Clinical Cancer Research Versailles No Abst AACR Membership
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshiura, K.
Right arrow Articles by Yamashita, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshiura, K.
Right arrow Articles by Yamashita, N.
Clinical Cancer Research Vol. 11, 8201-8207, November 15, 2005
© 2005 American Association for Cancer Research


Cancer Therapy: Preclinical

Carbonic Anhydrase II Is a Tumor Vessel Endothelium–Associated Antigen Targeted by Dendritic Cell Therapy

Kenta Yoshiura1, Takashi Nakaoka1, Toshihide Nishishita1, Katsuaki Sato7, Akifumi Yamamoto5, Shinji Shimada8, Toshiaki Saida9, Yutaka Kawakami6, Tsuneo A. Takahashi3, Hiroyuki Fukuda4, Shinobu Imajoh-Ohmi4, Naoki Oyaizu2 and Naohide Yamashita1

Authors' Affiliations: 1 Departments of Advanced Medical Science and 2 Laboratory Medicine and Divisions of 3 Cell Processing and 4 Molecular Biology, Institute of Medical Science, University of Tokyo; 5 Division of Dermatology, National Cancer Center, Central Hospital; 6 Division of Cellular Signaling, The Institute of Advanced Medical Science, Keio University School of Medicine, Tokyo, Japan; 7 Laboratory for Dendritic Cell Immunobiology, Research Center for Allergy and Immunology, RIKEN Yokohama Institute, Kanagawa, Japan; 8 Department of Dermatology, Yamanashi Medical University, Yamanashi, Japan; and 9 Department of Dermatology, Shinshu University School of Medicine, Matsumoto, Japan

Requests for reprints: Kenta Yoshiura, Department of Advanced Medical Science, Institute of Medical Science, University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan. Phone: 81-3-5449-5772; Fax: 81-3-5449-5456; E-mail: yoshiura-gi{at}umin.ac.jp.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Tumor-associated antigens are promising candidates as target molecules for immunotherapy and a wide variety of tumor-associated antigens have been discovered through the presence of serum antibodies in cancer patients. We previously conducted dendritic cell therapy on 10 malignant melanoma patients and shrinkage or disappearance of metastatic tumors with massive necrosis occurred in two patients. In this study, we found a 29-kDa protein against which antibody was elicited by dendritic cell therapy in one of the two patients. Matrix-assisted laser desorption ionization-time of flight/mass spectrometry analysis of the protein isolated by two-dimensional electrophoresis combined with Western blots revealed that the 29-kDa protein was carbonic anhydrase II (CA-II). Immunohistochemistry of the tumors and normal tissues showed that CA-II was expressed in the tumor vessel but not in normal vessel endothelium. CA-II expression in tumor endothelium was observed as well in other cancers including esophageal, renal, and lung cancers. In an in vitro angiogenesis model, CA-II expression of normal human vein endothelial cells was significantly up-regulated when cells were cultured in the acidic and hypoxic conditions indicative of a tumor environment. These findings suggest that CA-II is a tumor vessel endothelium–associated antigen in melanoma and other cancers, and elicitation of serum anti–CA-II antibody by dendritic cell therapy may be associated with good clinical outcome including tumor reduction.


Cancer immunotherapy makes use of the host immune response against tumor-associated antigens (TAA), some of which are mutated and others overexpressed in a tumor-specific manner. Identification of TAAs that elicit an efficient immune response is crucial in improving the quality of immunotherapy (13).

The TAAs of melanoma are generally classified into the following groups according to expression pattern: tumor-specific mutated antigens such as ß-catenin (4); cancer-testis antigens such as MAGE-1 (5), HOM-MEL-40 (6), and NY-ESO-1 (7); and differentiation antigens such as tyrosinase (8). Although cancer vaccines using peptides of TAAs such as tyrosinase, MART-1, and NY-ESO-1 have been developed, their effects have been less than satisfactory thus far (9).

We previously conducted dendritic cell therapy on 10 melanoma patients and remarkable tumor reductions were observed in two patients. We then aimed to identify some of the unique antigens targeted by dendritic cell therapy in these patients. To identify the target antigens, we employed two-dimensional electrophoresis combined with Western blots analysis and matrix-assisted laser desorption ionization-time of flight/mass spectrometry (MALDI-TOF/MS) methods. Through this strategy, carbonic anhydrase II (CA-II) was identified as an antigen that elicited serum antibody response to dendritic cell therapy in the patient. To our knowledge, this is the first report showing the presence of serum anti–CA-II antibody in cancer patients although it has been reported that the antibody is prevalent in some autoimmune diseases (10). In this study, we also did the immunohistochemistry of CA-II in various cancer specimens and found that CA-II was expressed in tumor vessel endothelium. Taken together with the data of mRNA assay for CA-II in an in vitro angiogenesis model, we suggest that CA-II is a tumor vessel endothelium–associated antigen and discuss the relevance of this antigen in cancer immunotherapy.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Patients. Ten malignant melanoma patients were treated by dendritic cell therapy at our department from 2000 until 2002. The detailed protocol and results of the therapy are described elsewhere (11). In brief, dendritic cells were prepared by culturing autologous monocytes with granulocyte-macrophage colony-stimulating factor and interleukin-4, followed by pulsation with autologous tumor lysate combined with tumor necrosis factor {alpha}. All of the patients died by the end of 2002 and no one had manifested a complete response in accordance with the WHO criteria on solid tumors (12). However, three patients had shown favorable clinical outcomes to dendritic cell therapy. Specifically, shrinkage or disappearance of multiple metastatic tumors with massive necrosis occurred during the therapy in patients 8 and 9 and tumor growth ceased for 4 months after the therapy in patient 6 (stable disease condition).

Tumor specimens and the frozen sera were stored at –80°C and –20°C, respectively, until use. Pre-therapy serum samples were collected within 1 month before therapy and post-therapy serum samples were collected between 2 and 12 months after initiating therapy, depending on the survival period. As controls, sera of 10 melanoma patients who had not undergone dendritic cell therapy and sera of six thyroid cancer patients who had undergone dendritic cell therapy at our department were employed. Normal blood and serum were provided by healthy volunteers. Informed consent for enrollment in this study was obtained from each subject and the use of materials was approved by the Institutional Review Board of the Institute of Medical Science, University of Tokyo.

Cell lines, chemicals, and antibodies. Five melanoma cell lines, CRL1579, G361, HMV-I, HMV-II, and SK-MEL-28, were provided by Cell Resource Center for Biomedical Research, Tohoku University (Sendai, Japan). Culture media were DMEM (Invitrogen, Carlsbad, CA) for HMV-I and HMV-II, RPMI 1640 for G361 and CRL1579, and Eagle's MEM for SK-MEL-28 cells. All media were supplemented with 10% fetal bovine serum (Thermo Trace Ltd., Melbourne, Australia).

Purified human CA-II (Sigma-Aldrich, St. Louis, MO) and rabbit anti-human CA-II antibody (Chemicon International, Inc., Temecula, CA) were purchased.

Preparation of cell lysate. The frozen tumor block was homogenized in PBS supplemented with proteinase inhibitor cocktail (Complete Mini, Roche Diagnostics, Mannheim, Germany) and 5 mmol/L iodoacetamide using a Polytron homogenizer and centrifuged at 2,000 x g for 10 minutes. The pellet was incubated in lysis buffer [20 mmol/L Tris-HCl (pH 8), 140 mmol/L sodium chloride, 2% Triton X-100, 1% sodium deoxycholate, 5 mmol/L iodoacetamide, Complete Mini protein inhibitor cocktail] by rotating for 2 hours at 4°C. The supernatant after centrifuging for 1 hour at 18,000 x g and 4°C was then harvested and stored at –80°C.

Freshly drawn blood was mixed with 5 mmol/L EDTA and fractionated by centrifugation with Ficoll-Paque Plus (Amersham Biosciences, Uppsala, Sweden). Erythrocyte membrane (ghosts) and cytoplasmic fraction were separated by hemolysis in 5 mmol/L sodium phosphate (pH 8) and centrifugation (13). To obtain an erythrocyte cytoplasmic 10- to 50-kDa protein fraction, the hemolytic solution was filtered using a filtration device limiting 50-kDa protein (Centriplus YM-50, Millipore, Bedford, MA) and the filtrate was concentrated using a filtration device limiting 10-kDa protein (Centriplus and Microcon YM-10, Millipore).

Electrophoresis and Western blots. Conventional SDS-PAGE was done based on the method of Laemmli (14). After electrophoresis, the gel was blotted on Protran nitrocellulose membrane (Schleicher & Schuell, Dassel, Germany). The membrane was incubated with blocking buffer composed of TBS-T [20 mmol/L Tris-HCl (pH 7.6), 137 mmol/L sodium chloride, 0.05% polyoxyethylenesorbitan monolaurate] supplemented with 5% skim milk for 2 hours at room temperature. To detect serum reactivity, the membrane was incubated with serum diluted in blocking buffer for 2 hours at room temperature, followed by incubation with horseradish peroxidase–conjugated antihuman immunoglobulin G Fc portion antibody (Sigma-Aldrich). The signal was detected by using enhanced chemiluminescence system (Amersham Pharmacia Biotech UK, Buckinghamshire, United Kingdom).

For two-dimensional electrophoresis analysis, protein samples were prepared in 8.5 mol/L urea, 2% NP40, 2% Ampholine (Amersham Pharmacia Biotech AB, Uppsala, Sweden), and 5% 2-mercaptoethanol. Isoelectric electrophoresis was done using immobilized pH gradient tube gel (Daiichi Kagaku, Tokyo, Japan) according to the instruction of the manufacturer. After electrophoresis, the gel was soaked in an equilibration buffer [125 mmol/L Tris-HCl (pH 6.8), 4.3% SDS, 10% 2-mercaptoethanol, 0.01% bromophenol blue, 30% glycerol] and loaded on polyacrylamide slab gel (Daiichi Kagaku). After electrophoresis, the gel was stained with Coomassie brilliant blue R-250 (ICN Biomedicals, Aurora, OH) or blotted on nitrocellulose membrane followed by Western blots as described above.

Protein identification. Spots of Coomassie brilliant blue–stained gel corresponding to positive spots on the Western blot were cut out and decolorized in a solution of 50 mmol/L ammonium hydrogen carbonate and 50% methanol and were subjected to reduction in a mixture of 10 mmol/L DTT and 0.1 mol/L ammonium hydrogen carbonate, followed by alkylation in a mixture of 40 mmol/L iodoacetamide and 0.1 mol/L ammonium hydrogen carbonate. Subsequently, the gel was incubated in 50 nmol/L trypsin for 14 hours at 37°C and digested peptides were subjected to the 4700 Proteomics Analyzer MALDI-TOF/MS (Applied Biosystems, Foster City, CA). Protein identification was carried out using the Mascot Search system (Matrix Science, London, United Kingdom).

Immunohistochemistry. Immunohistochemical staining of tissue sections with anti–CA-II antibody was done using a peroxidase technique. Briefly, deparaffinized sections of formalin-fixed, paraffin-embedded tissues were heated in 10 mmol/L citrate buffer (pH 7.0) at 95°C for 30 minutes for antigen retrieval. After washing, sections were treated by H2O2 solution to quench endogenous peroxidase activity followed by blocking reagent (K5006, DakoCytomation Japan, Kyoto, Japan) to block nonspecific binding sites. The sections were then incubated with primary antibody at a dilution of 1:4,000 for 45 minutes at room temperature. DAKO Envision system (EnVision+, peroxidase, rabbit, DakoCytomation) was used for the detection of immune complexes.

In vitro angiogenesis model. Human umbilical vein endothelial cells (HUVEC; Clonetics, San Diego, CA) were normally cultured in endothelial growth medium (Clonetics) containing 2% fetal bovine serum at 37°C under atmospheric conditions of 95% air and 5% CO2. To make an in vitro angiogenesis model, the wells of a six-well tissue culture plate were coated with Matrigel basement membrane matrix (BD Biosciences, Bedford, MA). HUVECs (2 x 105) were seeded in a Matrigel-coated well and cultured in experimental conditions for 18 hours. Cells were harvested with Cell Recovery Solution (BD Biosciences) and subjected to reverse transcription-PCR assay.

Quantitative reverse transcription-PCR. Total RNA was extracted from tumors or cultured cells using Trizol (Invitrogen). First-strand cDNA was transcribed from total RNA using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). Real-time PCR was done using QuantiTect SYBR Green PCR kit (Qiagen, Hilden, Germany) and iCycler (Bio-Rad) with 45cycles of 94°C for 30 seconds, 56°C for 30 seconds, and 72°C for 30 seconds. One microgram of total RNA was subjected to reverse transcription reaction in a 20-µL solution and a 1-µL aliquot after the reaction was used in the subsequent real-time PCR. The primers for CA-II were caatggtcatgctttcaacg and tccatcaagtgaaccccagt and those for glyceraldehyde-3-phosphate dehydrogenase were gctcatttcctggtatgacaac and ttcctcttgtgctcttgctg. The quantity of CA-II mRNA copies relative to glyceraldehyde-3-phosphate dehydrogenase (internal control) was calculated on the basis of standard reactions.

Statistical analysis. The correlation between two factors was evaluated by using the {chi}2 analysis. The nonparametric Mann-Whitney U test was used to evaluate any significant differences between two groups. P < 0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
29-kDa antigen eliciting serum antibody. To identify the serum antibodies augmented after dendritic cell therapy in patient 9 who experienced massive tumor necrosis following therapy as was described in Materials and Methods, tumor lysate from the patient was subjected to Western blots with the autologous sera of pre- and post-therapy (6 months after the start point). As depicted in Fig. 1A, a 29-kDa band appeared only in the post-therapy sample whereas 47-kDa bands were detected in both the pre- and post-therapy sera. We then aimed to identify the 29-kDa antigen, a possible target of dendritic cell therapy. We tried to separate the tumor lysate by two-dimensional electrophoresis followed by Western blots with the serum but it was difficult to obtain the 29-kDa protein purely and abundantly enough for subsequent MALDI-TOF/MS analysis. Therefore, we searched the 29-kDa protein in melanoma cell lines, HUVECs, and blood cells by Western blots with the serum and found that the 29-kDa protein was abundant in cytoplasmic fraction of erythrocytes (data not shown).



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. A, Western blots of tumor lysate from patient 9 with the autologous sera at pre-therapy and post-therapy. Size of the bands is indicated on the left. The 29-kDa band was detected only in the post-therapy but not in the pre-therapy serum. B, Coomassie brilliant blue–stained two-dimensional electrophoresis gel of an erythrocyte cytoplasmic 10- to 50-kDa protein fraction and the corresponding Western blot. Three positive spots on the Western blot with the post-therapy serum of patient 9 are indicated on the gel. C, Western blots of tumor lysate from patient 9 along with purified CA-II with the post-therapy serum of patient 9, the same serum precleared by purified CA-II, and anti–CA-II antibody. D, Western blots of human CA-II with the post-therapy serum of patient 9. One microgram of purified CA-II was loaded and blotted with the serum at indicated dilutions. The band was detected at a serum dilution of 1:400. E, Western blots of CA-II with the patients' sera. Results of six patients with a positive antibody response at a serum dilution of 1:100. In each patient, pre-therapy serum (lane 1) and post-therapy serum (lane 2) were analyzed. Serum dilution factor is indicated on the left. N, normal serum.

 
Two-dimensional electrophoresis and matrix-assisted laser desorption ionization-time of flight/mass spectrometry. The 29-kDa protein was isolated from erythrocytes as follows. After hemolysis and removal of membranes (ghosts), the hemolytic solution was size fractionated to collect a 10- to 50-kDa protein fraction so that the sample did not contain any hemoglobin {alpha}2ß2 tetramer (68 kDa), the isomers of which would cause contamination in degenerative electrophoresis. The fraction was subjected to two-dimensional electrophoresis followed by Western blots with the post-therapy serum of patient 9. Three positive spots at 29 kDa, which similarly reacted with the serum, were detected (Fig. 1B). These three spots of the Coomassie brilliant blue–stained gel (Fig. 1B) were separately retrieved and analyzed by MALDI-TOF/MS. As a result, the three spots were revealed to represent the same protein, CA-II. MS data for spot 1 are shown in Table 1. The reason for the differences in isoelectric point among these three was unclear. To confirm that the 29-kDa protein in the lysate recognized by the serum is CA-II, tumor lysate and purified CA-II were loaded in parallel on SDS-PAGE and Western blotting with the post-therapy serum, the same serum precleared by purified CA-II, or anti–CA-II antibody was done. As shown in Fig. 1C, 29-kDa bands in both lanes of the tumor lysate and purified CA-II appeared in Western blots with the post-therapy serum and anti–CA-II antibody in a similar fashion, and the bands diminished in Western blots with the same serum precleared by purified CA-II. These results indicated that the post-therapy serum specifically reacted with CA-II in the tumor lysate. The serum reactivity level with CA-II was assessed by Western blots and the serum was positive at 1:400 dilution against 1 µg purified CA-II (Fig. 1D).


View this table:
[in this window]
[in a new window]

 
Table 1. Matched peptides of the 29-kDa spot 1 with CA-II

 
Anti–carbonic anhydrase II antibody in the patients. We assessed anti–CA-II antibody response by dendritic cell therapy in 10 melanoma and 6 thyroid cancer patients who underwent dendritic cell therapy at our department. One microgram of purified CA-II was subjected to Western blots with the patients' sera. Anti–CA-II antibody was positive in 6 of 10 melanoma patients and in none of the six thyroid cancer patients at a serum dilution of 1:100. All of three normal sera were negative at the same dilution. For the six positive patients, Western blots at serum dilutions of 1:100 and 1:200 were shown in Fig. 1E. Clinical courses and status of the antibody levels in melanoma patients are summarized in Table 2. A marked antibody response to dendritic cell therapy in patient 9 (from none to 1:400 dilution) as well as a weak elevation in antibody levels in patients 6 and 8 (from 1:100 to 1:200 dilution) was observed whereas the antibody levels remained low or diminished in patients 1, 3, and 7. When the patients are divided to clinical responders (patients 6, 8, and 9) and nonresponders (other patients), the relationship between clinical response and antibody response to dendritic cell therapy was significantly correlated by the {chi}2 analysis (P < 0.05, Fisher's exact test). As we were interested in the fact that anti–CA-II antibody was positive in five melanoma patients before dendritic cell therapy, we further investigated the antibody status in 10 other melanoma patients who had not been enrolled in dendritic cell therapy. Three of them were positive at 1:100 dilution and negative at 1:200 dilution. Accordingly, 8 of 20 (40%) melanoma patients were positive for anti–CA-II antibody independent of dendritic cell therapy.


View this table:
[in this window]
[in a new window]

 
Table 2. Clinical response to dendritic cell therapy and serum anti–CA-II antibody levels at pre- and post-therapy

 
Immunohistochemistry for carbonic anhydrase II. To examine localization of CA-II antigen expression in the tissue, immunostaining was done using a rabbit anti-human CA-II antibody (Fig. 2). Consistent with previous report (15), CA-II could be detected in the cytoplasm of the tubular epithelium (Fig. 2B). In the metastatic tumor of the kidney in patient 9, expression of CA-II was found to be positive in the membrane of the tumor vessel endothelium (Fig. 2D). Of note was that the vessel endothelium as well as glomerular endothelium of the normal kidney was negative for CA-II (Fig. 2B, arrows). In patient 8, however, tumor vessel endothelium was negative for CA-II (data not shown). To address whether CA-II expression in the tumor vessel endothelium is melanoma specific, we did CA-II immunostaining in other cancer tissues. Positive CA-II expression in tumor vessel endothelium was also detected in some, but not all, cancer tissues including esophageal cancer, renal cell carcinoma, and lung cancer (Fig. 2E-H). Thus, CA-II expression in vessel endothelium was limited in tumors including melanoma and was not detected in the normal tissues as far as we examined.



View larger version (107K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. CA-II expression in tumor vessel endothelium but not in normal tissue endothelium. Serially sectioned specimens of the normal kidney (A and B) and metastatic melanoma in the kidney of patient 9 (C and D) were stained with H&E (A and C) and anti–CA-II antibody (B and D). Expression of CA-II is detected in tubular epithelial cells of the normal kidney (B) and in endothelial cells of tumor vessels (D). Note that CA-II expression was not observed in vessels of normal renal tissue (B, arrows). CA-II expression in tumor vessel endothelium of various cancer tissues was also shown (E-H). Pictures show esophageal cancer (E), renal cell carcinoma (F), and two cases of lung cancer (G and H). Original magnifications: x200 (A, B, and E-G); x400 (C, D, and H).

 
Reverse transcription-PCR for carbonic anhydrase II in melanomas. Immunohistochemistry analysis had revealed that CA-II expression was positive in the tumor vessel endothelium but not in the melanoma cells or normal vessel endothelium. CA-II–positive tumor vessel endothelium was seen in patient 9 but not in patient 8. To better understand these findings, CA-II expression in tumors and melanoma cell lines was assessed by quantitative real-time reverse transcription-PCR. The quantity of CA-II mRNA copies relative to glyceraldehyde-3-phosphate dehydrogenase was evaluated. CA-II expression in the tumor of patient 9 was higher than those in the tumor of patient 8 and in the five melanoma cell lines (Fig. 3A). These data suggest prominent expression of CA-II in nonmelanoma cells in the tumor of patient 9 and are consistent with the results of immunohistochemistry analysis showing that CA-II expression was limited in the tumor vessel endothelium of patient 9.



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. A, quantity of CA-II mRNA copies relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the tumors and melanoma cell lines. The graph is shown in a logarithmic scale. B and C, cultures of HUVECs on a plastic dish (C) or on Matrigel (D). After 18 hours of culture, cells were grown in a monolayer on a plastic dish (two-dimensional culture) or formed tubular structures on Matrigel (three-dimensional culture). Original magnification, x40. D, quantity of CA-II mRNA copies relative to glyceraldehyde-3-phosphate dehydrogenase of HUVECs in an in vitro angiogenesis model. Cells were cultured on a plastic dish (two-dimensional culture) or Matrigel (three-dimensional culture). N, normal condition; Acid, acidic media (pH 6.8); Hypo, hypoxia (2% oxygen). Columns, mean; bars, SE (n = 3). *, P < 0.05.

 
Carbonic anhydrase II expression in in vitro angiogenesis. To assess CA-II expression of HUVECs in an in vitro angiogenesis model, the cells were cultured on a plastic plate (two-dimensional culture, Fig. 3B) or Matrigel (three-dimensional culture, Fig. 3C) for 18 hours and CA-II mRNA expression was evaluated using quantitative real-time reverse transcription-PCR. CA-II expression was significantly up-regulated in the three-dimensional culture compared with two-dimensional culture in the normal media and atmosphere. When cells were exposed to acidic media (pH 6.8), hypoxia (2% oxygen), or both in the three-dimensional culture, CA-II expression was significantly up-regulated in the acidic and hypoxic conditions (Fig. 3D).


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
By using two-dimensional electrophoresis combined with Western blots and MALDI-TOF/MS methods, we have identified CA-II as an antigen which elicited humoral immune responses in melanoma patients. A similar strategy has been employed to explore TAAs in renal cell carcinoma (16, 17), neuroblastoma (18), and lung cancer (19), the methods of which these researchers have named "serological proteome analysis: SERPA" (20) or "proteome-based target evaluation combined with immunoreactive target structure identification explored by sera: PROTEOMEX" (21) or "serological and proteomic evaluation of antibody responses: SPEAR" (22). Another powerful way of detecting TAAs is the serologic identification of antigens by recombinant expression cloning method (SEREX; ref. 23). In this study, we employed the proteomic strategy to identify a target protein that we found in the preliminary Western blots, the results of which have been successful.

It was thought that TAAs with gene mutations such as ß-catenin are specific to the tumor and recognized as "nonself" by the host immune system. On the other hand, the majority of TAAs in humans do not have mutations and are expressed in certain normal tissues, as is the case with cancer-testis antigens that are expressed in normal testis and with differentiation antigens that are expressed in normal melanocytes. Furthermore, some TAAs have also been reportedly expressed in a wide range of normal tissues. For instance, ATP6S1, a putative accessory unit of the vacuolar H+-ATPase complex that is expressed in a broad range of normal tissues, has been reported to elicit potent humoral responses associated with immune-mediated tumor destruction (24). Therefore, this ubiquitous expression in normal tissues may not exclude the possibility that CA-II is a TAA.

CA-II was identified as a TAA through reaction with the serum of patient 9. Actually, a marked antibody response (from negative to 1:400) was detected only in patient 9. Additional two patients who had antibody response (from 1:100 to 1:200) were patient 6 (stable disease) and patient 8, who had tumor reductions along with patient 9, whereas no antibody response was detected in the remaining patients who had no clinical response to dendritic cell therapy as depicted in Table 2. Anti–CA-II antibody status during therapy may be useful as a marker of good clinical response to dendritic cell therapy, although additional studies are required to conclude the notion as the number of patients who responded to dendritic cell therapy was small.

The presence of anti–CA-II antibody has been reported in some systemic autoimmune diseases, such as systemic lupus erythematosus (prevalence of 24.1%), primary Sjögren's syndrome (20.0%), progressive systemic sclerosis (16.7%), dermatomyositis (25.0%; ref. 10), and in other autoimmune-related diseases including Sjögren-associated chronic pancreatitis (61.9%; ref. 25), autoimmune-related pancreatitis (58.8%; ref. 26), primary biliary cirrhosis [8% (27) to 18% (28)], type 1 diabetes (50.0%; ref. 29), and ulcerative colitis (27.8%; ref. 30). The mechanism of antibody acquisition or the role of the antibody in pathophysiology of these diseases has not been elucidated. In this study, 8 of 20 (40%) melanoma patients had anti–CA-II antibody independent of dendritic cell therapy although the antibody level was relatively moderate compared with the augmented antibody level after dendritic cell therapy in the responders. As seen in patient 3 whose antibody diminished after dendritic cell therapy, anti–CA-II antibody may fluctuate independent of dendritic cell therapy in some melanoma patients. Because no thyroid cancer patient had anti–CA-II antibody in this study and no cancer patient with anti–CA-II antibody has been reported thus far, melanoma may be a unique cancer in this regard.

CA-II has not generally been regarded as a tumor-associated protein because it is expressed in a wide variety of normal cells including erythrocytes, pancreatic epithelial cells, as well as those of the kidney and gastrointestinal tract. A few examples of cancers with high CA-II expression are brain tumors (31) and leukemia (32). Likewise, in this study, CA-II expression was low in melanoma cells. However, we showed that CA-II is expressed in the tumor vessel endothelium instead of normal vessels not only in melanoma but also in esophageal cancer, renal cell carcinoma, and lung cancer. Therefore, we propose that CA-II is a tumor vessel endothelium–associated antigen.

To support the notion that CA-II is specifically expressed in the tumor vessel endothelium, we investigated CA-II mRNA expression in an in vitro angiogenesis model. Compared with the two-dimensional culture, CA-II was significantly up-regulated in the three-dimensional culture, suggesting that CA-II is required in angiogenesis of normal endothelial cells. We further addressed CA-II expression in tumor angiogenesis where we set up cultures in acidic media (pH 6.8) and hypoxic conditions (2% oxygen) to mimic a tumor environment (33, 34). In the acidic and hypoxic conditions, CA-II was significantly up-regulated compared with normal conditions, supporting the specific CA-II expression in tumor vessel endothelium. In our study, however, not all of the tumors had CA-II–positive tumor vessel endothelium. Tumor endothelial CA-II expression may depend on the degree of acidity or hypoxia within the tumor. Another possibility is that CA-II expression is a phenotype of tumor vessel endothelium limited to some tumors. Although tumor vessel endothelium–specific genes were explored (35), to our knowledge, CA-II has not been reported thus far.

How anti–CA-II immunity recognizes CA-II expressed in the tumor vessel endothelium is a critical question because CA-II is generally known to be a cytoplasmic protein. In the immunohistochemistry analysis, CA-II expression was localized to the membrane of the tumor endothelium. CA-II may be attached to the inner leaflet of the membrane as shown in a pancreatic cancer cell line (36). However, it is still possible that CA-II expressed in the endothelium is targeted by the immune system because mouse models have shown that immunization with CA-II induced sialoadenitis (37), cholangitis (38), and pancreatitis (39) by targeting CA-II expressed in each organ.

The discovery of CA-II expression specific to tumor vessel endothelium may lead to another therapeutic strategy. CA inhibitors have been shown to inhibit growth and invasion of cancers including melanoma (40, 41) although its precise mechanism has yet to be uncovered. Given that CA-II has a critical role in tumor angiogenesis, CA inhibitors may deteriorate tumor angiogenesis and cause tumor reduction or inhibition of tumor growth.

Further investigation is needed to clarify the role of CA-II in tumor angiogenesis and to explore the therapeutic effects of vaccination with CA-II and CA inhibitors against tumor angiogenesis.


    Footnotes
 
Grant support: Ministry of Education, Science, Sports, Culture, and Technology of Japan.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 4/13/05; revised 8/ 8/05; accepted 8/19/05.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Carter P. Improving the efficacy of antibody-based cancer therapies. Nat Rev Cancer 2001;1:118–29.[CrossRef][Medline]
  2. Rammensee HG, Weinschenk T, Gouttefangeas C, Stevanovic S. Towards patient-specific tumor antigen selection for vaccination. Immunol Rev 2002;188:164–76.[CrossRef][Medline]
  3. Finn OJ. Cancer vaccines: between the idea and the reality. Nat Rev Immunol 2003;3:630–41.[CrossRef][Medline]
  4. Robbins PF, El-Gamil M, Li YF, et al. A mutated ß-catenin gene encodes a melanoma-specific antigen recognized by tumor infiltrating lymphocytes. J Exp Med 1996;183:1185–92.[Abstract/Free Full Text]
  5. Traversari C, van der Bruggen P, Luescher IF, et al. A nonapeptide encoded by human gene MAGE-1 is recognized on HLA-A1 by cytolytic T lymphocytes directed against tumor antigen MZ2-E. J Exp Med 1992;176:1453–7.[Abstract/Free Full Text]
  6. Tureci O, Sahin U, Schobert I, et al. The SSX-2 gene, which is involved in the t(X;18) translocation of synovial sarcomas, codes for the human tumor antigen HOM-MEL-40. Cancer Res 1996;56:4766–72.[Abstract/Free Full Text]
  7. Chen YT, Scanlan MJ, Sahin U, et al. A testicular antigen aberrantly expressed in human cancers detected by autologous antibody screening. Proc Natl Acad Sci U S A 1997;94:1914–8.[Abstract/Free Full Text]
  8. Brichard V, Van Pel A, Wolfel T, et al. The tyrosinase gene codes for an antigen recognized by autologous cytolytic T lymphocytes on HLA-A2 melanomas. J Exp Med 1993;178:489–95.[Abstract/Free Full Text]
  9. Rosenberg SA, Yang JC, Restifo NP. Cancer immunotherapy: moving beyond current vaccines. Nat Med 2004;10:909–15.[CrossRef][Medline]
  10. Ono M, Watanabe K, Miyashita Y, Inagaki Y, Ueki H. A study of anti-carbonic anhydrase II antibodies in rheumatic autoimmune diseases. J Dermatol Sci 1999;21:183–6.[CrossRef][Medline]
  11. Nagayama H, Sato K, Morishita M, et al. Results of a phase I clinical study using autologous tumour lysate-pulsed monocyte-derived mature dendritic cell vaccinations for stage IV malignant melanoma patients combined with low dose interleukin-2. Melanoma Res 2003;13:521–30.[CrossRef][Medline]
  12. Therasse P, Arbuck SG, Eisenhauer EA, et al. New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada. J Natl Cancer Inst 2000;92:205–16.[Abstract/Free Full Text]
  13. Fairbanks G, Steck TL, Wallach DF. Electrophoretic analysis of the major polypeptides of the human erythrocyte membrane. Biochemistry 1971;10:2606–17.[CrossRef][Medline]
  14. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680–5.[CrossRef][Medline]
  15. Spicer SS, Sens MA, Tashian RE. Immunocytochemical demonstration of carbonic anhydrase in human epithelial cells. J Histochem Cytochem 1982;30:864–73.[Abstract]
  16. Kellner R, Lichtenfels R, Atkins D, et al. Targeting of tumor associated antigens in renal cell carcinoma using proteome-based analysis and their clinical significance. Proteomics 2002;2:1743–51.[CrossRef][Medline]
  17. Lichtenfels R, Kellner R, Atkins D, et al. Identification of metabolic enzymes in renal cell carcinoma utilizing PROTEOMEX analyses. Biochim Biophys Acta 2003;1646:21–31.[Medline]
  18. Prasannan L, Misek DE, Hinderer R, Michon J, Geiger JD, Hanash SM. Identification of ß-tubulin isoforms as tumor antigens in neuroblastoma. Clin Cancer Res 2000;6:3949–56.[Abstract/Free Full Text]
  19. Brichory F, Beer D, Le Naour F, Giordano T, Hanash S. Proteomics-based identification of protein gene product 9.5 as a tumor antigen that induces a humoral immune response in lung cancer. Cancer Res 2001;61:7908–12.[Abstract/Free Full Text]
  20. Klade CS, Voss T, Krystek E, et al. Identification of tumor antigens in renal cell carcinoma by serological proteome analysis. Proteomics 2001;1:890–8.[CrossRef][Medline]
  21. Lichtenfels R, Kellner R, Bukur J, et al. Heat shock protein expression and anti-heat shock protein reactivity in renal cell carcinoma. Proteomics 2002;2:561–70.[CrossRef][Medline]
  22. Unwin RD, Harnden P, Pappin D, et al. Serological and proteomic evaluation of antibody responses in the identification of tumor antigens in renal cell carcinoma. Proteomics 2003;3:45–55.[CrossRef][Medline]
  23. Li G, Miles A, Line A, Rees RC. Identification of tumour antigens by serological analysis of cDNA expression cloning. Cancer Immunol Immunother 2004;53:139–43.[CrossRef][Medline]
  24. Hodi FS, Schmollinger JC, Soiffer RJ, et al. ATP6S1 elicits potent humoral responses associated with immune-mediated tumor destruction. Proc Natl Acad Sci U S A 2002;99:6919–24.[Abstract/Free Full Text]
  25. Kino-Ohsaki J, Nishimori I, Morita M, et al. Serum antibodies to carbonic anhydrase I and II in patients with idiopathic chronic pancreatitis and Sjogren's syndrome. Gastroenterology 1996;110:1579–86.[CrossRef][Medline]
  26. Okazaki K, Uchida K, Ohana M, et al. Autoimmune-related pancreatitis is associated with autoantibodies and a Th1/Th2-type cellular immune response. Gastroenterology 2000;118:573–81.[CrossRef][Medline]
  27. Invernizzi P, Battezzati PM, Crosignani A, et al. Antibody to carbonic anhydrase II is present in primary biliary cirrhosis (PBC) irrespective of antimitochondrial antibody status. Clin Exp Immunol 1998;114:448–54.[CrossRef][Medline]
  28. Ueno Y, Ishii M, Igarashi T, et al. Primary biliary cirrhosis with antibody against carbonic anhydrase II associates with distinct immunological backgrounds. Hepatol Res 2001;20:18–27.[CrossRef][Medline]
  29. Taniguchi T, Okazaki K, Okamoto M, Seko S, Uchida K, Seino Y. Presence of autoantibodies to carbonic anhydrase II and lactoferrin in type 1 diabetes: proposal of the concept of autoimmune exocrinopathy and endocrinopathy of the pancreas. Diabetes Care 2001;24:1695–6.[Free Full Text]
  30. Andoh A, Fujiyama Y, Yoshioka U, et al. Elevated serum anti-carbonic anhydrase II antibodies in patients with ulcerative colitis. Int J Mol Med 2002;9:499–502.[Medline]
  31. Parkkila AK, Herva R, Parkkila S, Rajaniemi H. Immunohistochemical demonstration of human carbonic anhydrase isoenzyme II in brain tumours. Histochem J 1995;27:974–82.[Medline]
  32. Leppilampi M, Koistinen P, Savolainen ER, et al. The expression of carbonic anhydrase II in hematological malignancies. Clin Cancer Res 2002;8:2240–5.[Abstract/Free Full Text]
  33. Harris AL. Hypoxia—a key regulatory factor in tumour growth. Nat Rev Cancer 2002;2:38–47.[CrossRef][Medline]
  34. Fukumura D, Xu L, Chen Y, Gohongi T, Seed B, Jain RK. Hypoxia and acidosis independently up-regulate vascular endothelial growth factor transcription in brain tumors in vivo. Cancer Res 2001;61:6020–4.[Abstract/Free Full Text]
  35. St Croix B, Rago C, Velculescu V, et al. Genes expressed in human tumor endothelium. Science 2000;289:1197–202.[Abstract/Free Full Text]
  36. Alvarez L, Fanjul M, Carter N, Hollande E. Carbonic anhydrase II associated with plasma membrane in a human pancreatic duct cell line (CAPAN-1). J Histochem Cytochem 2001;49:1045–53.[Abstract/Free Full Text]
  37. Nishimori I, Bratanova T, Toshkov I, et al. Induction of experimental autoimmune sialoadenitis by immunization of PL/J mice with carbonic anhydrase II. J Immunol 1995;154:4865–73.[Abstract]
  38. Ueno Y, Ishii M, Takahashi S, Igarashi T, Toyota T, LaRusso NF. Different susceptibility of mice to immune-mediated cholangitis induced by immunization with carbonic anhydrase II. Lab Invest 1998;78:629–37.[Medline]
  39. Uchida K, Okazaki K, Nishi T, et al. Experimental immune-mediated pancreatitis in neonatally thymectomized mice immunized with carbonic anhydrase II and lactoferrin. Lab Invest 2002;82:411–24.[CrossRef][Medline]
  40. Scozzafava A, Supuran CT. Carbonic anhydrase inhibitors: synthesis of N-morpholylthiocarbonylsulfenylamino aromatic/heterocyclic sulfonamides and their interaction with isozymes I, II and IV. Bioorg Med Chem Lett 2000;10:1117–20.[Medline]
  41. Supuran CT, Briganti F, Tilli S, Chegwidden WR, Scozzafava A. Carbonic anhydrase inhibitors: sulfonamides as antitumor agents? Bioorg Med Chem 2001;9:703–14.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
A. M. Niemela, P. Hynninen, J.-P. Mecklin, T. Kuopio, A. Kokko, L. Aaltonen, A.-K. Parkkila, S. Pastorekova, J. Pastorek, A. Waheed, et al.
Carbonic Anhydrase IX Is Highly Expressed in Hereditary Nonpolyposis Colorectal Cancer
Cancer Epidemiol. Biomarkers Prev., September 1, 2007; 16(9): 1760 - 1766.
[Abstract] [Full Text] [PDF]


Home page
Neuro OncolHome page
J. Haapasalo, K. Nordfors, S. Jarvela, H. Bragge, I. Rantala, A.-K. Parkkila, H. Haapasalo, and S. Parkkila
Carbonic anhydrase II in the endothelium of glial tumors: A potential target for therapy
Neuro-oncol, July 1, 2007; 9(3): 308 - 313.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
Z. Yasukawa, C. Sato, and K. Kitajima
Identification of an Inflammation-inducible Serum Protein Recognized by Anti-disialic Acid Antibodies as Carbonic Anhydrase II
J. Biochem., March 1, 2007; 141(3): 429 - 441.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshiura, K.
Right arrow Articles by Yamashita, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshiura, K.
Right arrow Articles by Yamashita, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online