
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Imaging, Diagnosis, Prognosis |
Authors' Affiliations: 1 Tumor Immunology Program, German Cancer Research Center; 2 Department of Pathology, University of Heidelberg; and Departments of 3 Head and Neck Surgery and 4 Neurosurgery University Hospital of Heidelberg, Heidelberg, Germany
Requests for reprints: Philipp Beckhove, Tumor Immunology Program, German Cancer Research Center, INF 280, 69120 Heidelberg, Germany. Phone: 49-6221-423745; Fax: 49-6221-423702; E-mail: P.Beckhove{at}dkfz.de.
| Abstract |
|---|
|
|
|---|
Experimental Design: We analyzed the expression of the active form of heparanase in HNSCC tissues in corresponding tumor cell cultures and after xenotransplantation of tumor cell cultures into NOD/Scid mice by immunohistochemistry, Western blot analysis, and reverse transcription-PCR in altogether 25 patients and did a comparison with clinicopathologic data of the patients.
Results: Heparanase expression in situ was detected in all tumor biopsies in the tumor stroma and in tumor cells from 13 of 19 primary tumors and 9 of 12 lymph node metastases. Heparanase was localized in disseminated tumor cells, in tumor cell clusters invading adjacent stromal tissues, and in tumor cells at the tumor invasion front. Lymph node metastases expressed higher levels of heparanase compared with corresponding primary tumors. In contrast to a heterogeneous expression pattern in tumor tissues, all corresponding HNSCC tumor cell cultures showed a rather homogeneous heparanase expression on the mRNA and protein levels. Comparison of heparanase expression in situ and in corresponding tumor cell cultures in vitro or after xenotransplantation into NOD/Scid mice revealed that heparanase expression was regulated in vivo. Lack of heparanase in tumor cells from primary tumors or lymph node metastases was correlated with prolonged disease-free survival and overall survival.
Conclusion: Heparanase expression seems to be involved in the invasiveness and aggressiveness of HNSCC.
Key Words: tumor invasion NOD/Scid mice primary tumor culture
The hydrolase heparanase has been described recently to be involved in tumor invasion and metastasis (3). Heparanase is an endo-ß-D-glucuronidase, which is predominantly involved in cleavage of heparan sulfate residues and hence participates in extracellular matrix degradation and remodeling (4). Heparan sulfate proteoglycans are ubiquitous macromolecules associated with the cell surface and the main constituents of the extracellular matrix of a wide range of tissues (5). In the process of metastasis, the penetration of the basement membranes in blood or lymphatic vessels is an essential step required for the intravasation and extravasation of cancer cells (6). In addition, heparanase also regulates angiogenesis, proliferation of cancer cells, and lipid metabolism by releasing heparan sulfatebound growth factors and enzymes, such as basic fibroblast growth factor and lipoprotein lipase (6). A single heparanase gene encodes for a 65-kDa protein that undergoes a proteolytic cleavage, yielding a 50-kDa polypeptide, which is
100-fold more active than the 65-kDa form (4).
Heparanase is directly involved in cell adhesion independent of its enzymatic activity provided that the enzyme is expressed on the cell surface (7). Heparanase-mediated cell adhesion to extracellular matrix results in integrin-dependent cell spreading and reorganization of the actin cytoskeleton (7). The surface-bound enzyme also augments cell invasion through a reconstituted basement membrane. Heparanase activity has been identified in a variety of cells from normal tissues, primarily the placenta and lymphoid organs (8, 9), among which are cytotrophoblasts, endothelial cells, platelets, mast cells, neutrophils, macrophages, T and B lymphocytes, ganglion cells, and nerves, with little or no staining in connective tissue cells and most normal epithelia (10, 11). Whereas no or weak heparanase expression was detected in normal epithelial cells, heparanase expression is increased in human carcinomas of the breast, lung, prostate, ovary, cervix, bladder, pancreas, liver, esophagus, colon, and stomach compared with the corresponding normal tissues (4, 1020). In animal models, heparanase overexpression inhibited tumor cell proliferation but conferred a highly invasive phenotype to tumor cells leading to enhanced generation of metastases and decreased survival (21, 22). Clinical studies revealed an association of elevated heparanase expression with decreased tumor cell differentiation, increased tumor vascularity, metastasis formation, or poor postoperative survival of some tumors (bladder cancer, early pancreatic cancer, gastric cancer, colon cancer, invasive cervix cancer, and multiple myeloma; refs. 1416, 1820, 23, 24).
Thus far, only few studies have been published on heparanase expression in head and neck cancers concentrating on the expression in the oral cavity. They reported mRNA expression in tumor tissues but provided no data on the cell types involved or its localization in situ (25, 26).
We did this study to verify and extend previous results regarding heparanase location in head and neck squamous cell carcinoma (HNSCC) tissues, differential expression of heparanase in HNSCC tumor tissues and tumor cell lines, and a potential implication of heparanase expression for patient prognosis. Therefore, tumor tissue from a broad variety of 25 head and neck cancers was compared with corresponding tumor cell cultures from the same tumors with regard to heparanase expression based on detection of heparanase mRNA and heparanase protein in reverse transcription-PCR, Western blot, and immunohistochemistry using a monoclonal antibody specific for the active 50-kDa fragment of heparanase.
| Materials and Methods |
|---|
|
|
|---|
|
Mice and tumor cell xenotransplantation. Six- to 8-week-old female NOD/Scid mice (purchased from Charles River Wiga GmbH, Sulzfeld, Germany) were kept under pathogen-free conditions. Cultured tumor cells (5 x 106) were injected in 200 µL PBS s.c. into the left flank region of each mouse. Tumor growth was monitored twice weekly. When tumor diameter exceeded 6 mm, mice were sacrificed and tumors were snap frozen for immunohistologic analysis.
RNA isolation and reverse transcription-PCR analysis. Total RNA was isolated from cell cultures grown on 75 cm2 plastic tissue culture flasks (RNeasy total RNA preparation kit, Qiagen, Hilden, Germany) according to the manufacturer's instructions. Reverse transcription-PCR reactions were done using a reverse transcription system kit (Invitrogen, Karlsruhe, Germany). Reverse transcription was done in a volume of 20 µL using 1 µg total RNA, 15 units Thermoscript reverse transcriptase, 0.5 mmol/L of each dATP, dGTP, dCTP, and dTTP, and 2.5 µmol/L random nonamers in 1x first strand buffer, 1 µL 0.1 mol/L DTT, and 1 unit/µL RNase inhibitor. PCR reaction (25 µL) contained 2 µL of the reverse transcription reaction, 0.2 mmol/L of each dATP, dGTP, dCTP, and dTTP, 2.5 mmol/L MgCl2, 0.4 µmol/L of each primer, and 2.5 units PlatinumTaq DNA polymerase. Primer annealing temperature was optimized for each primer set: heparanase, 35 cycles of 94°C for 45 seconds, 60°C for 1 minute, and 72°C for 90 seconds; glyceraldehyde-3-phosphate dehydrogenase, 30 cycles of 94°C for 90 seconds, 62°C for 1 minute, and 72°C for 90 seconds. Forward and reverse primers were synthesized according to the sequences extracted from Genbank. The following primer sets were used: heparanase, sense TTCGATCCCAAGAAGGAATCAAC and antisense GTAGTGATGCCATGTAACTGAATC (3) and glyceraldehyde-3-phosphate dehydrogenase, sense CCTGGAGCTGAGAACTACCG and antisense GCTTTCTGAGAAGACCACCG. PCR of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase was done as control for the quality of the RNA preparation.
Western blot analysis. Proteins from cultured cells were extracted in 50 mmol/L Tris (pH 8), 150 mmol/L NaCl, 0.1% SDS, 1% NP40, 0.5% sodium deoxycholate, 0.02% NaN3, 1 mg/mL Pefabloc, 5 µg/mL leupeptin, 1 µg/mL pepstatin, 1 µg/mL aprotinin, and 0.5 mg/mL EDTA. Total protein concentration was determined using the Bradford method (DC Protein Assay, Bio-Rad Laboratories, Munich, Germany). Equal amounts of protein were loaded on 5% SDS-PAGE mini-gels, analyzed, and transferred to Hybond-P membranes (Amersham Pharmacia Biotech, Freiburg, Germany). Blocking was done by incubating the polyvinylidene difluoride membranes with 5% (w/v) nonfat dry milk in TBS (pH 7.5) for 1 hour at room temperature and under continuous agitation. The membranes were then incubated with an affinity-purified mouse monoclonal antibody raised against heparanase [clone HP130 (3), kindly provided by I. Vlodavsky (Jerusalem, Israel)] diluted 1:300 for 18 hours at 8°C under continuous agitation. After three washes with 20 mmol/L Tris (pH 7.5), 500 mmol/L glycine, and 0.05% (w/v) Tween, the antibody binding was visualized by incubation with peroxidase-coupled anti-rabbit IgG antibody (diluted 1:4,000) in 5% (w/v) nonfat dry milk in PBS for 45 minutes at room temperature followed by chemiluminescence detection with the enhanced chemiluminescence system (Amersham Pharmacia Biotech) according to the manufacturer's instructions.
Immunohistochemistry. Immunohistochemical staining using an anti-heparanase mouse monoclonal antibody [clone HP130 (3), kindly provided by I. Vlodavsky] was done on HNSCC cells grown for 24 hours on slides (Histobond, Marienfeld, Bad Mergentheim, Germany), on 5 µm cryostat sections of xenotransplanted tumor tissues as well as on serial sections of the paraffin-embedded biopsies, mounted on 3-aminopropyl-triethoxysilan-coated slides. Acetone (10 minutes) at 20°C and alternatively freshly prepared, buffered 4% paraformaldehyde (20 minutes) were used as fixatives. Incubation with the primary and secondary antibodies and detection were carried out as described elsewhere (27) with Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA).
Statistical evaluation. All statistical analyses were done with two-sided Student's t test.
| Results |
|---|
|
|
|---|
|
|
|
|
|
80% heparanase expression in the tumor tissue and strong expression in culture; Figs. 2A, 3A and B, and 4A; Table 1) and tumor cells from patient 20 (which showed no heparanase expression in the tumor tissue but strong heparanase expression in vitro; Figs. 2B, 3A and B, and 4C; Table 1) into NOD/Scid mice and analyzed heparanase protein expression using immunohistochemistry after tumor engraftment. Interestingly, heparanase was strongly expressed in tumors derived from culture 4 (Fig. 5A) and expression was lost in tumors from culture 20 (Fig. 5C). Thus, an expression pattern was restored in the engrafted mice, which was similar to that of the original patient's tumor but clearly differed from that in culture, suggesting regulatory influences in vivo (e.g., by the tumor stroma).
Heparanase expression in situ and prognosis of head and neck squamous cell carcinoma patients. Because heparanase expression was shown previously to influence the prognosis of some malignancies, we did comparative analysis of the observed heparanase expression in tumor tissues (Table 1) and survival times of the respective patients. Patients lacking heparanase-expressing cells (<5%) in their primary or relapsed tumors had a prolonged disease-free survival of 25.8 ± 31.4 months compared with patients containing heparanase-positive tumors (
5% heparanase expression, mean disease-free survival, 8.2 ± 7.8 months; P = 0.04; Fig. 6A; Table 1). Similarly, overall survival was higher in patients lacking heparanase-expressing tumor cells in their primary tumors compared with those with heparanase expression (mean, 28.8 ± 30.2 versus 12.5 ± 6.4 months, respectively; P = 0.03; Fig. 6A; Table 1). Similarly, low numbers of heparanase-expressing tumor cells in lymph node metastases (<15%) were correlated with better disease-free survival and overall survival (23.8 ± 4.3 and 30.6 ± 6.0 months, respectively) compared with metastases with high numbers of heparanase-expressing tumor cells (
15%) with disease-free survival and overall survival of 13.0 ± 8.7 and 17.4 ± 7.0 months, respectively (P = 0.03, disease-free survival; P < 0.01, overall survival; Fig. 6B).
|
15%) were associated with occurrence of distant metastases in six of seven patients, whereas none of four patients containing low levels of heparanase expression (<15%) in their lymph node metastases developed distant metastases (P = 0.02; Table 1). In accordance, heparanase expression was higher in lymph node metastases from patients with distant metastases compared with those without distant metastases (Fig. 6C). No correlation of prognostic variables was found with expression levels of heparanase in tumor cell cultures. Moreover, no other clinicopathologic variable, including sex, age, tumor-node-metastasis stage, tumor grade, or presence of distant metastases, showed a correlation with heparanase expression in primary tumors or tumor cell cultures (Table 1).
| Discussion |
|---|
|
|
|---|
In accordance with our results, three other studies recently reported heparanase mRNA expression by reverse transcription-PCR in all of 10 oral cancer cell lines and in 10 of 22 (45%) unrelated oral cancer tissues (1, 25, 26). Interestingly, one study reported a predominant heparanase expression in some metastasized tumors, although the number of patients analyzed was to low for statistical evaluation (25). Similarly, the invasiveness of three oral squamous cell carcinoma cell lines orthotopically transplanted into Scid mice seemed to correlate with increased heparanase mRNA expression in situ (26). Analysis of mRNA levels was used in these studies probably due to the lack of commercially available antibodies specific for heparanase protein. However, mRNA analysis in tumor tissue lysates may provide misleading results due to heparanase expression by nonmalignant cells or due to neglect in case of very low proportions of heparanase-expressing tumor cells. In contrast to these studies, by the use of a specific antibody, we were not only able to detect expression of heparanase by tumor cells in a higher number (68% in primary/relapsed tumors and 75% in lymph node metastases) of tumor tissues but also able to add important information on the localization of the protein within the tumor tissue.
Most interestingly, we found a specific distribution pattern in all HNSCC tissues presenting with heparanase-positive tumor cells. Whereas central areas expressed little heparanase, strong heparanase expression was localized at the invasion front of the tumor and in disseminated tumor cells. This observation suggests the possibility of dynamic regulation of heparanase expression in tumor cells. Such regulation may be driven by Ets transcription factors, which can be activated by a variety of cytokines and are involved in heparanase induction (28). The observed expression pattern strikingly correlates with animal experiments on heparanase-transfected tumor cell lines: low expression levels induced angiogenesis and promoted cell survival and proliferation, whereas high expression of heparanase had an antiproliferative effect and enhanced cell migration and invasion (21). Thus, high expression of heparanase even by a few tumor cells may be sufficient to promote dissemination of single tumor cells into adjacent tissuesa potential origin of tumor relapses or distant metastases commonly observed in HNSCC. In accordance with this assumption, disease-free survival, and even overall survival, was significantly enhanced in patients containing heparanase-negative tumors, and distant metastasis occurred especially in those patients with high numbers of heparanase-positive tumor cells in their lymph node metastases. In this study, 31 tumor tissues from altogether 24 patients could be analyzed and correlated with patient outcome. Although statistically significant differences were obtained with respect to the patient outcome in heparanase-low and heparanase-high groups, the limited number of patients demands a subsequent study based on immunohistologic quantitation of heparanase expression in a larger number of cases to validate the promising data presented in this study. Such validation seems of clinical importance, because heparanase is the only heparan sulfate proteoglycandegrading enzyme in humans. Therefore, its selective inhibition may provide an additional adjuvant therapy to prolong the disease-free survival of HNSCC cancer patients.
We conclude that heparanase expression is regulated in vivo and involved in the invasiveness of HNSCC. Even small numbers of heparanase-expressing tumor cells may be sufficient to promote tumor dissemination and formation of local metastases. Therefore, use of heparanase as a prognostic marker in HNSCC should be based on histologic analysis rather than mRNA detection.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received 4/ 7/04; revised 12/10/04; accepted 1/31/05.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G. W. Yip, M. Smollich, and M. Gotte Therapeutic value of glycosaminoglycans in cancer. Mol. Cancer Ther., September 1, 2006; 5(9): 2139 - 2148. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. H. Schmitz-Winnenthal, C. Volk, K. Z'graggen, L. Galindo, D. Nummer, Y. Ziouta, M. Bucur, J. Weitz, V. Schirrmacher, M. W. Buchler, et al. High Frequencies of Functional Tumor-Reactive T Cells in Bone Marrow and Blood of Pancreatic Cancer Patients Cancer Res., November 1, 2005; 65(21): 10079 - 10087. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |