neck cancer patients receiving 5-fluorouracil. Br J Cancer 1999;79:1864–9.[CrossRef][Medline]
  7. Cohen EE, Lingen MW, Vokes EE. The expanding role of systemic therapy in head and neck cancer. J Clin Oncol 2004;22:1743–52.[Abstract/Free Full Text]
  8. Cohen EE, Rosen F, Stadler WM, et al. Phase II trial of ZD1839 in recurrent or metastatic squamous cell carcinoma of the head and neck. J Clin Oncol 2003;21:1980–7.[Abstract/Free Full Text]
  9. Kris MG, Natale RB, Herbst RS, et al. Efficacy of gefitinib, an inhibitor of the epidermal growth factor receptor tyrosine kinase, in symptomatic patients with non-small cell lung cancer: a randomized trial. JAMA 2003;290:2149–58.[Abstract/Free Full Text]
  10. Fukuoka M, Yano S, Giaccone G, et al. Multi-institutional randomized phase II trial of gefitinib for previously treated patients with advanced non-small-cell lung cancer. J Clin Oncol 2003;21:2237–46.[Abstract/Free Full Text]
  11. Lynch TJ, Bell DW, Sordella R, et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004;350:2129–39.[Abstract/Free Full Text]
  12. Paez JG, Janne PA, Lee JC, et al. EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 2004;304:1497–500.[Abstract/Free Full Text]
  13. Pao W, Miller V, Zakowski M, et al. EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 2004;101:13306–11.[Abstract/Free Full Text]
  14. Huang SF, Liu HP, Li LH, et al. High frequency of epidermal growth factor receptor mutations with complex patterns in non-small cell lung cancers related to gefitinib responsiveness in Taiwan. Clin Cancer Res 2004;10:8195–203.[Abstract/Free Full Text]
  15. Tokumo M, Toyooka S, Kiura K, et al. The relationship between epidermal growth factor receptor mutations and clinicopathologic features in non-small cell lung cancers. Clin Cancer Res 2005;11:1167–73.[Abstract/Free Full Text]
  16. Mitsudomi T, Kosaka T, Endoh H, et al. Mutations of the epidermal growth factor receptor gene predict prolonged survival after gefitinib treatment in patients with non-small-cell lung cancer with postoperative recurrence. J Clin Oncol 2005;11:1–8.
  17. Sordella R, Bell DW, Haber DA, Settleman J. Gefitinib-sensitizing EGFR mutations in lung cancer activate anti-apoptotic pathways. Science 2004;305:1163–7.[Abstract/Free Full Text]
  18. Amann J, Kalyankrishna S, Massion PP, et al. Aberrant epidermal growth factor receptor signaling and enhanced sensitivity to EGFR inhibitors in lung cancer. Cancer Res 2005;65:226–35.[Abstract/Free Full Text]
  19. Weichselbaum RR, Dunphy EJ, Beckett MA, et al. Epidermal growth factor receptor gene amplification and expression in head and neck cancer cell lines. Head Neck 1989;11:437–42.[Medline]
  20. Rikimaru K, Tadokoro K, Yamamoto T, Enomoto S, Tsuchida N. Gene amplification and overexpression of epidermal growth factor receptor in squamous cell carcinoma of the head and neck. Head Neck 1992;14:8–13.[CrossRef][Medline]
  21. Stephens P, Hunter C, Bignell G, et al. Lung cancer: intragenic ERBB2 kinase mutations in tumours. Nature 2004;431:525–6.
  22. Shigematsu H, Takahashi T, Nomura M, et al. Somatic mutations of the HER2 kinase domain in lung adenocarcinomas. Cancer Res 2005;65:1642–6.[Abstract/Free Full Text]
  23. Lee JW, Soung YH, Kim SY et al. Somatic mutations of EGFR gene in squamous cell carcinoma of the head and neck. Clin Cancer Res 2005;11:2879–82.[Abstract/Free Full Text]
  24. Kosaka T, Yatabe Y, Endoh H, Kuwano H, Takahashi T, Mitsudomi T. Mutations of the epidermal growth factor receptor gene in lung cancer: biological and clinical implications. Cancer Res 2004;64:8919–23.[Abstract/Free Full Text]
  25. Marchetti A, Martella C, Felicioni L, et al. EGFR mutations in non-small-cell lung cancer: analysis of a large series of cases and development of a rapid and sensitive method for diagnostic screening with potential implications on pharmacologic treatment. J Clin Oncol 2005;23:857–65.[Abstract/Free Full Text]
  26. Shigematsu H, Lin L, Takahashi T, et al. Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers. J Natl Cancer Inst 2005;97:339–46.[Abstract/Free Full Text]
  27. Kane MA, CE M, List B, et al. Phase II study of 250 mg gefitinib in advanced squamous cell carcinoma of the head and neck (SCCHN). In ASCO, Vol. 22. New Orleans: ASCO, 2004.



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
K. Yonesaka, K. Zejnullahu, N. Lindeman, A. J. Homes, D. M. Jackman, F. Zhao, A. M. Rogers, B. E. Johnson, and P. A. Janne
Autocrine Production of Amphiregulin Predicts Sensitivity to Both Gefitinib and Cetuximab in EGFR Wild-type Cancers
Clin. Cancer Res., November 1, 2008; 14(21): 6963 - 6973.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
T. Trowe, S. Boukouvala, K. Calkins, R. E. Cutler Jr., R. Fong, R. Funke, S. B. Gendreau, Y. D. Kim, N. Miller, J. R. Woolfrey, et al.
EXEL-7647 Inhibits Mutant Forms of ErbB2 Associated with Lapatinib Resistance and Neoplastic Transformation
Clin. Cancer Res., April 15, 2008; 14(8): 2465 - 2475.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
U. McDermott, S. V. Sharma, L. Dowell, P. Greninger, C. Montagut, J. Lamb, H. Archibald, R. Raudales, A. Tam, D. Lee, et al.
Identification of genotype-correlated sensitivity to selective kinase inhibitors by using high-throughput tumor cell line profiling
PNAS, December 11, 2007; 104(50): 19936 - 19941.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
F. Thomas, P. Rochaix, A. Benlyazid, J. Sarini, M. Rives, J. L. Lefebvre, B. C. Allal, F. Courbon, E. Chatelut, and J.-P. Delord
Pilot Study of Neoadjuvant Treatment with Erlotinib in Nonmetastatic Head and Neck Squamous Cell Carcinoma
Clin. Cancer Res., December 1, 2007; 13(23): 7086 - 7092.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. Mounawar, A. Mukeria, F. Le Calvez, R. J. Hung, H. Renard, A. Cortot, C. Bollart, D. Zaridze, P. Brennan, P. Boffetta, et al.
Patterns of EGFR, HER2, TP53, and KRAS Mutations of p14arf Expression in Non-Small Cell Lung Cancers in Relation to Smoking History
Cancer Res., June 15, 2007; 67(12): 5667 - 5672.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
S. Temam, H. Kawaguchi, A. K. El-Naggar, J. Jelinek, H. Tang, D. D. Liu, W. Lang, J.-P. Issa, J. J. Lee, and L. Mao
Epidermal Growth Factor Receptor Copy Number Alterations Correlate With Poor Clinical Outcome in Patients With Head and Neck Squamous Cancer
J. Clin. Oncol., June 1, 2007; 25(16): 2164 - 2170.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
J. B. Vermorken, J. Trigo, R. Hitt, P. Koralewski, E. Diaz-Rubio, F. Rolland, R. Knecht, N. Amellal, A. Schueler, and J. Baselga
Open-Label, Uncontrolled, Multicenter Phase II Study to Evaluate the Efficacy and Toxicity of Cetuximab As a Single Agent in Patients With Recurrent and/or Metastatic Squamous Cell Carcinoma of the Head and Neck Who Failed to Respond to Platinum-Based Therapy
J. Clin. Oncol., June 1, 2007; 25(16): 2171 - 2177.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
B. A. Frederick, B. A. Helfrich, C. D. Coldren, D. Zheng, D. Chan, P. A. Bunn Jr., and D. Raben
Epithelial to mesenchymal transition predicts gefitinib resistance in cell lines of head and neck squamous cell carcinoma and non-small cell lung carcinoma
Mol. Cancer Ther., June 1, 2007; 6(6): 1683 - 1691.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
F. Perrone, S. Suardi, E. Pastore, P. Casieri, M. Orsenigo, S. Caramuta, G. Dagrada, M. Losa, L. Licitra, P. Bossi, et al.
Molecular and Cytogenetic Subgroups of Oropharyngeal Squamous Cell Carcinoma.
Clin. Cancer Res., November 15, 2006; 12(22): 6643 - 6651.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
C. H. Chung, K. Ely, L. McGavran, M. Varella-Garcia, J. Parker, N. Parker, C. Jarrett, J. Carter, B. A. Murphy, J. Netterville, et al.
Increased Epidermal Growth Factor Receptor Gene Copy Number Is Associated With Poor Prognosis in Head and Neck Squamous Cell Carcinomas
J. Clin. Oncol., September 1, 2006; 24(25): 4170 - 4176.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
E. L. Kwak, J. Jankowski, S. P. Thayer, G. Y. Lauwers, B. W. Brannigan, P. L. Harris, R. A. Okimoto, S. M. Haserlat, D. R. Driscoll, D. Ferry, et al.
Epidermal growth factor receptor kinase domain mutations in esophageal and pancreatic adenocarcinomas.
Clin. Cancer Res., July 15, 2006; 12(14): 4283 - 4287.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
K. Erjala, M. Sundvall, T. T. Junttila, N. Zhang, M. Savisalo, P. Mali, J. Kulmala, J. Pulkkinen, R. Grenman, and K. Elenius
Signaling via ErbB2 and ErbB3 Associates with Resistance and Epidermal Growth Factor Receptor (EGFR) Amplification with Sensitivity to EGFR Inhibitor Gefitinib in Head and Neck Squamous Cell Carcinoma Cells.
Clin. Cancer Res., July 1, 2006; 12(13): 4103 - 4111.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
E. E.W. Cohen
Role of Epidermal Growth Factor Receptor Pathway-Targeted Therapy in Patients With Recurrent and/or Metastatic Squamous Cell Carcinoma of the Head and Neck
J. Clin. Oncol., June 10, 2006; 24(17): 2659 - 2665.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cohen, E. E.W.
Right arrow Articles by Bell, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cohen, E. E.W.
Right arrow Articles by Bell, D. W.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online