Clinical Cancer Research Landon Prizes for Basic and Translational Cancer Research Infection and Cancer: Biology, Therapeutics, and Prevention
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rein, D. T.
Right arrow Articles by Curiel, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rein, D. T.
Right arrow Articles by Curiel, D. T.
Clinical Cancer Research Vol. 11, 1327-1335, February 2005
© 2005 American Association for Cancer Research

Cancer Therapy: Preclinical

A Fiber-Modified, Secretory Leukoprotease Inhibitor Promoter-Based Conditionally Replicating Adenovirus for Treatment of Ovarian Cancer

Daniel T. Rein1,4, Martina Breidenbach1,5, Tyler O. Kirby3, Tie Han1, Gene P. Siegal2, Gerd J. Bauerschmitz4, Minghui Wang1, Dirk M. Nettelbeck6, Yuko Tsuruta1, Masato Yamamoto1, Peter Dall4, Akseli Hemminki7 and David T. Curiel1

1 Division of Human Gene Therapy, Departments of Medicine, Surgery, and Pathology and Gene Therapy Center, 2 Departments of Pathology, Cell Biology, and Surgery and Gene Therapy Center, and 3 Division of Gynecologic Oncology, University of Alabama at Birmingham, Birmingham, Alabama; 4 Department of Obstetrics and Gynecology, University of Düsseldorf Medical Center, Düsseldorf, Germany; 5 Department of Obstetrics and Gynecology, Rhine-Westphalian Technical University, Aachen, Germany; 6 Department of Dermatology, University of Erlangen-Nürnberg, Erlangen, Germany; and 7 Rational Drug Design Program, University of Helsinki and Department of Oncology, Helsinki University Central Hospital, Helsinki, Finland

Requests for reprints: David T. Curiel, Division of Human Gene Therapy, Gene Therapy Center, 901 19th Street South, BMR2-508, University of Alabama at Birmingham, Birmingham, AL 35294-2172. Phone: 205-934-8627; Fax: 205-975-2961; E-mail: david.curiel{at}ccc.uab.edu.


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Purpose: The use of conditionally replicating adenoviruses (CRAD) is dependent on molecular differences between tumor cells and nontumor cells. Transcriptional targeting of CRAD replication via tumor-specific promoters is an effective way to control replication regulation. Genetic fiber pseudotyping is an approach for circumventing low expression of the primary adenovirus serotype 5 (Ad5) receptor by using the distinct adenovirus serotype 3 (Ad3) receptor for entry into and subsequent killing of ovarian cancer cells.

Experimental Design: In this study, we constructed a fiber-modified CRAD containing the secretory leukoprotease inhibitor (SLPI) promoter to control viral replication via the E1A gene (Ad5/3SLPI). To evaluate the liver toxicity of chimeric 5/3 fiber-modified CRADs, we compared Ad5/3SLPI with Ad5/3Cox-2L, a CRAD with E1A under control of the Cox-2 promoter, and Ad5/3{Delta}24, a CRAD that replicates in cancer cells inactive in the retinoblastoma/p16 pathway by use of an in vivo hepatotoxicity model and by a model system that uses slices of human liver.

Results: We show efficient viral replication and oncolysis of Ad5/3SLPI in both multiple ovarian cancer cell lines and primary tumor cell spheroids as well as therapeutic efficacy in an orthotopic mouse model of peritoneal carcinomatosis. Ad5/3SLPI showed significantly decreased liver toxicity compared with other 5/3 fiber-modified control vectors examined.

Conclusions: In summary, Ad5/3SLPI is a promising vector candidate for treating metastatic ovarian cancer and showed robust virus replication, oncolysis, and in vivo therapeutic efficacy. Ad5/3SLPI showed comparatively low liver toxicity and therefore holds potential for patient use in the clinic.

Key Words: ovarian cancer • SLPI • adenovirus • liver toxicity • promoter


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ovarian cancer is the most fatal gynecologic malignancy in the United States, and the incidence is reported to be increasing (1). The majority of patients present with peritoneally disseminated disease, which is associated with a poor prognosis. In this regard, anticancer molecular therapies have been proposed as a treatment alternative for advanced cancers refractory to conventional treatment modalities. To this end, adenoviral vectors have been used for a variety of gene therapy applications (2). Unfortunately, the efficacy of gene transfer to solid tumors has been limited; thus, there is little evidence supporting significant clinical benefit, albeit only phase I and II trials have been reported (3, 4). To overcome this obstacle, conditionally replicating adenoviruses (CRAD) have emerged as novel therapeutic agents for a variety of neoplastic diseases, which led to their rapid translation into clinical trials (5, 6). CRADs have been designed to replicate in tumor cells whereby the viral replication results in oncolysis and subsequent release of the virus progeny (7, 8) .

Two strategies have been employed to restrict virus replication to target cells and to spare normal tissue. "Genetic complementation"–type (a.k.a. "type 1") CRADs (9, 10), such as Ad5{Delta}24, have a mutation in the immediately early (E1A) or early (E1B) adenoviral region, which is complemented in tumor cells but not in normal cells. In "transcomplementation"-type (a.k.a. "type 2") CRADs, virus replication is controlled via a tumor/tissue-specific promoter (11). However, in both instances, ectopic liver transduction is the major predicate of adenoviral vector–induced toxicity. Therefore, it is rational to choose a tumor-specific promoter, which is highly expressed in the tumor but has potentially low activity in the liver.

One of the most promising promoters for ovarian cancer is the promoter for secretory leukoprotease inhibitor (SLPI). SLPI is a 11.7-kDa serine protease inhibitor that has been described to be highly expressed in different human carcinomas, including those derived from breast, lung, endometrium, and ovary (12). SLPI gene expression has been investigated in cell lines and tissues. Northern blot analysis has been employed to measure the levels of SLPI gene expression in SKOV3.ip1 ovarian cancer cells (13). Gene expression analysis has been used to show that SLPI is 60-fold up-regulated in ovarian carcinomas compared with normal ovarian epithelium (14). In addition, SLPI is minimally expressed in the normal liver (15). Finally, quantitative real-time PCR was used to analyze a panel of 39 microdissected ovarian carcinomas for the presence of genes expected to be up-regulated. The SLPI gene was found to be overexpressed at high levels in all of the ovarian cancer subtypes examined (16). Based on these considerations, the SLPI promoter has been investigated recently as a clinically applicable agent and described as useful in the context of ovarian cancer gene therapy (17, 18). Recent studies have shown that the oncolytic potency of a CRAD agent is directly determined by its ability to infect target cells (19). Unfortunately, in the field of ovarian cancer, transduction efficacy by adenovirus serotype 5 (Ad5) is frequently suboptimal due to the highly variable and often low expression pattern of the primary adenovirus receptor, coxsackie adenovirus receptor (CAR; refs. 20–22). In contrast, CAR is expressed ubiquitously on most normal tissues. High liver transduction by adenoviral vectors following systemic administration can lead to severe side effects and therefore restricts i.v. application of adenoviral vectors. Several strategies have been developed to alter the tropism of adenovirus to improve its utility as a gene transfer vector. Increased transduction of low CAR tumor cells can be achieved via genetic retargeting approaches. One such approach is the substitution of Ad5 with a fiber knob deriving from adenovirus serotype 3 (Ad3). Ad5/3 chimeras have displayed enhanced infectivity of ovarian cancer cells without increasing gene delivery to murine livers (23, 24). It was the purpose of this study to develop a novel 5/3 fiber-modified, SLPI-based CRAD (Ad5/3SLPI), and oncolytic activity and selectivity was shown using established ovarian cancer cell lines as well as purified ovarian cancer cells from patients. Potent antitumor efficacy was shown in a xenograft model of i.p. ovarian cancer after i.p. virus injection because the compartmentalized nature of ovarian cancer creates a rationale for locoregional treatment.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines. Hey, OV-4, and SKOV3.ip1 ovarian adenocarcinoma cell lines were kind gifts from Dr. Timothy J. Eberlein (Harvard Medical School, Boston, MA) and Drs. Judy Wolf and Janet Price (both from University of Texas M.D. Anderson Cancer Center, Houston, TX), respectively. The ovarian adenocarcinoma cell line OV-3 was obtained from American Type Culture Collection (Manassas, VA). The lung adenocarcinoma cell line A549 was a kind gift from Dr. A.J. van der Eb (University of Leiden, Leiden, the Netherlands). Cell lines were maintained under recommended conditions. Cells were grown at 37°C in a humidified atmosphere of 5% CO2. Fresh malignant ascites fluid samples from three patients with pathologically confirmed ovarian adenocarcinoma were obtained from the University of Alabama at Birmingham Hospital (Birmingham, AL) following informed consent and institutional review board approval. Cancer cells were purified using a previously described immunomagnetic-based method (24, 25). Briefly, ovarian cancer cells endogenously displaying B72.3 on their cell surfaces were initially bound with a mouse anti–tumor-associated glycoprotein 72 antibody and subsequently collected with magnetic beads coated with anti-mouse IgG. To create three-dimensional spheroids, cells were suspended in growth medium in 3% agar-coated flasks and incubated overnight at 37°C in a 5% CO2 environment on a rocker.

Recombinant Adenoviruses. A fiber shuttle vector, pNEB.PK.F5/3, containing an Ad5 tail and shaft and an Ad3 knob was digested with EagI and KpnI and used for homologous recombination with SwaI linearized plasmid pVK500, generating pAdback5/3. Subsequent homologous recombination with shuttle plasmids (26) pSESLPI or pSECox-2L that contained the E1A gene downstream of the 1,320-bp SLPI promoter (17) or Cox-2L promoter (11) resulted in plasmids pAd5/3.SLPI or pAd5/3Cox-2L, respectively, which contained the recombinant adenoviral genomes. Plasmids were validated for promoter insertion and fiber gene modification by PCR and restriction digest. Adenoviral particles were produced by transfection of PacI-digested pAd plasmids into HeLa cells using LipofectAMINE (Life Technologies, Rockville, MD) following the manufacturer's protocol. The presence of the E3 region and the 5/3 fiber knob modification were confirmed with PCR. The absence of wild-type E1A was confirmed with PCR. Generation of recombinant adenoviruses Ad5/3wt, Ad5/3{Delta}24, and Ad5/3Luc was described elsewhere (23, 27, 28) . All vectors contain chimeric fibers with the tail and shaft domains of Ad5 and the knob domain of Ad3. Ad5/3wt contains the wild-type Ad5 genome, and Ad5/3{Delta}24 contains a 24-bp deletion in the constant region 2 of E1A. Ad5/3Luc is a replication-incompetent adenoviral vector containing a firefly luciferase transgene cassette in place of the deleted E1 region. All replicative adenoviruses were amplified on HeLa cells to avoid wild-type contamination. Replication-deficient, E1-deleted Ad5/3Luc has been amplified in 293 cells. Purification was done with double CsCl gradients using standard methods. The viral particle (vp) concentration was determined at 260 nm, and standard plaque assay on 291 cells was done to determine infectious particles. The ratios of vp to infectious particles were 9.8, 12.4, 7.6, 4.7, and 45.7 for Ad5/3.SLPI, Ad5/3Cox-2L, Ad5/3wt, Ad5/3{Delta}24, and Ad5/3Luc, respectively.

In vitro Cytotoxicity Assay. Cells in triplicate were infected for 1 hour at 37°C in 50 µL growth medium with 2% fetal bovine serum. Thereafter, cells were incubated with 5% growth medium. Cell viability was measured using the CellTiter 96 AQueous One Solution Cell Proliferation Assay [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxy-phenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt assay, Promega, Madison, WI] on day 6 (SKOV3.ip1 and OV-3), day 10 (Hey), or day 13 (OV-4) as described previously (27). The results with Ad5/3SLPI were compared with those of the other viruses using two-tailed Student's t test. For crystal violet staining (29), cells were plated and infected on six-well plates, and infection volume was brought to 500 µL. Oncolysis was evaluated when Ad5wt or Ad5/3wt showed clear oncolysis with the lowest amount of virus.

Quantitating Virus Replication. Primary ovarian cancer cells were purified and cultured as spheroids overnight. The next day, spheroids were infected with 1,000 vp/cell with Ad5wt, Ad5/3wt, Ad5/3SLPI, Ad5/3luc, or no virus. Then, the spheroids were divided into aliquots of 105 cells in Costar 96-well ultralow attachment plates (Corning, Inc., Corning, NY). Cells and growth medium were harvested together and frozen at 1, 2, 3, 4, and 5 days after infection. Purification of the DNA and quantitative PCR for E4 were done as described previously (27). To quantitate the total E4 copy number, DNA was purified from the spheroid suspension (cellular and growth medium fractions) using a DNeasy Tissue kit (Qiagen, Santa Clarita, CA). The primers used for amplifying the E4 were forward 5'-GGAGTGCGCCGAGACAAC-3' and reverse 5'-ACTACGTCCGGCGTTCCAT-3' and detected with the probe 5'-TGGCATGACACTACGACCAACAC-3'. Human ß-actin was amplified to control for housekeeping gene copies within the cells as described previously (30).

Therapeutic Ovarian Cancer Model. Mice were obtained at 3 to 4 weeks of age and quarantined at least 1 week before beginning the study. Mice were kept under pathogen-free conditions according to the American Association for Accreditation of Laboratory Animal Care guidelines. Animal protocols were reviewed and approved by the Institutional Animal Care and Use Committee of University of Alabama at Birmingham. Female CB17 severe combined immunodeficient mice (University of Alabama at Birmingham Centers for AIDS Research Mouse Core Facility) were injected i.p. with 1 x 107 SKOV3.ip1 cells on day 0. On days 10, 11, and 12, mice were injected i.p. with 1 x 108 vp of Ad5/3SLPI (n = 10), Ad5/3Cox-2 (n = 10), Ad5/3wt (n = 10), Ad5wt (n = 10), Ad5/3luc (n = 9), or no virus (n = 9) in 500 µL Opti-MEM (Mediatech, Herndon, VA). In another experiment, mice were injected i.p. on days 10 and 11 with 5 x 109 vp of Ad5/3SLPI (n = 10), Ad5/3Cox-2 (n = 10), Ad5/3wt (n = 10), Ad5wt (n = 10), Ad5/3luc (n = 9), or no virus (n = 9) in 500 µL Opti-MEM. Mice were followed daily and killed when there was any evidence of pain or distress. Survival data were plotted as a Kaplan-Meier curve, and the Ad5/3SLPI group was compared with the other groups using log-rank analysis and {chi}2 testing via Prism 4 software (GraphPad Software, San Diego, CA).

In vivo Toxicity Study. To evaluate the potential liver toxicity of different 5/3 fiber-modified CRADs in vivo, female C57BL/6 mice were injected i.p. with 5 x 1010 vp of Ad5/3SLPI, Ad5/3Cox-2, Ad5/3-{Delta}24, Ad5/3wt, Ad5wt, and Ad5/3luc. After 48 hours, mice were killed and the livers were harvested and fixed in 10% buffered formalin. Serial paraffin-embedded sections were taken and stained with H&E under standard conditions. Histopathology was scored in a blinded manner by an expert pathologist (G.P.S.). Two other liver samples were snap frozen on dry ice. To analyze the E1 RNA level, total RNA from the liver was extracted with a RNeasy Mini kit (Qiagen). A GeneAmp RNA PCR core kit (Applied Biosystems, Foster City, CA) was used for cDNA synthesis and PCR amplification of cDNA products. Taqman primers and probes were designed by the Primer Express 1.0 software and synthesized by Applied Biosystems. Oligonucleotide sequences for amplification of the E1A gene were forward primer AACCAGTTGCCGTGAGAGTTG, reverse primer CTCGTTAAGCAAGTCCTCGATACA, and probe 6FAM-CACAGCCTGGCGACGCCCA-TAMRA. The human housekeeping gene GAPDH was used as an internal control. The sequences to amplify GAPDH gene were forward primer GGTTTACATGTTCCAATATGATTCCA, reverse primer ATGGGATTTCCATTGATGACAAG, and probe 6FAM-CGTTCTCGCCTTGACGGTGCCAT-TAMRA. With optimized concentration of primers and probe, the components of the real-time PCR mixture were designed to result in a master mix with a final volume of 9 µL per reaction containing 1x Taqman EZ RT-PCT kit (Applied Biosystems), 100 nmol/L forward primer, 100 nmol/L reverse primer, 100 nmol/L probe, and 0.025% bovine serum albumin. Total RNA sample (1 µL) was added to 9 µL PCR mixture in each reaction capillary. A negative control (no template) received 1 µL water. For the assay, a known amount of E1A RNA (108, 106, 104, and 102 copies per µL) was amplified to generate a standard curve for quantification of the E1A copy numbers. Capillaries were sealed and centrifuged using a LC Carousel Centrifuge (Roche Molecular Biochemicals, Indianapolis, IN) to facilitate mixing. All PCR reactions were carried out using a LightCycler System (Roche Molecular Biochemicals). Thermal cycling conditions were 2 minutes at 50°C, 30 minutes at 60°C, 5 minutes at 95°C, and 40 cycles of 20 seconds at 94°C and 1 minute at 60°C. Data were analyzed with LightCycler software.

Precision-Cut Human Liver Slices. Human liver tissue was obtained from livers taken from multiorgan donors following institutional review board approval. Informed consent was obtained from the legal next-of-kin for the explantation of organs for transplantation purposes. Excess material was received from donor livers reduced in size to perform transplantation at the University of Alabama at Birmingham Hospital. The donor livers were perfused in situ with University of Wisconsin solution at 4°C and kept on ice until reduction. Precision-cut liver slices (diameter 4 mm, thickness 150 µm) were prepared using a Krumdiek Tissue Slicer (Alabama Research and Development, Munford, AL). Each slice was transferred into a well of a 24-well plate containing 1 mL William's Medium E and placed on a rocker. Liver slices were maintained at 37°C in a 5% CO2 environment on a rocker and allowed to preincubate for 2 hours before treatment. Liver slices were infected with 50 vp/cell with Ad5wt, Ad5/3wt, Ad5/3Cox-2, Ad5/3SLPI, Ad5/3{Delta}24, Ad5/3luc, or no virus. Liver slices were harvested and frozen at 12, 24, 36, and 48 hours after infection. To analyze the E1A RNA level, total RNA was extracted from the liver using a RNeasy Mini kit (Qiagen). Quantitative reverse transcription-PCR was done as described above.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
In vitro Oncolytic Potency of Ad5/3SLPI. To analyze the specificity of Ad5/3SLPI, we infected monolayers of HeLa cells, which have been reported to express high levels of the SLPI gene, and A549 cells, which express low levels of the SLPI gene, as positive and negative control cell line (17), respectively. In both cell lines, the crystal violet staining–based cell killing assay showed complete oncolysis with Ad5/3wt and Ad5wt (Fig. 1). Ad5/3SLPI caused almost complete cell killing in SLPI-positive HeLa cells but did not cause oncolysis in the negative control cell line A549. Ad5/3luc was included as a nonreplicative control and did not cause oncolysis. These experiments thus indicated a specific cell killing effect of Ad5/3SLPI in SLPI-positive cells.



View larger version (98K):
[in this window]
[in a new window]
  		Fig. 1 Ad5/3SLPI kills tumor cells specifically. SLPI-positive HeLa cells (A) and SLPI-negative A549 cells (B) were infected with Ad5/3SLPI, Ad5/3wt, Adwt, and Ad5/3luc (E1-deleted control virus). Oncolysis was evaluated by crystal violet staining.

 
Ad5/3SLPI Displays Efficient Killing of Ovarian Cancer Cells In vitro. We infected monolayers of SKOV3.ip1, OV-4, OV-3, and Hey cells (Fig. 2) with Ad5/3SLPI, Ad5/3wt, Ad5wt, or Ad5/3luc. In all cell lines, the quantitative cell killing assay showed no effect with the nonreplicative control. The percentages of viable cells remaining with Ad5/3SLPI were 0%, 5.2%, 8.2%, and 12% for SKOV3.ip1, OV-4, OV-3, and Hey cells, respectively. The percentages of viable cells remaining with Ad5/3wt were 5%, 4%, 42%, and 2% compared with uninfected cells, with SKOV3.ip1, OV-4, OV-3, and Hey cells, respectively. Further, Ad5/3SLPI killed significantly more SKOV3.ip1, OV-4, and OV-3 cells (P < 0.001) than Ad5/3luc. In all ovarian cancer cell lines, Ad5/3SLPI displayed enhanced cell killing compared with Ad5wt (P < 0.001, P < 0.002, P < 0.001, and P < 0.001 for SKOV3.ip1, OV-4, and OV-3 cells, respectively). These results thus showed efficient cell killing efficacy of Ad5/3SLPI in ovarian cancer cells in vitro.



View larger version (24K):
[in this window]
[in a new window]
  		Fig. 2 Ad5/3SLPI displays increased cell killing in low CAR ovarian cancer cells. Cells were infected with Ad5/3SLPI, Ad5/3wt, Adwt, and Ad5/3luc (E1-deleted control virus) with 0, 0.1, 1, and 10 vp/cell. Cell viability was measured with the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxy-phenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt assay on day 6 (SKOV3.ip1 and OV-3), day 10 (Hey), or day 13 (OV-4). A490 nm values of uninfected cells were set at 100%. Points, mean of triplicate experiments; bars, SD.

 
Ad5/3SLPI Replicates in Ovarian Cancer Primary Cell Spheroids. We analyzed three purified, unpassaged human primary ovarian cancer samples for adenovirus replication. To measure viral copy number, we collected spheroids and growth medium at indicated time points and did quantitative PCR for the adenoviral E4 gene (Fig. 3). To determine the relative increase in copies, we normalized E4 copy number at each time point to the copy number obtained with Ad5/3luc at 24 hours. On day 5, Ad5/3SLPI copy number had increased to 1,002-, 9,682-, and 1,104-fold in patient samples 1 to 3, respectively, compared with 202-, 645-, and 99-fold increases with Ad5wt and 26,384-, 27,505-, and 10,647-fold increases with Ad5/3wt. Thus, replication of Ad5/3SLPI was increased in comparison with Ad5wt.



View larger version (19K):
[in this window]
[in a new window]
  		Fig. 3 Ad5/3SLPI replicates in three-dimensional human ovarian primary cancer cell spheroids. Purified and unpassaged ovarian cancer cells were allowed to form spheroids, which were infected with 1,000 vp/cell of Ad5/3SLPI, Ad5/3wt, Ad5wt, and Ad5/3luc (E1-deleted control virus). Spheroids and growth medium were collected at indicated time points, and virus copy number was measured with quantitative PCR. A-C, increase in virus copy number is noted in patient samples 1-3, respectively. Background values (uninfected spheroids) were subtracted. Bars, SD.

 
Ad5/3SLPI in an Orthotopic Murine Model of Peritoneally Disseminated Ovarian Cancer. Advanced carcinomatosis was allowed to develop for 10 days, and the mice were treated on 3 consecutive days with Ad5/3SLPI, Ad5/3Cox-2L, Ad5/3wt, Ad5wt, Ad5/3luc, or no virus. The median survival of mice was 104, 95, 92, 32, 32, and 30 days, respectively (Fig. 4A). In pairwise comparisons, survival with Ad5/3SLPI was significantly enhanced when compared with Ad5/3luc, no virus (P ≤ 0.0001), or Ad5wt (P = 0.0008). Survival of the mice treated with Ad5/3Cox-2L versus Ad5/3SLPI was not significantly different (P = 0.786). A higher dose divided into two injections on 2 consecutive days was also tested (Fig. 4B). For Ad5/3SLPI, Ad5/3Cox-2L, Ad5/3wt, Ad5wt, Ad5/3luc, and no virus, the median survival of mice was 91, 89, 102, 67, 32, and 30 days, respectively. Pairwise {chi}2 testing confirmed significantly improved survival with Ad5/3SLPI compared with Ad5/3luc and no virus (P ≤ 0.0001) and Ad5wt (P = 0.0188). Interestingly, survival of mice treated with Ad5wt in the low-dose group was significantly reduced compared with the high-dose group (P = 0.0181). In contrast, the survival of mice treated with high or low doses of Ad5/3SLPI, Ad5/3Cox-2L, or Ad5/3wt did not differ significantly.



View larger version (25K):
[in this window]
[in a new window]
  		Fig. 4 Therapeutic effect of Ad5/3SLPI in an animal model of peritoneally disseminated ovarian cancer. SKOV3.ip1 cells were injected i.p. into severe combined immunodeficient mice, and advanced carcinomatosis was allowed to develop for 10 days. A, mice received three daily i.p. injections of 1 x 108 vp of Ad5/3SLPI, Ad5/3Cox-2, Ad5/3wt, Ad5wt, Ad5/3luc, or no virus or (B) two daily i.p. injections of 5 x 109 vp. In both experiments, Ad5/3SLPI resulted in significantly enhanced survival (A) versus Ad5/3luc, no virus, and Ad5wt (all Ps < 0.0001) and (B) versus Ad5wt (P = 0.0008).

 
Evaluation of Liver Toxicity In vivo. To evaluate the liver toxicity of human CRADs preclinically is a challenge. It is known that human adenoviruses do not replicate productively in mice. However, to obtain key information regarding replication specificity of different 5/3 fiber-modified CRADs, we used an in vivo system that relies on histopathologic analysis and quantification of E1A mRNA after systemic administration of viral vectors in immunocompetent C57BL/6 mice (31). We injected 5 x 1010 vp/mouse of Ad5/3SLPI, Ad5/3Cox-2L, and Ad5/3{Delta}24 or control vectors (Ad5wt, Ad5/3wt, and Ad5/3luc) i.v., and the mice were killed 3 days later for analysis. The liver tissue was processed for histopathologic analysis with H&E staining and adenoviral E1A mRNA analysis. By histopathologic analysis, systemic administration of Ad5/3SLPI, Ad5wt, and Ad5/3luc did not result in any remarkable liver toxicity (Fig. 5A). Histopathology of the livers from mice, which were treated with Ad5/3Cox-2L, displayed chronic inflammation within the parenchyma and cell dropout, and Ad5/3{Delta}24-treated mice displayed similar diffuse chronic inflammation and signs of apoptosis. The highest liver toxicity was seen in mice treated with Ad5/3wt, showing submassive hepatic necrosis and associated congestion and hemorrhage.



View larger version (60K):
[in this window]
[in a new window]
  		Fig. 5 Ad5/3SLPI displays low liver toxicity in a panel of 5/3 fiber-modified adenoviruses. Female C57BL/6 mice treated i.v. with 5 x 1010 vp of Ad5/3SLPI, Ad5/3Cox-2, Ad5/3-{Delta}24, Ad5/3wt, Ad5wt, and Ad5/3luc. After 48 hours, the livers were harvested and fixed in 10% buffered formalin. A, serial paraffin-embedded sections were taken and stained with H&E under standard conditions. Histopathology was scored in a blinded manner by an experienced pathologist. B, RNA was isolated from the liver and analyzed by quantitative reverse-transcription PCR for the E1A gene. The result is indicated as E1A RNA copy number per µg total RNA. Columns, mean of three experiments; bars, SD. *, P < 0.05 versus Ad5/3luc.

 
Next, we correlated the results of the histopathologic analysis with quantitative E1A mRNA expression in the liver. Mice treated with Ad5/3SLPI, Ad5wt, and Ad5/3luc displayed the lowest levels of E1A mRNA with 19,574 ± 9,549, 31,335 ± 3,130, and 49,480 ± 16,063 mRNA copies, respectively. In contrast, E1A mRNA levels in Ad5/3wt, Ad5/3Cox2L, and Ad5/3{Delta}24 treatment groups on day 3 (Fig. 5B) were significantly higher with 30,690,000 ± 451,141, 4,557,244 ± 621,139, and 4,330,400 ± 16,063 copies, respectively. Of note, the E1A RNA levels of Ad5/3SLPI-treated animals, where the E1 gene is under control of the SLPI promoter, displayed significantly lower E1A RNA levels than Ad5/3Cox-2L and Ad5/3{Delta}24 (P < 0.001). These data support the concept that E1A itself, even in the absence of replication, may elicit toxicity and suggest that the SLPI promoter, in the context of a 5/3 fiber-modified CRAD, was minimally active in the mouse liver at the doses evaluated.

Evaluation of Liver Toxicity in Human Liver Slices. To evaluate liver toxicity in the most relevant context, the human liver, we analyzed fresh-cut human liver slices for adenovirus replication employing a novel technique. To measure E1A mRNA, liver slices were collected at 12, 24, and 36 hours (sample 1) and 12, 24, 36, and 48 hours (sample 2) after infection and quantitative reverse transcription-PCR was done to quantitate E1A mRNA (Fig. 6). Ad5/3SLPI, Ad5/3Cox-2L, and Ad5wt displayed the lowest mRNA copy numbers with 2,062, 3,840, and 3,041 copies after 36 hours in sample 1 and 6,709, 103,717, and 22,309 copies after 48 hours in sample 2. Ad5/3wt and Ad5/3{Delta}24 displayed significantly higher E1A mRNA copy numbers with 9,061 and 253,550 copies for Ad5/3wt in samples 1 and 2, respectively, and 5,274 and 161,412 copies for Ad5/3{Delta}24 in samples 1 and 2, respectively. Compared with Ad5/3SLPI, E1A mRNA copy numbers for Ad5/3Cox-2L, Ad5/3wt, Ad5/3{Delta}24, and Ad5wt were increased 1.8-, 4.4-, 2.6-, and 1.5-fold after 36 hours in sample 1 and 15.5-, 37.8-, 24.1-, and 3.3-fold after 48 hours in sample 2, respectively. Importantly, there was good correlation between data obtained from human and mouse livers (Fig. 5).



View larger version (35K):
[in this window]
[in a new window]
  		Fig. 6 Hepatic expression of E1A mRNA of 5/3 fiber-modified adenoviruses in human liver correlates with results obtained in the in vivo mouse model. Precision-cut liver slices were infected with 50 vp/cell with Ad5wt, Ad5/3wt, Ad5/3Cox-2, Ad5/3SLPI, Ad5/3{Delta}24, or Ad5/3luc. Liver slices were harvested and frozen at 12, 24, and 36 hours (A) or 12, 24, 36, and 48 hours (B) after infection. RNA was isolated from the liver and analyzed by quantitative reverse-transcription PCR for the E1A gene. Points, mean of three experiments.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Gene therapy applications in which viral vectors are used for gene transfer have shown promise in preclinical studies. Unfortunately, inefficient tumor transduction has often precluded significant benefit in clinical trials. CRADs have been developed to achieve a higher therapeutic index than for the currently available modalities. However, only phase I and II trials have been done thus far. Importantly, the safety data have been good, but the preliminary evidence of efficacy has not been dramatic. Nevertheless, the emergence of infectivity was enhanced and more oncolytic CRADs may provide enhanced efficacy, which might in turn require more specificity.

In this study, we evaluated the efficacy and efficacy of a CRAD using the SLPI promoter for controlling E1A expression. SLPI was identified as a potent inhibitor of leukocyte serine proteases (32). Although human SLPI has been intensively studied, its precise function in vivo remains unclear. However, SLPI is expressed in ovarian cancer and has low expression levels in normal organs, such as the liver (13, 14, 16). The SLPI promoter retains its fidelity in adenoviral ectors and is activated in ovarian cancer cell lines and ovarian cancer primary cells (17). Furthermore, its activity is low in the liver, which is important concerning safety issues for further clinical evaluations.

The efficacy of CRADs is determined by their infectivity. One method for circumventing the frequent deficiency of CAR on clinical ovarian cancers is genetic retargeting via substitution of the knob domain of Ad5 with a knob from an alternative adenovirus serotype. Earlier studies have shown the increased expression of Ad3 receptors compared with Ad5 receptors in ovarian adenocarcinoma cell lines (24). 5/3 Fiber-modified adenoviruses (23, 27, 33) have shown improved targeting to ovarian cancer cells lines and freshly isolated ovarian cancer tissue from patients. It is conceivable that the Ad3 receptor, as opposed to CAR, may not be involved in the carcinogenic process and thus not down-regulated in advanced tumors. Here, we did a preclinical evaluation of Ad5/3SLPI in the context of ovarian cancer gene therapy. We evaluated the cell killing efficacy of Ad5/3SLPI in four ovarian cancer adenocarcinoma cell lines, which have been shown to express SLPI or allow SLPI-controlled transgene expression (17, 18). In a quantitative assay, Ad5/3SLPI displayed enhanced oncolysis when compared with a wild-type adenovirus, whereas Ad5/3wt achieved almost total oncolysis with all cell lines (Fig. 2). In a crystal violet staining assay, Ad5/3SLPI displayed specific tumor cell killing only in a SLPI positive cell line. The cell killing efficacy of Ad5/3SLPI correlated with the replication rate in three-dimensional human ovarian primary cancer cell spheroids.

Finally, the therapeutic efficacy of Ad5/3SLPI was evaluated in an orthotopic mouse model of ovarian cancer. Xenograft models are a useful tool to study adenoviral transduction of tumor cells and viral replication in tumors. Most current xenograft tumor models are based on s.c. transplantation of established human tumor cell lines into immunodeficient mice and subsequent intratumoral vector injection. In the context of ovarian cancer, these models do not mimic the most relevant clinical situation. Therefore, we have used a model of i.p. cancer and i.p. injection of viral vectors. Ad5/3SLPI displayed significantly enhanced survival in comparison with Ad5wt and the nonreplicative negative control Ad5/3luc. Survival of mice treated with Ad5/3wt and Ad5/3Cox-2L, another promising CRAD with E1A under control of the Cox-2 promoter, was comparable with mice treated with Ad5/3SLPI. In summary, these results indicate a comparable therapeutic efficacy for 5/3 fiber-modified adenoviruses driven by the SLPI or the Cox-2L promoter. Converted weight/weight into humans, the lower dose used in our study would equal 9 x 1010 vp. This is well below the 2 x 1012 vp daily for 5 consecutive days, without dose-limiting toxicity (34). In vector trials, up to 7.5 x 1013 vp have been given for 5 consecutive days, without dose-limiting toxicity (35). This equals approximately the dose that we used in the murine toxicity model of our study.

During preparation of this article, another report (36) was published describing a adenoviral vector with a double expression cassette consisting of E1A driven by the SLPI promoter that was and followed by E1B-19K under control of the cytomegalovirus promoter. This vector showed efficacy and specificity in non–small cell lung cancer cell lines in vitro and in a s.c. model of non–small cell lung cancer. Interestingly, the investigators had also deleted the E1B-55K protein and E3, both of which are important for effective oncolysis (37, 38). Transductional targeting of the virus was not endeavored, and replication was attenuated compared with a wild-type virus, although only an in vitro comparison was done. CRADs have emerged as a tool to overcome low tumor transduction demonstrating preliminary evidence of efficacy in clinical trials. In a phase II study of an intratumorally given E1B-55K-deleted CRAD in 40 patients with head and neck cancer, three complete and two partial responses were reported (39). To improve infectivity of target cells, infectivity enhanced CRADs have been constructed. Promising results with such an infectivity enhanced CRAD (Ad5-{Delta}24RGD) have been reported recently in the context of ovarian cancer gene therapy (29). Ad5-{Delta}24RGD features a RGD-4C modification in the HI loop of the knob, which allows binding to {alpha}{nu}ß integrins, which are often overexpressed on ovarian cancer cells. The virus showed impressive oncolysis and enhanced survival in an animal model. Consequently, a clinical phase I trial using this virus for ovarian cancer is in preparation. However, other studies have reported superior tumor transduction rates of 5/3 fiber-modified CRADs compared with CRADs containing a RGD-4C modification. A major challenge for systemic administration of adenovirus-based gene therapy vectors could be toxicity resulting from infection of normal cells. Previous studies have shown improved tumor transduction with fiber-modified adenoviruses, but the liver toxicity of 5/3 fiber-modified CRADs has not been evaluated systematically. Therefore, we have compared Ad5/3SLPI and Ad5/3Cox-2L, two transcomplementation-type CRADs with E1A under control of the SLPI and Cox-2L promoters, respectively. Another control virus was Ad5/3{Delta}24, a oncolytic genetic complementation–type CRAD that contains a 24-bp deletion in the constant region 2 of E1A. The expressed protein is unable to bind retinoblastoma protein for induction of S phase (10). Thus, Ad5/3{Delta}24 is attenuated in nondividing normal cells but replicates in cells inactive in the retinoblastoma/p16 pathway (40). It has been suggested that all human cancers, including ovarian cancers, may be deficient in this crucial pathway (41). Because human adenoviruses do not replicate productively in rodents or other laboratory animals (42), there is no practical model to directly analyze adenoviral replication or adenoviral replication–based toxicities. However, it is well known that adenoviruses efficiently transduce the mouse liver after i.v. administration and produce clinical signs of hepatotoxicity within a week (43, 44). Some of the hepatotoxic effects can be attributed to the expression of the adenoviral E1A gene. For this reason, we have used an in vivo assay of E1A-related hepatotoxicity to evaluate the activity of different promoter-controlled, 5/3 fiber-modified CRADs in normal liver cells in immunocompetent C57BL/6 mice. In this study, we used molecular and histopathologic variables of hepatotoxicity as end points for the activity of heterologous tumor-selective promoters regulating E1A expression. We found that Ad5/3SLPI expressed significantly less E1A mRNA–related hepatotoxicity than Ad5/3wt, Ad5/3Cox-2L, and Ad5/3{Delta}24.

Of note, all 5/3 chimeric adenoviruses, with the exception of Ad5/3SLPI, seemed to display more liver toxicity compared with Ad5wt. Previous studies (23, 33, 45) have shown an increased liver tropism of 5/3 fiber-modified viruses compared with Ad5 using reporter gene analysis. Interestingly, Kanerva et al. compared viral genomes and subsequent transgene expression and found discrepancy. It was speculated that 5/3 viruses may transduce hepatocytes more readily than Ad5, which might be mostly cleared by Kupffer cells (23). As Kupffer cell uptake would not allow effective viral gene expression, this might partly explain why more E1A mRNA copies were seen after infection with Ad5/3wt in comparison with Ad5wt. However, as Kupffer cells have a central role in determining toxicity (46), it is not clear which is less desirable, transduction of Kupffer cells or hepatocytes. Further, murine and human livers also contain other cell types, such as fibroblasts and endothelial cells. Ad5/3-modified viruses might have improved access to these cells, which might contribute to E1A mRNA expression. Finally, high E1A mRNA levels found after infection with Ad5/3-{Delta}24 are of concern. However, if there is a negative feedback loop associated with the cross-regulation of adenovirus early genes, it may be conceivable that accumulation of E1A mRNA might in fact indicate attenuation of replication. In other words, the lack of productive replication might result in the virus "trying to force the issue" by increased production of E1A mRNA. However, this needs to be studied further.

These results suggest the utility of effective transcriptional control via tumor-specific promoters, such as SLPI. We hypothesize that the comparatively low hepatotoxicity of the Ad5/3SLPI-treated animals was not the result of a failure of the human SLPI promoter to function in murine cells, because the human and murine SLPI promoters share a high degree of similarity (47). To further evaluate differences in the hepatic activity of tumor-specific promoters in the context of fiber-modified adenoviruses, we chose precision-cut human liver slices as a stringent preclinical model. Liver slices have been used previously to evaluate liver function, toxicity, and metabolism (43) and they form a bridge for comparison between animals and humans in toxicology and metabolism studies (44). Precision-cut liver slices maintain the tissue architecture and contain the variety of cell types normally found in the liver. We did a time course evaluation of E1A RNA in liver slices following infection with viral vectors. Importantly, the E1A RNA levels of 5/3 fiber-modified adenoviruses correlated with results obtained from mouse livers following i.v. administration. Nevertheless, it is not known how much E1A expression is required for effective replication. Therefore, it cannot be excluded that there was productive replication of Ad5wt although E1A mRNA expression was low.

In conclusion, our results suggest that Ad5/3SLPI allows tumor-specific replication and improved cell killing compared with wild-type adenovirus. We showed decreased liver tropism and toxicity compared with Ad5/3Cox-2L and Ad5/3{Delta}24. Chimeric 5/3 fiber-modified CRADs are effective agents for treatment of ovarian cancer. To make gene therapy not only feasible but also clinically useful, strategies to insure both key safety and efficacy are needed. In this regard, Ad5/3SLPI is promising as an agent for achieving enhanced but selective replication, which could reduce adverse effects in clinical trials. We believe that Ad5/3SLPI could be an effective and safe gene therapy agent for treatment of ovarian cancer or other tumors featuring high expression of SLPI and low expression of CAR.


   ACKNOWLEDGMENTS
 
We thank Dr. C.L. Krumdieck for excellent technical support in preparation of precision-cut human liver slices and Drs. H. Inoue and T. Tanabe (Cardiovascular Center Research Institute, Suita, Japan) for providing plasmid phPES2 containing the Cox-2 promoter.


   FOOTNOTES
 
Grant support: Dr. Mildred Scheel Stiftung für Krebsforschung grant D/02/33141 (D. Rein), Deutsche Forschungsgemeinschaft grants NE832/1 (D. Nettelbeck) and BA2076/1 (G. Bauerschmitz), NIH Specialized Programs of Research Excellence grant P50 CA83591, and NIH grants RO1 CA 83821 (D. Curiel) and R01 CA93796 (G. Siegal)

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 8/20/04; revised 10/ 5/04; accepted 10/28/04.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, Thun MJ. Cancer statistics, 2003. CA Cancer J Clin 2003;53:5–26.[Abstract/Free Full Text]
  2. Hemminki A. From molecular changes to customised therapy. Eur J Cancer 2002;38:333–8.
  3. Bauerschmitz GJ, Barker SD, Hemminki A. Adenoviral gene therapy for cancer: from vectors to targeted and replication competent agents [review]. Int J Oncol 2002;21:1161–74.[Medline]
  4. Kanerva A, Hemminki A. Modified adenoviruses for cancer gene therapy. Int J Cancer 2004;110:475–80.[CrossRef][Medline]
  5. Ganly I, Kirn D, Eckhardt G, et al. A phase I study of Onyx-015, an E1B attenuated adenovirus, administered intratumorally to patients with recurrent head and neck cancer. Clin Cancer Res 2000;6:798–806.[Abstract/Free Full Text]
  6. Kirn D. Clinical research results with dl1520 (Onyx-015), a replication-selective adenovirus for the treatment of cancer: what have we learned? Gene Ther 2001;8:89–98.[CrossRef][Medline]
  7. Alemany R, Balague C, Curiel DT. Replicative adenoviruses for cancer therapy. Nat Biotechnol 2000;18:723–7.[CrossRef][Medline]
  8. Curiel DT. The development of conditionally replicative adenoviruses for cancer therapy. Clin Cancer Res 2000;6:3395–9.[Abstract/Free Full Text]
  9. Bischoff JR, Kirn DH, Williams A, et al. An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 1996;274:373–6.[Abstract/Free Full Text]
  10. Fueyo J, Gomez-Manzano C, Alemany R, et al. A mutant oncolytic adenovirus targeting the Rb pathway produces anti-glioma effect in vivo. Oncogene 2000;19:2–12.[CrossRef][Medline]
  11. Yamamoto M, Davydova J, Wang M, et al. Infectivity enhanced, cyclooxygenase-2 promoter-based conditionally replicative adenovirus for pancreatic cancer. Gastroenterology 2003;125:1203–18.[CrossRef][Medline]
  12. Garver RI Jr, Goldsmith KT, Rodu B, Hu PC, Sorscher EJ, Curiel DT. Strategy for achieving selective killing of carcinomas. Gene Ther 1994;1:46–50.[Medline]
  13. Robertson MW, Wang M, Siegal GP, et al. Use of a tissue-specific promoter for targeted expression of the herpes simplex virus thymidine kinase gene in cervical carcinoma cells. Cancer Gene Ther 1998;5:331–6.[Medline]
  14. Hough CD, Sherman-Baust CA, Pizer ES, et al. Large-scale serial analysis of gene expression reveals genes differentially expressed in ovarian cancer. Cancer Res 2000;60:6281–7.[Abstract/Free Full Text]
  15. Abe T, Tominaga Y, Kikuchi T, et al. Bacterial pneumonia causes augmented expression of the secretory leukoprotease inhibitor gene in the murine lung. Am J Respir Crit Care Med 1997;156:1235–40.[Abstract/Free Full Text]
  16. Hough CD, Cho KR, Zonderman AB, Schwartz DR, Morin PJ. Coordinately up-regulated genes in ovarian cancer. Cancer Res 2001;61:3869–76.[Abstract/Free Full Text]
  17. Barker SD, Coolidge CJ, Kanerva A, et al. The secretory leukoprotease inhibitor (SLPI) promoter for ovarian cancer gene therapy. J Gene Med 2003;5:300–10.[CrossRef][Medline]
  18. Barker SD, Dmitriev IP, Nettelbeck DM, et al. Combined transcriptional and transductional targeting improves the specificity and efficacy of adenoviral gene delivery to ovarian carcinoma. Gene Ther 2003;10:1198–204.[CrossRef][Medline]
  19. Douglas JT, Kim M, Sumerel LA, Carey DE, Curiel DT. Efficient oncolysis by a replicating adenovirus (ad) in vivo is critically dependent on tumor expression of primary ad receptors. Cancer Res 2001;61:813–7.[Abstract/Free Full Text]
  20. Dmitriev I, Krasnykh V, Miller CR, et al. An adenovirus vector with genetically modified fibers demonstrates expanded tropism via utilization of a coxsackievirus and adenovirus receptor-independent cell entry mechanism. J Virol 1998;72:9706–13.[Abstract/Free Full Text]
  21. Vanderkwaak TJ, Wang M, Gomez-Navarro J, et al. An advanced generation of adenoviral vectors selectively enhances gene transfer for ovarian cancer gene therapy approaches. Gynecol Oncol 1999;74:227–34.[CrossRef][Medline]
  22. Zeimet AG, Muller-Holzner E, Schuler A, et al. Determination of molecules regulating gene delivery using adenoviral vectors in ovarian carcinomas. Gene Ther 2002;9:1093–100.[CrossRef][Medline]
  23. Kanerva A, Wang M, Bauerschmitz GJ, et al. Gene transfer to ovarian cancer versus normal tissues with fiber-modified adenoviruses. Mol Ther 2002;5:695–704.[CrossRef][Medline]
  24. Kanerva A, Mikheeva GV, Krasnykh V, et al. Targeting adenovirus to the serotype 3 receptor increases gene transfer efficiency to ovarian cancer cells. Clin Cancer Res 2002;8:275–80.[Abstract/Free Full Text]
  25. Lam JT, Bauerschmitz GJ, Kanerva A, et al. Replication of an integrin targeted conditionally replicating adenovirus on primary ovarian cancer spheroids. Cancer Gene Ther 2003;10:377–87.[CrossRef][Medline]
  26. Nettelbeck DM, Rivera AA, Balague C, Alemany R, Curiel DT. Novel oncolytic adenoviruses targeted to melanoma: specific viral replication and cytolysis by expression of E1A mutants from the tyrosinase enhancer/promoter. Cancer Res 2002;62:4663–70.[Abstract/Free Full Text]
  27. Kanerva A, Zinn KR, Chaudhuri TR, et al. Enhanced therapeutic efficacy for ovarian cancer with a serotype 3 receptor-targeted oncolytic adenovirus. Mol Ther 2003;8:449–58.[CrossRef][Medline]
  28. Davydova J, Le LP, Gavrikova T, Wang M, Krasnykh V, Yamamoto M. Infectivity-enhanced cyclooxygenase-2-based conditionally replicative adenoviruses for esophageal adenocarcinoma treatment. Cancer Res 2004;64:4319–27.[Abstract/Free Full Text]
  29. Bauerschmitz GJ, Lam JT, Kanerva A, et al. Treatment of ovarian cancer with a tropism modified oncolytic adenovirus. Cancer Res 2002;62:1266–70.[Abstract/Free Full Text]
  30. Hemminki A, Belousova N, Zinn KR, et al. An adenovirus with enhanced infectivity mediates molecular chemotherapy of ovarian cancer cells and allows imaging of gene expression. Mol Ther 2001;4:223–31.[CrossRef][Medline]
  31. Jakubczak JL, Ryan P, Gorziglia M, et al. An oncolytic adenovirus selective for retinoblastoma tumor suppressor protein pathway-defective tumors: dependence on E1A, the E2F-1 promoter, and viral replication for selectivity and efficacy. Cancer Res 2003;63:1490–9.[Abstract/Free Full Text]
  32. Thompson K, Rabinovitch M. Exogenous leukocyte and endogenous elastases can mediate mitogenic activity in pulmonary artery smooth muscle cells by release of extracellular-matrix bound basic fibroblast growth factor. J Cell Physiol 1996;166:495–505.[CrossRef][Medline]
  33. Breidenbach M, Rein DT, Wang M, et al. Genetic replacement of the adenovirus shaft fiber reduces liver tropism in ovarian cancer gene therapy. Hum Gene Ther 2004;15:509–18.[CrossRef][Medline]
  34. Vasey PA, Shulman LN, Campos S, et al. Phase I trial of intraperitoneal injection of the E1B-55-kd-gene-deleted adenovirus ONYX-015 (dl1520) given on days 1 through 5 every 3 weeks in patients with recurrent/refractory epithelial ovarian cancer. J Clin Oncol 2002;20:1562–9.[Abstract/Free Full Text]
  35. Buller RE, Runnebaum IB, Karlan BY, et al. A phase I/II trial of rAd/p53 (SCH 58500) gene replacement in recurrent ovarian cancer. Cancer Gene Ther 2002;9:553–66.[CrossRef][Medline]
  36. Maemondo M, Saijo Y, Narumi K, et al. Gene therapy with secretory leukoprotease inhibitor promoter-controlled replication-competent adenovirus for non-small cell lung cancer. Cancer Res 2004;64:4611–20.[Abstract/Free Full Text]
  37. Dosch T, Horn F, Schneider G, et al. The adenovirus type 5 E1B-55K oncoprotein actively shuttles in virus-infected cells, whereas transport of E4orf6 is mediated by a CRM1-independent mechanism. J Virol 2001;75:5677–83.[Abstract/Free Full Text]
  38. Suzuki K, Alemany R, Yamamoto M, Curiel DT. The presence of the adenovirus E3 region improves the oncolytic potency of conditionally replicative adenoviruses. Clin Cancer Res 2002;8:3348–59.[Abstract/Free Full Text]
  39. Nemunaitis J, Khuri F, Ganly I, et al. Phase II trial of intratumoral administration of ONYX-015, a replication-selective adenovirus, in patients with refractory head and neck cancer. J Clin Oncol 2001;19:289–98.[Abstract/Free Full Text]
  40. Heise C, Hermiston T, Johnson L, et al. An adenovirus E1A mutant that demonstrates potent and selective systemic anti-tumoral efficacy. Nat Med 2000;6:1134–9.[CrossRef][Medline]
  41. Sherr CJ. Cancer cell cycles. Science 1996;274:1672–7.[Abstract/Free Full Text]
  42. Hay JG. "Man's best friend": a new model system for cancer therapeutics? Mol Ther 2003;7:144–5.[Medline]
  43. Jessen BA, Mullins JS, De Peyster A, Stevens GJ. Assessment of hepatocytes and liver slices as in vitro test systems to predict in vivo gene expression. Toxicol Sci 2003;75:208–22.[Abstract/Free Full Text]
  44. Wrighton SA, Ring BJ, VandenBranden M. The use of in vitro metabolism techniques in the planning and interpretation of drug safety studies. Toxicol Pathol 1995;23:199–208.[Medline]
  45. Breidenbach M, Rein DT, Wang M, et al. Genetic replacement of the adenovirus shaft fiber reduces liver tropism in ovarian cancer gene therapy. Hum Gene Ther 2004;15:509–18.
  46. Shayakhmetov DM, Li ZY, Ni S, Lieber A. Analysis of adenovirus sequestration in the liver, transduction of hepatic cells, and innate toxicity after injection of fiber-modified vectors. J Virol 2004;78:5368–81.[Abstract/Free Full Text]
  47. Kikuchi T, Abe T, Yaekashiwa M, et al. Secretory leukoprotease inhibitor augments hepatocyte growth factor production in human lung fibroblasts. Am J Respir Cell Mol Biol 2000;23:364–70.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
Y. Tsuruta, L. Pereboeva, M. Breidenbach, D. T. Rein, M. Wang, R. D. Alvarez, G. P. Siegal, P. Dent, P. B. Fisher, and D. T. Curiel
A Fiber-Modified Mesothelin Promoter-Based Conditionally Replicating Adenovirus for Treatment of Ovarian Cancer
Clin. Cancer Res., June 1, 2008; 14(11): 3582 - 3588.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
J. M. Mathis, P. L. Stewart, Z. B. Zhu, and D. T. Curiel
Advanced Generation Adenoviral Virotherapy Agents Embody Enhanced Potency Based upon CAR-Independent Tropism.
Clin. Cancer Res., May 1, 2006; 12(9): 2651 - 2656.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rein, D. T.
Right arrow Articles by Curiel, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rein, D. T.
Right arrow Articles by Curiel, D. T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online