
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Imaging, Diagnosis, Prognosis |
Departments of 1 Pathology and 2 Surgery (Neurosurgery) and Neurology, Memorial Sloan-Kettering Cancer Center, New York, New York
Requests for reprints: Marc Ladanyi, Department of Pathology, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021. Phone: 212-639-6369; Fax: 212-717-3515; E-mail: ladanyim{at}mskcc.org.
| ABSTRACT |
|---|
|
|
|---|
Experimental Design: Among 205 consecutive cases of glioma studied for 1p loss of heterozygosity (LOH), 112 tumors were evaluated for both 1p and 19q LOH using at least three polymorphic markers on 1p and 19q each. The latter group included both low-grade tumors (oligodendroglioma, diffuse astrocytoma, and "oligoastrocytoma") and high-grade tumors (anaplastic oligodendrogliomas, anaplastic astrocytomas, anaplastic oligoastrocytomas). Tumors with small segmental 1p losses (defined as LOH at some loci with retention of heterozygosity at other loci) were studied using a more extensive panel of markers to define the 1p MDR. The candidate gene was screened for mutations and its expression was studied by qualitative and quantitative reverse transcriptase-PCR and Northern blotting.
Results: Allelic losses on 1p and 19q, either separately or combined, were more common in classic oligodendrogliomas than in either astrocytomas or oligoastrocytomas (P < 0.0001). Classic oligodendrogliomas showed 1p loss in 35 of 42 (83%) cases, 19q loss in 28 of 39 (72%), and these were combined in 27 of 39 (69%) cases. There was no significant difference in 1p/19q LOH status between low-grade and anaplastic oligodendrogliomas. In contrast, no astrocytomas and only 6 of 30 (20%) oligoastrocytic tumors had combined 1p/19q loss. Although rare, 1p deletions were more often segmental in astrocytomas (5 of 6, 83%) than in oligodendrogliomas (3 of 35, 9%; P = 0.006). Eleven tumors (6 oligodendrogliomas or having oligodendroglial components, 5 purely astrocytic) with small segmental 1p losses underwent further detailed LOH mapping. All informative tumors in the oligodendroglial group and 2 of 3 informative astrocytomas showed LOH at 1p36.23, with a 150-kb MDR located between D1S2694 and D1S2666, entirely within the CAMTA1 transcription factor gene. Mutation analysis of the exons encoding conserved regions of CAMTA1 showed no somatic mutations in 10 gliomas, including 6 cases with and 4 cases without 1p LOH. CAMTA1 is normally expressed predominantly in non-neoplastic adult brain tissue. Relative to the latter, the expression level of CAMTA1 was low in oligodendroglial tumors and was further halved in cases with 1p deletion compared with those without 1p deletion (Mann-Whitney, P = 0.03).
Conclusions: Our data confirm the strong association of combined 1p/19q loss with classic oligodendroglioma histology and identify a very small segment of 1p36 located within CAMTA1 that was deleted in all oligodendroglial tumors with 1p LOH. This MDR also overlaps the neuroblastoma 1p36 MDR. CAMTA1 shows no evidence of inactivation by somatic mutations but its expression is reduced by half in cases with 1p LOH, suggesting that the functional effects of CAMTA1 haploinsufficiency warrant further investigation.
Key Words: Oligodendroglioma 1p36 region 1p LOH 19q LOH CAMTA1
| INTRODUCTION |
|---|
|
|
|---|
70% to 85% of oligodendrogliomas and 20% to 30% of astrocytomas have allelic losses on chromosome arm 1p suggesting the presence of a tumor suppressor gene (14). However, the latter remains elusive because most deletions are very large, often involving the entire 1p arm.
Loss of genetic material on 1p is not unique to glioma and occurs in many human cancers. In a study of 683 solid tumors of various types (5), the prevalence of loss of heterozygosity (LOH) on 1p ranged from 30% to 64% depending on tumor site. The most frequent 1p LOH was seen in breast, lung, endometrial, ovarian, and colorectal carcinomas. High percentages of LOH were identified at 1p36.3, 1p36.1, 1p35-34.3, 1p32, and 1p31 regions, with tumor-specific patterns. The most extensive 1p deletion mapping in search for a tumor suppressor has been done in neuroblastomas, known to have 1p losses (predominantly at 1p36) in
30% of cases. Genes on 1p previously subjected to mutation analysis as candidate tumor suppressors for neuroblastoma or glioma have included TP73, RAD54L, KIF1B, HKR3, UBE4B/UFD2, EXTL1, and CHD5 (617). However, no strong candidate for the 1p tumor suppressor gene in either neuroblastomas or gliomas has thus far been identified. The putative 19q tumor suppressor also remains elusive, although the p190RhoGAP gene has recently been proposed as a candidate (18, 19).
Remarkably, in spite of neither tumor suppressor gene being clearly identified, the detection of combined allelic losses at 1p and 19q is already in widespread clinical use in neuro-oncology and is becoming part of the standard of care for patients with oligodendrogliomas because of its strong correlation with histology and chemotherapy response (1, 2). As part of a prospective analysis of 205 gliomas, we identified 11 tumors with small losses at 1p36 that allowed us to substantially narrow the commonly deleted region, thereby pinpointing CAMTA1 (20) as a new candidate tumor suppressor gene. We have also sought to better define the histologic correlates of different patterns of 1p and 19q loss (combined versus isolated and extensive versus segmental) in the subset 110 gliomas studied for both loci.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA Extraction. Tumor DNA was extracted from paraffin-embedded tissue using the DNeasy Tissue Kit (QIAGEN, Inc., Valencia, CA) according to the manufacturer's protocol. Following DNA extraction, all tumor samples were subjected to control gene (PGK) amplification to assess DNA integrity. Constitutional DNA from peripheral blood leukocytes was isolated using the standard phenol/chlorophorm extraction method with ethanol precipitation. In cases when peripheral blood was unavailable, patient's nail clippings were used as a source of normal DNA. DNA extraction from nails was done using a protocol modified from published methods (21, 22) with reagents from the PUREGENE DNA Purification Kit (Gentra Systems, Inc., Minneapolis, MN ). Briefly, 1 to 5 mg of nail clippings were snap-frozen in liquid nitrogen, finely ground, treated with 150 µL of cell lysis solution, and 1.25 µL of proteinase K and incubated at 55°C for 72 hours. The lysate was treated with 0.75 µL of RNase A solution (4 mg/mL) and incubated for an additional hour. Following incubation, the sample was cooled on ice for at least 5 minutes. Cell lysate was treated with 50 µL of protein precipitation solution, vortexed, and centrifuged at 14,000 x g for 3 minutes. The precipitated protein formed a tight pellet. Supernatant containing DNA was transferred to a clean 1.5-mL tube and treated with 150 µL of 100% isopropanol and 0.5 µL of glycogen solution (20 mg/mL). The sample was gently mixed and centrifuged at 14,000 x g for 5 minutes. Supernatant was discarded and the pellet was allowed to air-dry. DNA pellet was washed with 150 µL of 70% ethanol, centrifuged at 14,000 x g for 1 minute and allowed to completely air-dry. DNA was re-suspended in 30 µL of DNA hydration solution, incubated at 65°C for 1 hour, and allowed to completely dissolve at room temperature overnight. Average DNA yield was 0.5 to 2 µg.
Loss of Heterozygosity Analysis. Constitutional DNA/tumor DNA pairs were evaluated by standard PCR-based LOH assays. All cases were initially studied using at least three microsatellite markers mapped to the distal portion of the chromosome within the region of previously reported minimal 1p losses (tel-D1S468, D1S548, D1S1612, D1S1592, D1S552, D1S496-cent). Segmental loss was defined as evidence of interstitial or small terminal deletions, as manifested by LOH at one or more loci with retention of heterozygosity at the centromeric end of the evaluated region, with or without retention of heterozygosity at the telomeric end. Cases with segmental 1p36 deletions were studied with an expanded panel of 15 markers mapped to p36.32 to p34.3 and spanning
32 Mb (tel- D1S171, D1S468, D1S2145, D1S2870, D1S253, D1S2642, D1S214, D1S2694, D1S548, D1S2666, D1S508, D1S1612, D1S1592, D1S552, and D1S496-cent). Information on these loci was obtained from various public databases [Genome Database (http://www.gdb.org), National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov), Ensembl Genome Browser (http://www.ensembl.org/Homo_sapiens/)].
Allelic losses at 19q were evaluated using 3 polymorphic markers mapped to a commonly deleted region at q13.3 (D1S219, D1S412, and PLA4C2G). Oligonucleotide primer pairs were custom synthesized at Proligo LLC (http://www.gensetoligos.com). Approximately 100 ng of DNA and 15 pmol of each primer (forward primer labeled with 6-FAM) were used for each PCR reaction. All PCR products were first run on a 2% agarose gel to check the efficacy of PCR amplification and then analyzed by capillary electrophoresis on 3100 Avant Genetic Analyzer (Applied Biosystems, Foster City, CA). LOH was scored as present when the tumor sample showed reduction in height of one of two peaks by >50%. This was compared with the ratio of peak heights of the two alleles in the corresponding constitutional DNA. The consistency of all significant findings was confirmed by repeat analysis.
Mutation Analysis. The exons encoding conserved regions of CAMTA1 (Ensembl: ENSG00000171735) were evaluated for somatic mutations by PCR amplification followed by direct sequencing. Primers for the amplification of specific exons (listed in Table 1) were selected in the flanking intronic sequences. The GC-rich (78% GC content) region of exon 1 was particularly difficult to amplify. The specific 386-bp product was obtained only with the use of the approach described by Bachmann et al. (23) that included partial substitution of dGTP in the standard PCR mix with 7-Deaza-dGTP [150 µmol/L of 7-Deaza-dGTP (Roche, Indianapolis, IN) + 50 µmol/L dGTP per reaction, instead of 200 µmol/L dGTP]. We also did mutation analysis of selected anonymous expressed sequence tags (EST) within a large intron 5 of CAMTA1 that aligned with a region of consistent LOH within BAC clone RP3-453P22 (Genbank accession no. Z97987; GI: 2769643). All primer sequences and PCR product sizes are listed in Tables 1 and 2.
|
|
-32P] dCTP-labeled probe that represented a PCR-amplified portion of CAMTA1 exon 9 spanning 1 kb (primers, sense GTGTTCATGTCAGAGGTCACCA and antisense AGGAGATGTCAAAGTGGTCCAG). The hybridization was carried out at 63°C in ExpressHyb solution (Clontech, Palo Alto, CA) for 2 hours. The blot was washed according to the manufacturers protocol and exposed to a phosphorimaging screen (Bio-Rad, Hercules, CA) for 24 hours. CAMTA1 Expression in Gliomas by Quantitative Reverse Transcriptase-PCR. Total RNA was extracted from frozen tumors using RNA STAT-60 isolation reagent (Tel-Test, Inc., Friendswood, TX) and was quantified on a spectrophotometer. One microgram of RNA was reverse-transcribed using SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA), and 10 µL of cDNA were used in quantitative RT-PCR reaction. Quantitative real-time RT-PCR was done on an iCycler (Bio-Rad) using a commercially available CAMTA1 primers/Taqman probe set (Applied Biosystems) spanning exon 10 to 11 boundary. The thermal cycling conditions comprised an initial denaturation step at 95°C for 10 minutes and 50 cycles at 95°C for 30 seconds and 60°C for 1 minute. Each sample was normalized using TATA box-binding protein transcripts as an endogenous housekeeping gene control. Normal adult brain total RNA (Clontech) served as a reference standard for calculation of relative expression values. Experiments were done in triplicate for each data point. The delta-Ct value of the sample was determined by subtracting the average Ct value of CAMTA1 from the average Ct value of the TBP gene. The delta-delta-Ct value was then calculated by subtracting the delta-Ct value of the sample from that of the normal adult brain RNA sample from the same batch. The CAMTA1 expression level relative to normal brain was then estimated as 2(delta-delta-Ct). Differences between the CAMTA1 expression levels in different subsets of gliomas were evaluated by the Mann-Whitney test.
| RESULTS |
|---|
|
|
|---|
|
5%) with segmental 1p deletions. However, this may be an underestimate because small deletions can only be excluded in cases where all loci are informative. The group of 11 tumors with segmental 1p losses consisted of six neoplasms exhibiting either pure oligodendroglioma morphology or having oligodendroglioma component [3 pure oligodendrogliomas, 1 oligoastrocytoma, and 2 tumors of other histologies (glioblastoma and a low-grade glioneuronal neoplasm of unconventional type)] and five pure astrocytomas. The segmental losses were interstitial in eight cases and small terminal in three cases, based on the informative loci available (Fig. 1). Small segmental 1p losses showed a strikingly uneven distribution between classic oligodendroglioma and astrocytic groups. Segmental deletions were significantly more common in astrocytomas than in classic oligodendrogliomas (P = 0.006; Table 3). Segmental 1p losses in oligodendroglioma tumors made up only 9% of 1p-deleted cases, consistent with the 5% to 10% range found in other studies (2, 2426). In contrast, in astrocytic tumors 1p losses are much less common but when present are often segmental (5 of 6, 83%).
|
|
|
Results of the 19q LOH assays are also shown in Fig. 1. LOH on 19q was detected in two of six (33%) oligodendroglial tumors with segmental 1p loss. This is within the expected range for a group including not only pure oligodendrogliomas but also mixed astrocytic-oligodendroglioma tumors. All four astrocytomas with segmental 1p loss that were informative for the 19q loci tested maintained heterozygosity on 19q.
Lack of Somatic Mutations in CAMTA1. The only gene currently mapped to the D1S2694-D1S2666 MDR is a recently characterized calmodulin-binding transcription activator gene, CAMTA1 (20). We searched for somatic mutations in exons encoding conserved regions of CAMTA1 using a panel of 10 tumors (with matching normal DNA). These 10 tumors included two with small segmental 1p losses (05** and AS-08, Fig. 1), four gliomas (2 oligodendrogliomas, 2 oligoastrocytomas) with well-documented large 1p deletions, and four gliomas (1 oligodendroglioma, 1 astrocytoma, and 2 oligoastrocytomas) without evidence of 1p allelic loss. Cases with deletions were studied based on the classic two-hit model that would require the remaining copy of the candidate tumor suppressor gene to be inactivated by somatic mutation. Cases without deletions were studied based on the alternative hypothesis that inactivation of only one copy of the gene may be pathogenetically significant (and therefore cases without deletions might harbor a somatic mutation instead). The following 15 exons encoding conserved regions of CAMTA1 were sequenced in each case using primers in the flanking intronic sequences: exons 1 to 2 (NLS_BP: putative nuclear localization signal), exons 3 to 7 (CG-1: DNA binding domain), exons 9 to 11 (TIG: DNA binding domain), exons 13 to 15 (ankyrin repeats), and exons 19 to 20 (IQ motif: calmodulin-binding site). Sequencing of these 15 exons showed no somatic mutations in the 10 cases analyzed. As stated above, these 10 cases included 6 cases with 1p36 LOH and 4 cases without 1p36 LOH.
Lack of Somatic Mutations in Expressed Sequence Tags in Intron 5 of CAMTA1. Because the pattern of LOH in one case (05**) suggested a very small interstitial deletion (between D1S2694 and D1S2666) roughly corresponding to intron 5 of CAMTA1, we speculated that this large intron may contain an unidentified gene. Therefore, we analyzed selected ESTs mapped to the intronic region (corresponding to clone RP3-453P22, Genbank accession no. Z97987). The sequences analyzed corresponded to rare ESTs in four small UniGene clusters and one unclustered EST (Table 2). Several single nucleotide polymorphisms were detected, but no somatic mutations were found in the same 10 cases analyzed above.
Expression Pattern of CAMTA1 in Normal Tissues. Among normal human tissues, brain and kidney showed the highest levels of CAMTA1 expression by RT-PCR (Fig. 4). The results are in agreement with publicly available gene expression data (SOURCE http://source.stanford.edu) that show highest expression of CAMTA1 in normal neural tissues. Northern blotting using a probe corresponding to exon 9 of CAMTA1 showed two transcripts (
8 and 3 kb) present at approximately same levels in samples from the different regions of normal brain (cerebellum, cerebral cortex, medulla, occipital lobe, frontal lobe, temporal lobe, and putamen) and in the spinal cord (Fig. 5). The exon composition of these two CAMTA1 transcripts is under investigation.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Several partially overlapping 1p MDRs have been previously described in gliomas (2,2430) and neuroblastomas (3137). The 1p MDR identified in this study further narrows a known MDR (D1S468-D1S1612) described in gliomas by Smith et al. (2) and overlaps the neuroblastoma 1p36 MDR (ref. 31; Fig. 7).
|
1 Mb between 6.5 and 7.5 Mb on 1p and, remarkably, encompasses five polymorphic loci used in the present study (D1S214, D1S2694, D1S548, D1S2666, and D1S508; Fig. 8). Because the D1S2694-D1S2666 MDR is located entirely within intron 5 of CAMTA1, we also examined some ESTs mapped to this intron (Table 2) for somatic mutations but found none.
|
15% of cases (38, 39). Indeed, the fact that the 1p MDR in gliomas shown here (D1S2694-D1S2666) overlaps the neuroblastoma MDR (D1S2731-D1S2666; (ref. 31), as shown in Fig. 7, is particularly intriguing and suggests that the analysis of CAMTA1 as a candidate tumor suppressor gene should be extended to neuroblastomas. Mutation analysis of oligodendroglial tumors with 1p LOH showed no evidence of somatic mutations in CAMTA1 exons encoding conserved domains arguing against a classic two hit mechanism. Mutation analysis of gliomas without 1p LOH also showed no evidence of somatic mutations in CAMTA1, suggesting that CAMTA1 mutation does not substitute for 1p deletion in these tumors.
Our finding that CAMTA1 transcript levels in oligodendroglial tumors with 1p LOH were essentially halved compared with cases without 1p LOH supports biallelic expression of CAMTA1. Continued expression from the remaining CAMTA1 allele in 1p-deleted cases is inconsistent with promoter hypermethylation as a second hit but raises the possibility that CAMTA1 haploinsufficiency may be functionally significant. Tumor suppressors for which haploinsufficiency is pathogenetically significant are being described in increasing numbers (for review see ref. 40). Cell cycle regulatory tumor suppressor genes seem especially dosage-sensitive (40). This is intriguing given that CAMTA1 expression levels change during the cell cycle suggestive of involvement in cell cycle regulation, at least in certain cellular contexts (41).
The high prevalence of hemizygous 1p deletions and rarity or absence of homozygous 1p deletions in gliomas and neuroblastomas suggests that there may be a selective advantage for haploinsufficiency of this tumor suppressor gene (possibly CAMTA1), but that loss of the remaining gene copy may be detrimental. Imprinting seems unlikely since there is no evidence for parent-of-origin effects for 1p36 deletions in either gliomas or neuroblastomas (42, 43) . Whether the low expression level of CAMTA1 in oligodendroglial tumors without 1p deletion is due to hypermethylation of promoter CpG islands or differences in CAMTA1 promoter activation due to cellular context or merely reflects the presence of other highly expressing cell types in normal adult brain remains to be investigated.
Finally, the findings of two recent studies further strengthen the candidacy of CAMTA1 as an oligodendroglioma tumor suppressor gene. In a glioma gene expression profiling study (44), Mukasa et al. identified CAMTA1 as one of the top differentially overexpressed genes in astrocytomas relative to oligodendroglioma and glioblastomas (or conversely, underexpressed in oligodendroglioma and glioblastoma relative to astrocytomas). These results parallel our quantitative RT-PCR data. The second study is that of Hahn et al. (45), who used a bioinformatics approach to systematically identify chimeric transcripts present in human mRNA and EST databases. Remarkably, in an oligodendroglioma EST library, they found an out-of-frame fusion involving CAMTA1 (no. 82 in their Supplementary Table 3), representing a chromosomal inversion whose likely functional consequence is to effectively inactivate one copy of CAMTA1 in that tumor.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Note: Presented in part at the Annual Meeting of the United States and Canadian Academy of Pathology, March 8, 2004, Vancouver, British Columbia, Canada.
| REFERENCES |
|---|
|
|
|---|
gene located at 1p36.2 in neuroblastoma. Int J Oncol 2003;23:73744.[Medline]
This article has been cited by other articles:
![]() |
D. Yin, S. Ogawa, N. Kawamata, P. Tunici, G. Finocchiaro, M. Eoli, C. Ruckert, T. Huynh, G. Liu, M. Kato, et al. High-Resolution Genomic Copy Number Profiling of Glioblastoma Multiforme by Single Nucleotide Polymorphism DNA Microarray Mol. Cancer Res., May 1, 2009; 7(5): 665 - 677. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zheng, L. Gao, Y. Feng, L. Yuan, H. Zhao, and L. A. Cornelius Down-regulation of Rap1GAP via Promoter Hypermethylation Promotes Melanoma Cell Proliferation, Survival, and Migration Cancer Res., January 15, 2009; 69(2): 449 - 457. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.E. Emblem, D. Scheie, P. Due-Tonnessen, B. Nedregaard, T. Nome, J.K. Hald, K. Beiske, T.R. Meling, and A. Bjornerud Histogram Analysis of MR Imaging-Derived Cerebral Blood Volume Maps: Combined Glioma Grading and Identification of Low-Grade Oligodendroglial Subtypes AJNR Am. J. Neuroradiol., October 1, 2008; 29(9): 1664 - 1670. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bagchi and A. A. Mills The Quest for the 1p36 Tumor Suppressor Cancer Res., April 15, 2008; 68(8): 2551 - 2556. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Longoni, F. Orzan, M. Stroppi, N. Boari, P. Mortini, and P. Riva Evaluation of 1p36 markers and clinical outcome in a skull base chordoma study Neuro-oncol, February 1, 2008; 10(1): 52 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Li, J. Walling, Y. Kotliarov, A. Center, M. E. Steed, S. J. Ahn, M. Rosenblum, T. Mikkelsen, J. C. Zenklusen, and H. A. Fine Genomic Changes and Gene Expression Profiles Reveal That Established Glioma Cell Lines Are Poorly Representative of Primary Human Gliomas Mol. Cancer Res., January 1, 2008; 6(1): 21 - 30. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Gong, J. Han, K. Reddig, and H.-S. Li A Potential Dimerization Region of dCAMTA Is Critical for Termination of Fly Visual Response J. Biol. Chem., July 20, 2007; 282(29): 21253 - 21258. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Huentelman, A. Papassotiropoulos, D. W. Craig, F. J. Hoerndli, J. V. Pearson, K.-D. Huynh, J. Corneveaux, J. Hanggi, C. R.A. Mondadori, A. Buchmann, et al. Calmodulin-binding transcription activator 1 (CAMTA1) alleles predispose human episodic memory performance Hum. Mol. Genet., June 15, 2007; 16(12): 1469 - 1477. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Wang, S. Diskin, E. Rappaport, E. Attiyeh, Y. Mosse, D. Shue, E. Seiser, J. Jagannathan, S. Shusterman, M. Bansal, et al. Integrative genomics identifies distinct molecular classes of neuroblastoma and shows that multiple genes are targeted by regional alterations in DNA copy number. Cancer Res., June 15, 2006; 66(12): 6050 - 6062. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Jaeckle, K. V. Ballman, R. D. Rao, R. B. Jenkins, and J. C. Buckner Current Strategies in Treatment of Oligodendroglioma: Evolution of Molecular Signatures of Response J. Clin. Oncol., March 10, 2006; 24(8): 1246 - 1252. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-O. Henrich, M. Fischer, D. Mertens, A. Benner, R. Wiedemeyer, B. Brors, A. Oberthuer, F. Berthold, J. S. Wei, J. Khan, et al. Reduced Expression of CAMTA1 Correlates with Adverse Outcome in Neuroblastoma Patients Clin. Cancer Res., January 1, 2006; 12(1): 131 - 138. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |