Clinical Cancer Research The Science of Cancer Health Disparities Stand Up to Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barbashina, V.
Right arrow Articles by Ladanyi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barbashina, V.
Right arrow Articles by Ladanyi, M.
Clinical Cancer Research Vol. 11, 1119-1128, February 2005
© 2005 American Association for Cancer Research


Imaging, Diagnosis, Prognosis

Allelic Losses at 1p36 and 19q13 in Gliomas: Correlation with Histologic Classification, Definition of a 150-kb Minimal Deleted Region on 1p36, and Evaluation of CAMTA1 as a Candidate Tumor Suppressor Gene

Violetta Barbashina1, Paulo Salazar1, Eric C. Holland2, Marc K. Rosenblum1 and Marc Ladanyi1

Departments of 1 Pathology and 2 Surgery (Neurosurgery) and Neurology, Memorial Sloan-Kettering Cancer Center, New York, New York

Requests for reprints: Marc Ladanyi, Department of Pathology, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021. Phone: 212-639-6369; Fax: 212-717-3515; E-mail: ladanyim{at}mskcc.org.


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Purpose: Allelic loss at 1p is seen in 70% to 85% of oligodendrogliomas (typically in association with 19q allelic loss) and 20-30% of astrocytomas. Because most 1p deletions in gliomas involve almost the entire chromosome arm, narrowing the region of the putative tumor suppressor gene has been difficult. To better define the histologic correlates of different patterns of 1p and 19q loss, we evaluated 1p/19q status in a large group of gliomas. This also allowed us to define a very small minimal deleted region (MDR) on 1p36.

Experimental Design: Among 205 consecutive cases of glioma studied for 1p loss of heterozygosity (LOH), 112 tumors were evaluated for both 1p and 19q LOH using at least three polymorphic markers on 1p and 19q each. The latter group included both low-grade tumors (oligodendroglioma, diffuse astrocytoma, and "oligoastrocytoma") and high-grade tumors (anaplastic oligodendrogliomas, anaplastic astrocytomas, anaplastic oligoastrocytomas). Tumors with small segmental 1p losses (defined as LOH at some loci with retention of heterozygosity at other loci) were studied using a more extensive panel of markers to define the 1p MDR. The candidate gene was screened for mutations and its expression was studied by qualitative and quantitative reverse transcriptase-PCR and Northern blotting.

Results: Allelic losses on 1p and 19q, either separately or combined, were more common in classic oligodendrogliomas than in either astrocytomas or oligoastrocytomas (P < 0.0001). Classic oligodendrogliomas showed 1p loss in 35 of 42 (83%) cases, 19q loss in 28 of 39 (72%), and these were combined in 27 of 39 (69%) cases. There was no significant difference in 1p/19q LOH status between low-grade and anaplastic oligodendrogliomas. In contrast, no astrocytomas and only 6 of 30 (20%) oligoastrocytic tumors had combined 1p/19q loss. Although rare, 1p deletions were more often segmental in astrocytomas (5 of 6, 83%) than in oligodendrogliomas (3 of 35, 9%; P = 0.006). Eleven tumors (6 oligodendrogliomas or having oligodendroglial components, 5 purely astrocytic) with small segmental 1p losses underwent further detailed LOH mapping. All informative tumors in the oligodendroglial group and 2 of 3 informative astrocytomas showed LOH at 1p36.23, with a 150-kb MDR located between D1S2694 and D1S2666, entirely within the CAMTA1 transcription factor gene. Mutation analysis of the exons encoding conserved regions of CAMTA1 showed no somatic mutations in 10 gliomas, including 6 cases with and 4 cases without 1p LOH. CAMTA1 is normally expressed predominantly in non-neoplastic adult brain tissue. Relative to the latter, the expression level of CAMTA1 was low in oligodendroglial tumors and was further halved in cases with 1p deletion compared with those without 1p deletion (Mann-Whitney, P = 0.03).

Conclusions: Our data confirm the strong association of combined 1p/19q loss with classic oligodendroglioma histology and identify a very small segment of 1p36 located within CAMTA1 that was deleted in all oligodendroglial tumors with 1p LOH. This MDR also overlaps the neuroblastoma 1p36 MDR. CAMTA1 shows no evidence of inactivation by somatic mutations but its expression is reduced by half in cases with 1p LOH, suggesting that the functional effects of CAMTA1 haploinsufficiency warrant further investigation.

Key Words: Oligodendroglioma • 1p36 region • 1p LOH • 19q LOH • CAMTA1


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Diffuse gliomas are the most common primary tumors of the central nervous system. The major subtypes include astrocytoma, oligodendrogliomas, and so-called "oligoastrocytoma." Prior studies have shown that ~70% to 85% of oligodendrogliomas and 20% to 30% of astrocytomas have allelic losses on chromosome arm 1p suggesting the presence of a tumor suppressor gene (1–4). However, the latter remains elusive because most deletions are very large, often involving the entire 1p arm.

Loss of genetic material on 1p is not unique to glioma and occurs in many human cancers. In a study of 683 solid tumors of various types (5), the prevalence of loss of heterozygosity (LOH) on 1p ranged from 30% to 64% depending on tumor site. The most frequent 1p LOH was seen in breast, lung, endometrial, ovarian, and colorectal carcinomas. High percentages of LOH were identified at 1p36.3, 1p36.1, 1p35-34.3, 1p32, and 1p31 regions, with tumor-specific patterns. The most extensive 1p deletion mapping in search for a tumor suppressor has been done in neuroblastomas, known to have 1p losses (predominantly at 1p36) in ~30% of cases. Genes on 1p previously subjected to mutation analysis as candidate tumor suppressors for neuroblastoma or glioma have included TP73, RAD54L, KIF1B, HKR3, UBE4B/UFD2, EXTL1, and CHD5 (6–17). However, no strong candidate for the 1p tumor suppressor gene in either neuroblastomas or gliomas has thus far been identified. The putative 19q tumor suppressor also remains elusive, although the p190RhoGAP gene has recently been proposed as a candidate (18, 19).

Remarkably, in spite of neither tumor suppressor gene being clearly identified, the detection of combined allelic losses at 1p and 19q is already in widespread clinical use in neuro-oncology and is becoming part of the standard of care for patients with oligodendrogliomas because of its strong correlation with histology and chemotherapy response (1, 2). As part of a prospective analysis of 205 gliomas, we identified 11 tumors with small losses at 1p36 that allowed us to substantially narrow the commonly deleted region, thereby pinpointing CAMTA1 (20) as a new candidate tumor suppressor gene. We have also sought to better define the histologic correlates of different patterns of 1p and 19q loss (combined versus isolated and extensive versus segmental) in the subset 110 gliomas studied for both loci.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Specimens. Among 205 consecutive gliomas studied for 1p LOH at Memorial Sloan-Kettering Cancer Center (January 2000-September 2003), 112 tumors were evaluated for combined 1p/19q loss (19q LOH analysis was done prospectively in all cases evaluated starting in January 2003, as well as retrospectively based on DNA availability). These 112 gliomas included low-grade tumors (24 oligodendrogliomas, 18 diffuse astrocytomas, and 15 oligoastrocytomas) and high-grade tumors (18 anaplastic oligodendrogliomas, 17 anaplastic astrocytomas, and 18 anaplastic oligoastrocytomas) as well as two other brain tumors with oligodendroglial components. Tumor samples consisted of routinely processed formalin-fixed, paraffin- embedded tissue. For each tumor, histologic subtype and grade were documented by a neuropathologist (M.K.R.). An H&E-stained section was obtained before DNA extraction to evaluate the proportion of tumor in paraffin block. If tumor content was <90%, areas containing pure tumor were dissected. Matched constitutional DNA was obtained from peripheral blood or nail clippings. Frozen tumor material, obtained in a limited number of the above cases under a protocol approved by the Memorial Sloan-Kettering Cancer Center Institutional Review Board, was used for RNA extraction for quantitative real-time reverse transcriptase-PCR (RT-PCR).

DNA Extraction. Tumor DNA was extracted from paraffin-embedded tissue using the DNeasy Tissue Kit (QIAGEN, Inc., Valencia, CA) according to the manufacturer's protocol. Following DNA extraction, all tumor samples were subjected to control gene (PGK) amplification to assess DNA integrity. Constitutional DNA from peripheral blood leukocytes was isolated using the standard phenol/chlorophorm extraction method with ethanol precipitation. In cases when peripheral blood was unavailable, patient's nail clippings were used as a source of normal DNA. DNA extraction from nails was done using a protocol modified from published methods (21, 22) with reagents from the PUREGENE DNA Purification Kit (Gentra Systems, Inc., Minneapolis, MN ). Briefly, 1 to 5 mg of nail clippings were snap-frozen in liquid nitrogen, finely ground, treated with 150 µL of cell lysis solution, and 1.25 µL of proteinase K and incubated at 55°C for 72 hours. The lysate was treated with 0.75 µL of RNase A solution (4 mg/mL) and incubated for an additional hour. Following incubation, the sample was cooled on ice for at least 5 minutes. Cell lysate was treated with 50 µL of protein precipitation solution, vortexed, and centrifuged at 14,000 x g for 3 minutes. The precipitated protein formed a tight pellet. Supernatant containing DNA was transferred to a clean 1.5-mL tube and treated with 150 µL of 100% isopropanol and 0.5 µL of glycogen solution (20 mg/mL). The sample was gently mixed and centrifuged at 14,000 x g for 5 minutes. Supernatant was discarded and the pellet was allowed to air-dry. DNA pellet was washed with 150 µL of 70% ethanol, centrifuged at 14,000 x g for 1 minute and allowed to completely air-dry. DNA was re-suspended in 30 µL of DNA hydration solution, incubated at 65°C for 1 hour, and allowed to completely dissolve at room temperature overnight. Average DNA yield was 0.5 to 2 µg.

Loss of Heterozygosity Analysis. Constitutional DNA/tumor DNA pairs were evaluated by standard PCR-based LOH assays. All cases were initially studied using at least three microsatellite markers mapped to the distal portion of the chromosome within the region of previously reported minimal 1p losses (tel-D1S468, D1S548, D1S1612, D1S1592, D1S552, D1S496-cent). Segmental loss was defined as evidence of interstitial or small terminal deletions, as manifested by LOH at one or more loci with retention of heterozygosity at the centromeric end of the evaluated region, with or without retention of heterozygosity at the telomeric end. Cases with segmental 1p36 deletions were studied with an expanded panel of 15 markers mapped to p36.32 to p34.3 and spanning ~32 Mb (tel- D1S171, D1S468, D1S2145, D1S2870, D1S253, D1S2642, D1S214, D1S2694, D1S548, D1S2666, D1S508, D1S1612, D1S1592, D1S552, and D1S496-cent). Information on these loci was obtained from various public databases [Genome Database (http://www.gdb.org), National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov), Ensembl Genome Browser (http://www.ensembl.org/Homo_sapiens/)].

Allelic losses at 19q were evaluated using 3 polymorphic markers mapped to a commonly deleted region at q13.3 (D1S219, D1S412, and PLA4C2G). Oligonucleotide primer pairs were custom synthesized at Proligo LLC (http://www.gensetoligos.com). Approximately 100 ng of DNA and 15 pmol of each primer (forward primer labeled with 6-FAM) were used for each PCR reaction. All PCR products were first run on a 2% agarose gel to check the efficacy of PCR amplification and then analyzed by capillary electrophoresis on 3100 Avant Genetic Analyzer (Applied Biosystems, Foster City, CA). LOH was scored as present when the tumor sample showed reduction in height of one of two peaks by >50%. This was compared with the ratio of peak heights of the two alleles in the corresponding constitutional DNA. The consistency of all significant findings was confirmed by repeat analysis.

Mutation Analysis. The exons encoding conserved regions of CAMTA1 (Ensembl: ENSG00000171735) were evaluated for somatic mutations by PCR amplification followed by direct sequencing. Primers for the amplification of specific exons (listed in Table 1) were selected in the flanking intronic sequences. The GC-rich (78% GC content) region of exon 1 was particularly difficult to amplify. The specific 386-bp product was obtained only with the use of the approach described by Bachmann et al. (23) that included partial substitution of dGTP in the standard PCR mix with 7-Deaza-dGTP [150 µmol/L of 7-Deaza-dGTP (Roche, Indianapolis, IN) + 50 µmol/L dGTP per reaction, instead of 200 µmol/L dGTP]. We also did mutation analysis of selected anonymous expressed sequence tags (EST) within a large intron 5 of CAMTA1 that aligned with a region of consistent LOH within BAC clone RP3-453P22 (Genbank accession no. Z97987; GI: 2769643). All primer sequences and PCR product sizes are listed in Tables 1 and 2.


View this table:
[in this window]
[in a new window]

 
Table 1 Primer sequences for CAMTA1 mutation analysis

 

View this table:
[in this window]
[in a new window]

 
Table 2 Primers for mutation analysis of selected ESTs within CAMTA1 intron 5 [corresponding to clone RP3-453P22 [(Genbank accession no. Z97987)]

 
CAMTA1 Expression Analysis in Normal Tissues. Expression of CAMTA1 in normal human tissues was evaluated by RT-PCR and Northern blotting using Clontech Multiple Tissue cDNA Panel and Human Brain MTN Blot. Gene-specific primers for RT-PCR were exon 2 sense CGTTTCCCAAAGTGTATTCTGCGGA and exon 6 antisense ATGGACATAGCAGCCGTACAAGCA. The identity of RT-PCR product was confirmed by direct sequencing. Northern blotting was done using a [{alpha}-32P] dCTP-labeled probe that represented a PCR-amplified portion of CAMTA1 exon 9 spanning 1 kb (primers, sense GTGTTCATGTCAGAGGTCACCA and antisense AGGAGATGTCAAAGTGGTCCAG). The hybridization was carried out at 63°C in ExpressHyb solution (Clontech, Palo Alto, CA) for 2 hours. The blot was washed according to the manufacturer’s protocol and exposed to a phosphorimaging screen (Bio-Rad, Hercules, CA) for 24 hours.

CAMTA1 Expression in Gliomas by Quantitative Reverse Transcriptase-PCR. Total RNA was extracted from frozen tumors using RNA STAT-60 isolation reagent (Tel-Test, Inc., Friendswood, TX) and was quantified on a spectrophotometer. One microgram of RNA was reverse-transcribed using SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA), and 10 µL of cDNA were used in quantitative RT-PCR reaction. Quantitative real-time RT-PCR was done on an iCycler (Bio-Rad) using a commercially available CAMTA1 primers/Taqman probe set (Applied Biosystems) spanning exon 10 to 11 boundary. The thermal cycling conditions comprised an initial denaturation step at 95°C for 10 minutes and 50 cycles at 95°C for 30 seconds and 60°C for 1 minute. Each sample was normalized using TATA box-binding protein transcripts as an endogenous housekeeping gene control. Normal adult brain total RNA (Clontech) served as a reference standard for calculation of relative expression values. Experiments were done in triplicate for each data point. The delta-Ct value of the sample was determined by subtracting the average Ct value of CAMTA1 from the average Ct value of the TBP gene. The delta-delta-Ct value was then calculated by subtracting the delta-Ct value of the sample from that of the normal adult brain RNA sample from the same batch. The CAMTA1 expression level relative to normal brain was then estimated as 2–(delta-delta-Ct). Differences between the CAMTA1 expression levels in different subsets of gliomas were evaluated by the Mann-Whitney test.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Strong Association of Combined 1p/19q Loss of Heterozygosity with Classic Oligodendroglioma Morphology. The results of 1p/19q LOH analysis are summarized in Table 3. We found no significant difference in 1p/19q status between low-grade and anaplastic oligodendrogliomas (1p LOH, 83% versus 83%; 19q LOH, 66% versus 78%; combined 1p/19q loss, 66% versus 72%). Because WHO grade showed no significant impact on the proportions of patterns of 1p and 19q losses in the other two groups (astrocytomas and oligoastrocytomas), these data were combined for each histologic category in the remaining analyses. Thus, 1p and 19q losses, either separately or combined, were significantly more common in oligodendrogliomas than in either astrocytomas or oligoastrocytomas (P < 0.0001). No astrocytic tumors and only 6 of 30 oligoastrocytomas had combined 1p/19q loss.


View this table:
[in this window]
[in a new window]

 
Table 3 1p/19q LOH results

 
Low Frequency of Segmental 1p Losses and Association with Astrocytic Histology. Among 205 consecutive gliomas analyzed for 1p LOH, we found only 11 tumors (~5%) with segmental 1p deletions. However, this may be an underestimate because small deletions can only be excluded in cases where all loci are informative. The group of 11 tumors with segmental 1p losses consisted of six neoplasms exhibiting either pure oligodendroglioma morphology or having oligodendroglioma component [3 pure oligodendrogliomas, 1 oligoastrocytoma, and 2 tumors of other histologies (glioblastoma and a low-grade glioneuronal neoplasm of unconventional type)] and five pure astrocytomas. The segmental losses were interstitial in eight cases and small terminal in three cases, based on the informative loci available (Fig. 1). Small segmental 1p losses showed a strikingly uneven distribution between classic oligodendroglioma and astrocytic groups. Segmental deletions were significantly more common in astrocytomas than in classic oligodendrogliomas (P = 0.006; Table 3). Segmental 1p losses in oligodendroglioma tumors made up only 9% of 1p-deleted cases, consistent with the 5% to 10% range found in other studies (2, 24–26). In contrast, in astrocytic tumors 1p losses are much less common but when present are often segmental (5 of 6, 83%).



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1 Detailed 1p LOH mapping of tumors with segmental 1p losses. MDR in tumors with oligodendroglial component (three pure ODG and three of mixed histology) is between D1S2694 and D1S2666. This is the complete extent of LOH in case 05**. Two of three informative astrocytomas with segmental 1p deletion also showed LOH patterns consistent with this MDR. Bottom, legend for the 1p results. Abbreviations: ND, not deleted; PD, partial (segmental) deletion; NI, not informative (homozygous); OD, oligodendroglioma; OA, oligoastrocytoma; AS, astrocytoma; 04*, 05**, other histologic subtypes (glioblastoma, 04* and unconventional glioneuronal neoplasm, NOS, 05**) with oligodendroglial features.

 
Definition of Minimal Region of 1p Loss Contained within CAMTA1. Initial 1p LOH analysis of tumors with partial deletions showed consistent allelic loss present in oligodendroglial and some astrocytic tumors in the telomeric region of 1p distal to D1S1612 (p36.23, 7.8 Mb). This region was further analyzed by a detailed LOH mapping using 15 microsatellite markers as shown in Fig. 1. All informative tumors in the oligodendroglial group and two of three informative astrocytomas showed allelic loss at D1S548 (p36.23, 7.1 Mb). Results in four cases are shown in Fig. 2. The minimal deleted region (MDR) was centered on D1S548 between D1S2694 (p36.23, 7.05 Mb) and D1S2666 (p36.23, 7.16 Mb). Remarkably, this MDR measures only 100 to 150 kb and it is the full extent of deletion in one tumor (05**). The latter tumor was classified as a recurrent low-grade glioneuronal neoplasm with predominantly oligodendroglioma morphology. Histologic appearance of oligodendroglial component in tumors 04* and 05** is shown in Fig. 3.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2 Representative LOH data in 1p MDR in four cases from oligodendroglial group shown in Fig. 1. Abbreviation: NI, not informative.

 


View larger version (76K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3 Histologic appearance of the oligodendroglial component in two cases with segmental 1p loss (see Fig. 1). A, tumor 04*; B, tumor 05**. Original magnification, x200.

 
Overall, a similar pattern of segmental 1p allelic loss was present in five of five informative tumors in the oligodendroglial group and two of three informative astrocytomas (Fig. 1). Two astrocytomas showed additional discrete small regions of 1p deletion at D1S171-D1S2694 (tumor AS-08) and D1S1592-D1S496 (tumor AS-09) suggesting either the presence of more than one tumor suppressor genes or a possibility of random allelic losses in astrocytic tumors.

Results of the 19q LOH assays are also shown in Fig. 1. LOH on 19q was detected in two of six (33%) oligodendroglial tumors with segmental 1p loss. This is within the expected range for a group including not only pure oligodendrogliomas but also mixed astrocytic-oligodendroglioma tumors. All four astrocytomas with segmental 1p loss that were informative for the 19q loci tested maintained heterozygosity on 19q.

Lack of Somatic Mutations in CAMTA1. The only gene currently mapped to the D1S2694-D1S2666 MDR is a recently characterized calmodulin-binding transcription activator gene, CAMTA1 (20). We searched for somatic mutations in exons encoding conserved regions of CAMTA1 using a panel of 10 tumors (with matching normal DNA). These 10 tumors included two with small segmental 1p losses (05** and AS-08, Fig. 1), four gliomas (2 oligodendrogliomas, 2 oligoastrocytomas) with well-documented large 1p deletions, and four gliomas (1 oligodendroglioma, 1 astrocytoma, and 2 oligoastrocytomas) without evidence of 1p allelic loss. Cases with deletions were studied based on the classic two-hit model that would require the remaining copy of the candidate tumor suppressor gene to be inactivated by somatic mutation. Cases without deletions were studied based on the alternative hypothesis that inactivation of only one copy of the gene may be pathogenetically significant (and therefore cases without deletions might harbor a somatic mutation instead). The following 15 exons encoding conserved regions of CAMTA1 were sequenced in each case using primers in the flanking intronic sequences: exons 1 to 2 (NLS_BP: putative nuclear localization signal), exons 3 to 7 (CG-1: DNA binding domain), exons 9 to 11 (TIG: DNA binding domain), exons 13 to 15 (ankyrin repeats), and exons 19 to 20 (IQ motif: calmodulin-binding site). Sequencing of these 15 exons showed no somatic mutations in the 10 cases analyzed. As stated above, these 10 cases included 6 cases with 1p36 LOH and 4 cases without 1p36 LOH.

Lack of Somatic Mutations in Expressed Sequence Tags in Intron 5 of CAMTA1. Because the pattern of LOH in one case (05**) suggested a very small interstitial deletion (between D1S2694 and D1S2666) roughly corresponding to intron 5 of CAMTA1, we speculated that this large intron may contain an unidentified gene. Therefore, we analyzed selected ESTs mapped to the intronic region (corresponding to clone RP3-453P22, Genbank accession no. Z97987). The sequences analyzed corresponded to rare ESTs in four small UniGene clusters and one unclustered EST (Table 2). Several single nucleotide polymorphisms were detected, but no somatic mutations were found in the same 10 cases analyzed above.

Expression Pattern of CAMTA1 in Normal Tissues. Among normal human tissues, brain and kidney showed the highest levels of CAMTA1 expression by RT-PCR (Fig. 4). The results are in agreement with publicly available gene expression data (SOURCE http://source.stanford.edu) that show highest expression of CAMTA1 in normal neural tissues. Northern blotting using a probe corresponding to exon 9 of CAMTA1 showed two transcripts (~8 and 3 kb) present at approximately same levels in samples from the different regions of normal brain (cerebellum, cerebral cortex, medulla, occipital lobe, frontal lobe, temporal lobe, and putamen) and in the spinal cord (Fig. 5). The exon composition of these two CAMTA1 transcripts is under investigation.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4 CAMTA1 expression pattern in normal tissues. A 415-bp fragment of the CAMTA1 transcript was amplified by quantitative RT-PCR. The most prominent expression was seen in brain and kidney. A control RT-PCR for the ubiquitously expressed glyceraldehyde phosphate dehydrogenase (GAPDH) transcript (983-bp product) is also shown (see text for details).

 


View larger version (134K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5 CAMTA1 expression in non-neoplastic central nervous system tissues. Northern blot analysis using a CAMTA1 cDNA fragment as a probe shows two CAMTA1 transcripts (~8 and 3 kb). The presumed full-length 8-kb transcript is seen at approximately similar levels in cerebellum, cerebral cortex, occipital lobe, frontal lobe, and temporal lobe, and seems somewhat lower in medulla, spinal cord, and putamen. Even loading of lanes was documented by hybridization with a ß-actin probe (not shown). Lane 1, cerebellum; lane 2, cerebral cortex; lane 3, medulla; lane 4, spinal cord; lane 5, occipital lobe; lane 6, frontal lobe; lane 7, temporal lobe; lane 8, putamen; lane 9, no RNA.

 
Expression of CAMTA1 by Quantitative Reverse Transcriptase-PCR in Gliomas with Defined 1p Status. Frozen tumor material for RNA extraction and quantitative real-time RT-PCR was available in a limited number of gliomas with and without 1p loss. Using undiluted normal adult brain RNA as an arbitrary reference standard, the expression level of CAMTA1 was 18% (median, 11%) that of normal adult brain in nine oligodendroglial tumors with 1p deletion (7 classic oligodendrogliomas, 2 oligoastrocytomas). Expression levels were clustered in a low range (4-26%) in all but one of these nine cases (an oligoastrocytoma that showed a level of 72%). In contrast, the CAMTA1 expression level was 33% (median, 35%) that of normal adult brain in nine oligodendroglial tumors (1 classic oligodendroglioma, 8 oligoastrocytomas) without 1 p deletion, significantly higher than the group with 1p LOH (Mann-Whitney, P = 0.03). In five astrocytomas (all without 1p LOH), the CAMTA1 expression level was 48% that of normal brain (median, 47%), significantly higher than in oligodendroglial tumors with or without 1p LOH (Mann-Whitney, P = 0.02 and P = 0.03, respectively). The results are summarized in Fig. 6.



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6 Expression levels of CAMTA1 in relation to 1p LOH status and histology. Expression levels relative to normal adult total brain RNA (see text for details). Column, average of triplicate assays. Using normal adult brain RNA as a reference, the expression level of CAMTA1 was 18% of normal (median, 11%) in the nine tumors with 1p deletion and 33% of normal (median, 35%) in nine tumors without 1 p deletion. The difference between these two groups was significant (Mann-Whitney, P = 0.03). In five astrocytomas (all without 1p LOH), the average CAMTA1 expression level was 48% that of normal brain (median, 47%), significantly higher than in oligodendroglial tumors with or without 1p LOH (Mann-Whitney, P = 0.02 and P = 0.03, respectively). Abbreviations: ODG, oligodendrogliomas; OA, oligoastrocytomas.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The association between classic oligodendroglioma morphology and an elevated prevalence of allelic losses on 1p and 19q, either isolated or combined, has been well documented in the literature (2–4). Our data on the frequencies of 1p/19q deletions in different glioma types are in concordance with other studies (2–4). We have confirmed the strong association of 1p/19q LOH and classic oligodendroglioma morphology and shown that for each histologic category, the pattern of 1p/19q losses is similar in WHO grade 2 and grade 3 tumors.

Several partially overlapping 1p MDRs have been previously described in gliomas (2,24–30) and neuroblastomas (31–37). The 1p MDR identified in this study further narrows a known MDR (D1S468-D1S1612) described in gliomas by Smith et al. (2) and overlaps the neuroblastoma 1p36 MDR (ref. 31; Fig. 7).



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7 Compilation of published data on 1p LOH mapping in gliomas and neuroblastomas. MDR described in the present study overlaps with deleted regions identified in two studies of gliomas and six studies of neuroblastomas.

 
The compilation of published data on 1p deletion mapping, presented in Fig. 7, suggests that there may be more than one tumor suppressor gene present in the distal portion of 1p. It is possible that p36.3, p36.2, and p34.2-36.1 each contain a tumor suppressor locus, and that the typically large size of 1p deletions reflects selective pressure to inactivate more than one gene. It is therefore also possible that tumors with smaller 1p deletions could be biologically different from those with more extensive 1p deletion. In this study, the subset of tumors with segmental 1p loss showed consistent LOH in a small region of 1p between polymorphic loci D1S2694 and D1S2666, mapped to p36.23. A search of publicly available human genome data reveals only one gene currently mapped to the D1S2694-D1S2666 region, a recently described calmodulin-binding transcription activator, CAMTA1. Although no function has been attributed to any of the CAMTA proteins to date, based on domain organization they likely represent transcription factors. Bouche et al. (20) have shown that CAMTA proteins localize to the nucleus, bind DNA, and can activate transcription. The conserved regions of the CAMTA1 protein include NLS_BP (bipartite nuclear localization signal encoded by exons 1-2 and 5), CG-1 (DNA binding domain thought to provide sequence specificity and encoded by exons 3-7), TIG (nonspecific DNA binding domain encoded by exons 9-11), ankyrin repeats (involved in protein-protein interactions and encoded by exons 13-15), and IQ motif (calmodulin-binding site encoded by exons 19-20). Although expressed in various tissues, the highest expression of CAMTA1 is seen in neural tissues and kidney. The gene is unusually large, spanning ~1 Mb between 6.5 and 7.5 Mb on 1p and, remarkably, encompasses five polymorphic loci used in the present study (D1S214, D1S2694, D1S548, D1S2666, and D1S508; Fig. 8). Because the D1S2694-D1S2666 MDR is located entirely within intron 5 of CAMTA1, we also examined some ESTs mapped to this intron (Table 2) for somatic mutations but found none.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8 Candidate glioma tumor suppressor region at 1p36.23. Schematic picture consisting of annotated output from Ensembl Genome Browser showing CAMTA1 gene structure in relation to Genbank DNA sequence accessions, polymorphic markers (five markers used in the present study located within CAMTA1), and chromosome position in megabases from the 1p telomere.

 
The predominantly neural expression of CAMTA1 makes it attractive as a candidate 1p36 tumor suppressor in several tumors with neural or neuroectodermal features, including oligodendroglioma, neuroblastoma, and also Ewing's sarcoma where 1p36 LOH has been reported in ~15% of cases (38, 39). Indeed, the fact that the 1p MDR in gliomas shown here (D1S2694-D1S2666) overlaps the neuroblastoma MDR (D1S2731-D1S2666; (ref. 31), as shown in Fig. 7, is particularly intriguing and suggests that the analysis of CAMTA1 as a candidate tumor suppressor gene should be extended to neuroblastomas.

Mutation analysis of oligodendroglial tumors with 1p LOH showed no evidence of somatic mutations in CAMTA1 exons encoding conserved domains arguing against a classic two hit mechanism. Mutation analysis of gliomas without 1p LOH also showed no evidence of somatic mutations in CAMTA1, suggesting that CAMTA1 mutation does not substitute for 1p deletion in these tumors.

Our finding that CAMTA1 transcript levels in oligodendroglial tumors with 1p LOH were essentially halved compared with cases without 1p LOH supports biallelic expression of CAMTA1. Continued expression from the remaining CAMTA1 allele in 1p-deleted cases is inconsistent with promoter hypermethylation as a second hit but raises the possibility that CAMTA1 haploinsufficiency may be functionally significant. Tumor suppressors for which haploinsufficiency is pathogenetically significant are being described in increasing numbers (for review see ref. 40). Cell cycle regulatory tumor suppressor genes seem especially dosage-sensitive (40). This is intriguing given that CAMTA1 expression levels change during the cell cycle suggestive of involvement in cell cycle regulation, at least in certain cellular contexts (41).

The high prevalence of hemizygous 1p deletions and rarity or absence of homozygous 1p deletions in gliomas and neuroblastomas suggests that there may be a selective advantage for haploinsufficiency of this tumor suppressor gene (possibly CAMTA1), but that loss of the remaining gene copy may be detrimental. Imprinting seems unlikely since there is no evidence for parent-of-origin effects for 1p36 deletions in either gliomas or neuroblastomas (42, 43) . Whether the low expression level of CAMTA1 in oligodendroglial tumors without 1p deletion is due to hypermethylation of promoter CpG islands or differences in CAMTA1 promoter activation due to cellular context or merely reflects the presence of other highly expressing cell types in normal adult brain remains to be investigated.

Finally, the findings of two recent studies further strengthen the candidacy of CAMTA1 as an oligodendroglioma tumor suppressor gene. In a glioma gene expression profiling study (44), Mukasa et al. identified CAMTA1 as one of the top differentially overexpressed genes in astrocytomas relative to oligodendroglioma and glioblastomas (or conversely, underexpressed in oligodendroglioma and glioblastoma relative to astrocytomas). These results parallel our quantitative RT-PCR data. The second study is that of Hahn et al. (45), who used a bioinformatics approach to systematically identify chimeric transcripts present in human mRNA and EST databases. Remarkably, in an oligodendroglioma EST library, they found an out-of-frame fusion involving CAMTA1 (no. 82 in their Supplementary Table 3), representing a chromosomal inversion whose likely functional consequence is to effectively inactivate one copy of CAMTA1 in that tumor.


    ACKNOWLEDGMENTS
 
We thank Dr. Nathan Ellis, Dr. Diane Tabarini, Miguel Ilzarbe, and Donna Wong of the Memorial Sloan-Kettering Cancer Center Core DNA Sequencing Facility for their help and Dr. Qiulu Pan for expert technical advice.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Presented in part at the Annual Meeting of the United States and Canadian Academy of Pathology, March 8, 2004, Vancouver, British Columbia, Canada.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Cairncross JG, Ueki K, Zlatescu MC, et al. Specific genetic predictors of chemotherapeutic response and survival in patients with anaplastic oligodendrogliomas. J Natl Cancer Inst 1998;90:1473–9.[Abstract/Free Full Text]
  2. Smith JS, Alderete B, Minn Y, et al. Localization of common deletion regions on 1p and 19q in human gliomas and their association with histological subtype. Oncogene 1999;18:4144–52.[CrossRef][Medline]
  3. Bigner SH, Matthews MR, Rasheed BK, et al. Molecular genetic aspects of oligodendrogliomas including analysis by comparative genomic hybridization. Am J Pathol 1999;155:375–86.[Abstract/Free Full Text]
  4. Gelpi E, Ambros IM, Birner P, et al. Fluorescent in situ hybridization on isolated tumor cell nuclei: a sensitive method for 1p and 19q deletion analysis in paraffin-embedded oligodendroglial tumor specimens. Mod Pathol 2003;16:708–15.[CrossRef][Medline]
  5. Ragnarsson G, Eiriksdottir G, Johannsdottir JT, Jonasson JG, Egilsson V, Ingvarsson S. Loss of heterozygosity at chromosome 1p in different solid human tumours: association with survival. Br J Cancer 1999;79:1468–74.[CrossRef][Medline]
  6. Alonso ME, Bello MJ, Gonzalez-Gomez P, et al. Mutation analysis of the p73 gene in nonastrocytic brain tumours. Br J Cancer 2001;85:204–8.[CrossRef][Medline]
  7. Mai M, Huang H, Reed C, et al. Genomic organization and mutation analysis of p73 in oligodendrogliomas with chromosome 1 p-arm deletions. Genomics 1998;51:359–63.[CrossRef][Medline]
  8. Kaghad M, Bonnet H, Yang A, et al. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell 1997;90:809–19.[CrossRef][Medline]
  9. Ichimiya S, Nimura Y, Kageyama H, et al. p73 at chromosome 1p36.3 is lost in advanced stage neuroblastoma but its mutation is infrequent. Oncogene 1999;18:1061–6.[CrossRef][Medline]
  10. Ejeskar K, Sjoberg RM, Kogner P, Martinsson T. Variable expression and absence of mutations in p73 in primary neuroblastoma tumors argues against a role in neuroblastoma development. Int J Mol Med 1999;3:585–9.[Medline]
  11. Yang HW, Chen YZ, Takita J, Soeda E, Piao HY, Hayashi Y. Genomic structure and mutational analysis of the human KIF1B gene which is homozygously deleted in neuroblastoma at chromosome 1p36.2. Oncogene 2001;20:5075–83.[CrossRef][Medline]
  12. Chen YY, Takita J, Chen YZ, et al. Genomic structure and mutational analysis of the human KIF1B{alpha} gene located at 1p36.2 in neuroblastoma. Int J Oncol 2003;23:737–44.[Medline]
  13. Bello MJ, de Campos JM, Vaquero J, et al. hRAD54 gene and 1p high-resolution deletion-mapping analyses in oligodendrogliomas. Cancer Genet Cytogenet 2000;116:142–7.[CrossRef][Medline]
  14. Maris JM, Jensen J, Sulman EP, et al. Human Kruppel-related 3 (HKR3): a candidate for the 1p36 neuroblastoma tumour suppressor gene? Eur J Cancer 1997;33:1991–6.
  15. Krona C, Ejeskar K, Abel F, et al. Screening for gene mutations in a 500 kb neuroblastoma tumor suppressor candidate region in chromosome 1p; mutation and stage-specific expression in UBE4B/UFD2. Oncogene 2003;22:2343–51.[CrossRef][Medline]
  16. Thompson PM, Gotoh T, Kok M, White PS, Brodeur GM. CHD5, a new member of the chromodomain gene family, is preferentially expressed in the nervous system. Oncogene 2003;22:1002–11.[CrossRef][Medline]
  17. Mathysen D, Van Roy N, Van Hul W, et al. Molecular analysis of the putative tumour-suppressor gene EXTL1 in neuroblastoma patients and cell lines. Eur J Cancer 2004;40:1255–61.
  18. Tikoo A, Czekay S, Viars C, et al. p190-A, a human tumor suppressor gene, maps to the chromosomal region 19q13.3 that is reportedly deleted in some gliomas. Gene 2000;257:23–31.[CrossRef][Medline]
  19. Wolf RM, Draghi N, Liang X, et al. p190RhoGAP can act to inhibit PDGF-induced gliomas in mice: a putative tumor suppressor encoded on human chromosome 19q13.3. Genes Dev 2003;17:476–87.[Abstract/Free Full Text]
  20. Bouche N, Scharlat A, Snedden W, Bouchez D, Fromm H. A novel family of calmodulin-binding transcription activators in multicellular organisms. J Biol Chem 2002;277:21851–61.[Abstract/Free Full Text]
  21. Uchida S, Wang L, Yahagi Y, Tokunaga K, Tadokoro K, Juji T. Utility of fingernail DNA for evaluation of chimerism after bone marrow transplantation and for diagnostic testing for transfusion-associated graft-versus-host disease. Blood 1996;87:4015–6.[Free Full Text]
  22. Kaneshige T, Takagi K, Nakamura S, Hirasawa T, Sada M, Uchida K. Genetic analysis using fingernail DNA. Nucleic Acids Res 1992;20:5489–90.[Free Full Text]
  23. Bachmann HS, Siffert W, Frey UH. Successful amplification of extremely GC-rich promoter regions using a novel "slowdown PCR" technique. Pharmacogenetics 2003;13:759–66.[CrossRef][Medline]
  24. Iuchi T, Namba H, Iwadate Y, et al. Identification of the small interstitial deletion at chromosome band 1p34-p35 and its association with poor outcome in oligodendroglial tumors. Genes Chromosomes Cancer 2002;35:170–5.[CrossRef][Medline]
  25. Hashimoto N, Murakami M, Takahashi Y, Fujimoto M, Inazawa J, Mineura K. Correlation between genetic alteration and long-term clinical outcome of patients with oligodendroglial tumors, with identification of a consistent region of deletion on chromosome arm 1p. Cancer 2003;97:2254–61.[CrossRef][Medline]
  26. Felsberg J, Erkwoh A, Sabel MC, et al. Oligodendroglial tumors: refinement of candidate regions on chromosome arm 1p and correlation of 1p/19q- status with survival. Brain Pathology 2004;14:121–30.[Medline]
  27. Reifenberger J, Reifenberger G, Liu L, James CD, Wechsler W, Collins VP. Molecular genetic analysis of oligodendroglial tumors shows preferential allelic deletions on 19q and 1p. Am J Pathol 1994;145:1175–90.[Abstract]
  28. Bello MJ, Leone PE, Vaquero J, et al. Allelic loss at 1p and 19q frequently occurs in association and may represent early oncogenic events in oligodendroglial tumors. Int J Cancer 1995;64:207–10.[Medline]
  29. Zhu JJ, Santarius T, Wu X, et al. Screening for loss of heterozygosity and microsatellite instability in oligodendrogliomas. Genes Chromosomes Cancer 1998;21:207–16.[CrossRef][Medline]
  30. Husemann K, Wolter M, Buschges R, Bostrom J, Sabel M, Reifenberger G. Identification of two distinct deleted regions on the short arm of chromosome 1 and rare mutation of the CDKN2C gene from 1p32 in oligodendroglial tumors. J Neuropathol Exp Neurol 1999;58:1041–50.[Medline]
  31. Bauer A, Savelyeva L, Claas A, Praml C, Berthold F, Schwab M. Smallest region of overlapping deletion in 1p36 in human neuroblastoma: a 1 Mbp cosmid and PAC contig. Genes Chromosomes Cancer 2001;31:228–39.[CrossRef][Medline]
  32. Mora J, Cheung NK, Kushner BH, et al. Clinical categories of neuroblastoma are associated with different patterns of loss of heterozygosity on chromosome arm 1p. J Mol Diagn 2000;2:37–46.[Abstract/Free Full Text]
  33. Caron H, Spieker N, Godfried M, et al. Chromosome bands 1p35-36 contain two distinct neuroblastoma tumor suppressor loci, one of which is imprinted. Genes Chromosomes Cancer 2001;30:168–74.[CrossRef][Medline]
  34. Hogarty MD, Liu X, Guo C, et al. Identification of a 1-megabase consensus region of deletion at 1p36.3 in primary neuroblastomas. Med Pediatr Oncol 2000;35:512–5.[CrossRef][Medline]
  35. Amler LC, Corvi R, Praml C, Savelyeva L, Le Paslier D, Schwab M. A reciprocal translocation (1;15) (36.2;q24) in a neuroblastoma cell line is accompanied by DNA duplication and may signal the site of a putative tumor suppressor-gene. Oncogene 1995;10:1095–101.[Medline]
  36. White PS, Maris JM, Beltinger C, et al. A region of consistent deletion in neuroblastoma maps within human chromosome 1p36.2-36.3. Proc Natl Acad Sci U S A 1995;92:5520–4.[Abstract/Free Full Text]
  37. Martinsson T, Sjoberg RM, Hedborg F, Kogner P. Deletion of chromosome 1p loci and microsatellite instability in neuroblastomas analyzed with short-tandem repeat polymorphisms. Cancer Res 1995;55:5681–6.[Abstract/Free Full Text]
  38. Hattinger CM, Rumpler S, Strehl S, et al. Prognostic impact of deletions at 1p36 and numerical aberrations in Ewing tumors. Genes Chromosomes Cancer 1999;24:243–54.[CrossRef][Medline]
  39. Ozaki T, Paulussen M, Poremba C, et al. Genetic imbalances revealed by comparative genomic hybridization in Ewing tumors. Genes Chromosomes Cancer 2001;32:164–71.[CrossRef][Medline]
  40. Santarosa M, Ashworth A. Haploinsufficiency for tumour suppressor genes: when you don't need to go all the way. Biochim Biophys Acta 2004;1654:105–22.[Medline]
  41. Nakatani K, Nishioka J, Itakura T, et al. Cell cycle-dependent transcriptional regulation of calmodulin-binding transcription activator 1 in neuroblastoma cells. Int J Oncol 2004;24:1407–12.[Medline]
  42. Hogarty MD, Winter CL, Liu X, et al. No evidence for the presence of an imprinted neuroblastoma suppressor gene within chromosome sub-band 1p36.3. Cancer Res 2002;62:6481–4.[Abstract/Free Full Text]
  43. Sanson M, Leuraud P, Marie Y, Delattre JY, Hoang-Xuan K. Preferential loss of paternal 19q, but not 1p, alleles in oligodendrogliomas. Ann Neurol 2002;52:105–7.[CrossRef][Medline]
  44. Mukasa A, Ueki K, Ge X, et al. Selective expression of a subset of neuronal genes in oligodendroglioma with chromosome 1p loss. Brain Pathol 2004;14:34–42.[Medline]
  45. Hahn Y, Bera TK, Gehlhaus K, Kirsch IR, Pastan IH, Lee B. Finding fusion genes resulting from chromosome rearrangement by analyzing the expressed sequence databases. Proc Natl Acad Sci U S A 2004;101:13257–61.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Neuroradiol.Home page
K.E. Emblem, D. Scheie, P. Due-Tonnessen, B. Nedregaard, T. Nome, J.K. Hald, K. Beiske, T.R. Meling, and A. Bjornerud
Histogram Analysis of MR Imaging-Derived Cerebral Blood Volume Maps: Combined Glioma Grading and Identification of Low-Grade Oligodendroglial Subtypes
AJNR Am. J. Neuroradiol., October 1, 2008; 29(9): 1664 - 1670.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Bagchi and A. A. Mills
The Quest for the 1p36 Tumor Suppressor
Cancer Res., April 15, 2008; 68(8): 2551 - 2556.
[Abstract] [Full Text] [PDF]


Home page
Neuro OncolHome page
M. Longoni, F. Orzan, M. Stroppi, N. Boari, P. Mortini, and P. Riva
Evaluation of 1p36 markers and clinical outcome in a skull base chordoma study
Neuro-oncol, February 1, 2008; 10(1): 52 - 60.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
A. Li, J. Walling, Y. Kotliarov, A. Center, M. E. Steed, S. J. Ahn, M. Rosenblum, T. Mikkelsen, J. C. Zenklusen, and H. A. Fine
Genomic Changes and Gene Expression Profiles Reveal That Established Glioma Cell Lines Are Poorly Representative of Primary Human Gliomas
Mol. Cancer Res., January 1, 2008; 6(1): 21 - 30.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Gong, J. Han, K. Reddig, and H.-S. Li
A Potential Dimerization Region of dCAMTA Is Critical for Termination of Fly Visual Response
J. Biol. Chem., July 20, 2007; 282(29): 21253 - 21258.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. J. Huentelman, A. Papassotiropoulos, D. W. Craig, F. J. Hoerndli, J. V. Pearson, K.-D. Huynh, J. Corneveaux, J. Hanggi, C. R.A. Mondadori, A. Buchmann, et al.
Calmodulin-binding transcription activator 1 (CAMTA1) alleles predispose human episodic memory performance
Hum. Mol. Genet., June 15, 2007; 16(12): 1469 - 1477.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Q. Wang, S. Diskin, E. Rappaport, E. Attiyeh, Y. Mosse, D. Shue, E. Seiser, J. Jagannathan, S. Shusterman, M. Bansal, et al.
Integrative genomics identifies distinct molecular classes of neuroblastoma and shows that multiple genes are targeted by regional alterations in DNA copy number.
Cancer Res., June 15, 2006; 66(12): 6050 - 6062.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
K. A. Jaeckle, K. V. Ballman, R. D. Rao, R. B. Jenkins, and J. C. Buckner
Current Strategies in Treatment of Oligodendroglioma: Evolution of Molecular Signatures of Response
J. Clin. Oncol., March 10, 2006; 24(8): 1246 - 1252.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K.-O. Henrich, M. Fischer, D. Mertens, A. Benner, R. Wiedemeyer, B. Brors, A. Oberthuer, F. Berthold, J. S. Wei, J. Khan, et al.
Reduced Expression of CAMTA1 Correlates with Adverse Outcome in Neuroblastoma Patients
Clin. Cancer Res., January 1, 2006; 12(1): 131 - 138.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barbashina, V.
Right arrow Articles by Ladanyi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barbashina, V.
Right arrow Articles by Ladanyi, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research