Clinical Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium Tumor Immunology: New Perspectives
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Beckhove, P.
Right arrow Articles by Herold-Mende, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Beckhove, P.
Right arrow Articles by Herold-Mende, C.
Clinical Cancer Research Vol. 11, 2899-2906, April 15, 2005
© 2005 American Association for Cancer Research

Imaging, Diagnosis, Prognosis

Heparanase Expression at the Invasion Front of Human Head and Neck Cancers and Correlation with Poor Prognosis

Philipp Beckhove1, Burkhard M. Helmke2, Yvonne Ziouta1, Mariana Bucur1, Wolfgang Dörner1, Carolin Mogler2, Gerhard Dyckhoff3 and Christel Herold-Mende3,4

Authors' Affiliations: 1 Tumor Immunology Program, German Cancer Research Center; 2 Department of Pathology, University of Heidelberg; and Departments of 3 Head and Neck Surgery and 4 Neurosurgery University Hospital of Heidelberg, Heidelberg, Germany

Requests for reprints: Philipp Beckhove, Tumor Immunology Program, German Cancer Research Center, INF 280, 69120 Heidelberg, Germany. Phone: 49-6221-423745; Fax: 49-6221-423702; E-mail: P.Beckhove{at}dkfz.de.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Purpose: Head and neck squamous cell carcinomas (HNSCC) are characterized by a poor prognosis due to aggressive, recurrent tumor growth. Expression of the extracellular matrix–degrading enzyme heparanase was associated with poorer prognosis in several cancers. We analyzed the presence of heparanase in HNSCC tissues and tumor cells and its potential prognostic significance.

Experimental Design: We analyzed the expression of the active form of heparanase in HNSCC tissues in corresponding tumor cell cultures and after xenotransplantation of tumor cell cultures into NOD/Scid mice by immunohistochemistry, Western blot analysis, and reverse transcription-PCR in altogether 25 patients and did a comparison with clinicopathologic data of the patients.

Results: Heparanase expression in situ was detected in all tumor biopsies in the tumor stroma and in tumor cells from 13 of 19 primary tumors and 9 of 12 lymph node metastases. Heparanase was localized in disseminated tumor cells, in tumor cell clusters invading adjacent stromal tissues, and in tumor cells at the tumor invasion front. Lymph node metastases expressed higher levels of heparanase compared with corresponding primary tumors. In contrast to a heterogeneous expression pattern in tumor tissues, all corresponding HNSCC tumor cell cultures showed a rather homogeneous heparanase expression on the mRNA and protein levels. Comparison of heparanase expression in situ and in corresponding tumor cell cultures in vitro or after xenotransplantation into NOD/Scid mice revealed that heparanase expression was regulated in vivo. Lack of heparanase in tumor cells from primary tumors or lymph node metastases was correlated with prolonged disease-free survival and overall survival.

Conclusion: Heparanase expression seems to be involved in the invasiveness and aggressiveness of HNSCC.

Key Words: tumor invasion • NOD/Scid mice • primary tumor culture

Head and neck cancer is a major cause of cancer morbidity worldwide with >500,000 new cases reported annually (1). Despite progress in surgical techniques and an improved application of radiotherapy and chemotherapy, the mortality of these tumors is still high (2). Head and neck cancers are characterized by local tumor aggressiveness due to invasion of single tumor cells or tumor lobules into adjacent tissues and a marked propensity for dissemination to cervical lymph nodes.

The hydrolase heparanase has been described recently to be involved in tumor invasion and metastasis (3). Heparanase is an endo-ß-D-glucuronidase, which is predominantly involved in cleavage of heparan sulfate residues and hence participates in extracellular matrix degradation and remodeling (4). Heparan sulfate proteoglycans are ubiquitous macromolecules associated with the cell surface and the main constituents of the extracellular matrix of a wide range of tissues (5). In the process of metastasis, the penetration of the basement membranes in blood or lymphatic vessels is an essential step required for the intravasation and extravasation of cancer cells (6). In addition, heparanase also regulates angiogenesis, proliferation of cancer cells, and lipid metabolism by releasing heparan sulfate–bound growth factors and enzymes, such as basic fibroblast growth factor and lipoprotein lipase (6). A single heparanase gene encodes for a 65-kDa protein that undergoes a proteolytic cleavage, yielding a 50-kDa polypeptide, which is ~100-fold more active than the 65-kDa form (4).

Heparanase is directly involved in cell adhesion independent of its enzymatic activity provided that the enzyme is expressed on the cell surface (7). Heparanase-mediated cell adhesion to extracellular matrix results in integrin-dependent cell spreading and reorganization of the actin cytoskeleton (7). The surface-bound enzyme also augments cell invasion through a reconstituted basement membrane. Heparanase activity has been identified in a variety of cells from normal tissues, primarily the placenta and lymphoid organs (8, 9), among which are cytotrophoblasts, endothelial cells, platelets, mast cells, neutrophils, macrophages, T and B lymphocytes, ganglion cells, and nerves, with little or no staining in connective tissue cells and most normal epithelia (10, 11). Whereas no or weak heparanase expression was detected in normal epithelial cells, heparanase expression is increased in human carcinomas of the breast, lung, prostate, ovary, cervix, bladder, pancreas, liver, esophagus, colon, and stomach compared with the corresponding normal tissues (4, 10–20). In animal models, heparanase overexpression inhibited tumor cell proliferation but conferred a highly invasive phenotype to tumor cells leading to enhanced generation of metastases and decreased survival (21, 22). Clinical studies revealed an association of elevated heparanase expression with decreased tumor cell differentiation, increased tumor vascularity, metastasis formation, or poor postoperative survival of some tumors (bladder cancer, early pancreatic cancer, gastric cancer, colon cancer, invasive cervix cancer, and multiple myeloma; refs. 14–16, 18–20, 23, 24).

Thus far, only few studies have been published on heparanase expression in head and neck cancers concentrating on the expression in the oral cavity. They reported mRNA expression in tumor tissues but provided no data on the cell types involved or its localization in situ (25, 26).

We did this study to verify and extend previous results regarding heparanase location in head and neck squamous cell carcinoma (HNSCC) tissues, differential expression of heparanase in HNSCC tumor tissues and tumor cell lines, and a potential implication of heparanase expression for patient prognosis. Therefore, tumor tissue from a broad variety of 25 head and neck cancers was compared with corresponding tumor cell cultures from the same tumors with regard to heparanase expression based on detection of heparanase mRNA and heparanase protein in reverse transcription-PCR, Western blot, and immunohistochemistry using a monoclonal antibody specific for the active 50-kDa fragment of heparanase.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Samples. Tissue specimens of 25 HNSCC tumors were obtained intraoperatively after informed consent and approval of the local ethics committee. Fresh tissues were divided into two parts, one part was used to establish primary tumor cultures and the other part was paraffin embedded immediately after surgery. Clinical data of the respective patients concerning primary tumor localization, tumor-node-metastasis classification, and follow-up are summarized in Table 1.


View this table:
[in this window]
[in a new window]
  		Table 1. Clinical data of HNSCC patients and heparanase expression

 
Cell lines and cell culture. HNSCC tumor cell cultures have been established in our laboratory as described earlier (27). All tumor cultures were characterized for their epithelial origin by the immunohistochemical detection of tissue-specific markers using antibodies recognizing a broad spectrum of cytokeratins (clone MNF 116 recognizing cytokeratins 5, 6, 8, 17, and 19 and clone 34BE12 recognizing cytokeratins 1, 5, 10, and 14, both DAKO, Hamburg, Germany). Lack of endothelial cell contamination was determined by staining with endothelial cell–specific antibodies directed against factor VIII (DAKO) and platelet/endothelial cell adhesion molecule 1 (PharMingen, Heidelberg, Germany). Only cultures showing a homogenous staining for the cytokeratin markers and no staining for both endothelial cell markers were selected for this study. Cells were cultured routinely in RPMI 1640 supplemented with 10% FCS, 2 mmol/L glutamine, and antibiotics at 37°C, 5% CO2, and 95% air in a humidified incubator, with medium changes twice weekly. After reaching confluence, cells were harvested by a brief incubation with trypsin/EDTA solution (Viralex, PAA, Linz, Austria) and seeded into a fresh 75 cm2 plastic tissue culture flask. Mycoplasma contamination of the cells was excluded by 4',6-diamidino-2-phenylindole staining.

Mice and tumor cell xenotransplantation. Six- to 8-week-old female NOD/Scid mice (purchased from Charles River Wiga GmbH, Sulzfeld, Germany) were kept under pathogen-free conditions. Cultured tumor cells (5 x 106) were injected in 200 µL PBS s.c. into the left flank region of each mouse. Tumor growth was monitored twice weekly. When tumor diameter exceeded 6 mm, mice were sacrificed and tumors were snap frozen for immunohistologic analysis.

RNA isolation and reverse transcription-PCR analysis. Total RNA was isolated from cell cultures grown on 75 cm2 plastic tissue culture flasks (RNeasy total RNA preparation kit, Qiagen, Hilden, Germany) according to the manufacturer's instructions. Reverse transcription-PCR reactions were done using a reverse transcription system kit (Invitrogen, Karlsruhe, Germany). Reverse transcription was done in a volume of 20 µL using 1 µg total RNA, 15 units Thermoscript reverse transcriptase, 0.5 mmol/L of each dATP, dGTP, dCTP, and dTTP, and 2.5 µmol/L random nonamers in 1x first strand buffer, 1 µL 0.1 mol/L DTT, and 1 unit/µL RNase inhibitor. PCR reaction (25 µL) contained 2 µL of the reverse transcription reaction, 0.2 mmol/L of each dATP, dGTP, dCTP, and dTTP, 2.5 mmol/L MgCl2, 0.4 µmol/L of each primer, and 2.5 units PlatinumTaq DNA polymerase. Primer annealing temperature was optimized for each primer set: heparanase, 35 cycles of 94°C for 45 seconds, 60°C for 1 minute, and 72°C for 90 seconds; glyceraldehyde-3-phosphate dehydrogenase, 30 cycles of 94°C for 90 seconds, 62°C for 1 minute, and 72°C for 90 seconds. Forward and reverse primers were synthesized according to the sequences extracted from Genbank. The following primer sets were used: heparanase, sense TTCGATCCCAAGAAGGAATCAAC and antisense GTAGTGATGCCATGTAACTGAATC (3) and glyceraldehyde-3-phosphate dehydrogenase, sense CCTGGAGCTGAGAACTACCG and antisense GCTTTCTGAGAAGACCACCG. PCR of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase was done as control for the quality of the RNA preparation.

Western blot analysis. Proteins from cultured cells were extracted in 50 mmol/L Tris (pH 8), 150 mmol/L NaCl, 0.1% SDS, 1% NP40, 0.5% sodium deoxycholate, 0.02% NaN3, 1 mg/mL Pefabloc, 5 µg/mL leupeptin, 1 µg/mL pepstatin, 1 µg/mL aprotinin, and 0.5 mg/mL EDTA. Total protein concentration was determined using the Bradford method (DC Protein Assay, Bio-Rad Laboratories, Munich, Germany). Equal amounts of protein were loaded on 5% SDS-PAGE mini-gels, analyzed, and transferred to Hybond-P membranes (Amersham Pharmacia Biotech, Freiburg, Germany). Blocking was done by incubating the polyvinylidene difluoride membranes with 5% (w/v) nonfat dry milk in TBS (pH 7.5) for 1 hour at room temperature and under continuous agitation. The membranes were then incubated with an affinity-purified mouse monoclonal antibody raised against heparanase [clone HP130 (3), kindly provided by I. Vlodavsky (Jerusalem, Israel)] diluted 1:300 for 18 hours at 8°C under continuous agitation. After three washes with 20 mmol/L Tris (pH 7.5), 500 mmol/L glycine, and 0.05% (w/v) Tween, the antibody binding was visualized by incubation with peroxidase-coupled anti-rabbit IgG antibody (diluted 1:4,000) in 5% (w/v) nonfat dry milk in PBS for 45 minutes at room temperature followed by chemiluminescence detection with the enhanced chemiluminescence system (Amersham Pharmacia Biotech) according to the manufacturer's instructions.

Immunohistochemistry. Immunohistochemical staining using an anti-heparanase mouse monoclonal antibody [clone HP130 (3), kindly provided by I. Vlodavsky] was done on HNSCC cells grown for 24 hours on slides (Histobond, Marienfeld, Bad Mergentheim, Germany), on 5 µm cryostat sections of xenotransplanted tumor tissues as well as on serial sections of the paraffin-embedded biopsies, mounted on 3-aminopropyl-triethoxysilan-coated slides. Acetone (10 minutes) at –20°C and alternatively freshly prepared, buffered 4% paraformaldehyde (20 minutes) were used as fixatives. Incubation with the primary and secondary antibodies and detection were carried out as described elsewhere (27) with Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA).

Statistical evaluation. All statistical analyses were done with two-sided Student's t test.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
Heparanase expression in head and neck squamous cell carcinoma tumor tissue. We analyzed the expression of heparanase in tumor tissues of 17 primary tumors, 2 local tumor relapses, and 12 lymph node metastases by immunohistology using a monoclonal antibody specific for the active 50-kDa fragment of heparanase (Table 1). Heparanase expression in tumor tissues was highly heterogeneous. The majority of tumor cells within solid tumor masses was heparanase negative (Fig. 1A and B). In contrast, in most of the tumors analyzed, heparanase-expressing tumor cells were found at the invasion front of the tumor and in single tumor cells or small tumor cell clusters disseminating into the adjacent tissue (Figs. 1A-D and 2A). This feature of selective heparanase expression of stroma invading tumor cells was found in almost all tumors analyzed. Interestingly, in many tumors, noncellular heparanase staining was found in the extracellular matrix along the tumor invasion front, suggesting heparanase release into the connective tissue (Fig. 1B). In most tumors, heparanase expression was found in the cytoplasm as well as on the cell surface. Quantitative analysis revealed a rather low proportion of heparanase-expressing cells among all tumor cells ranging from 0% to 80% (Table 1), with a median of 10% (mean, 22%) in primary tumors and 15% (mean, 30%) in lymph node metastases, which was mainly restricted to those tumor cells in contact with adjacent nonmalignant tissue. In contrast to this common expression pattern, tumors from seven patients showed no heparanase expression at all (Fig. 2B; Table 1). A comparison of seven primary tumors with corresponding lymph node metastases from the same patients revealed a relatively higher proportion of heparanase-expressing tumor cells in the metastases (mean, 31% and 46%, respectively; P < 0.06, paired t test; Table 1). Heparanase expression was not restricted to tumor cells but was localized also in immune cell aggregates and in small vessel walls adjacent to tumor cell areas (Fig. 2C and D).



View larger version (131K):
[in this window]
[in a new window]
  		Fig. 1. Heparanase staining in tumor tissue. A and B, heparanase expression at the tumor invasion front. Arrow, heparanase-expressing tumor cells; arrowhead, noncellular heparanase within connective tissue potentially released by tumor cells. C and D, predominant heparanase expression in tumor cell aggregates and single tumor cells invading adjacent connective tissue. The tumors were derived from patients 2 (A-C) and 13 (D). Original magnification, x200 (A and B) and x100 (C and D). All slides were counterstained with hemalaun for visualization of nuclei.

 


View larger version (120K):
[in this window]
[in a new window]
  		Fig. 2. Heparanase expression in tumor cell clusters from patients 4 (A; for comparison with corresponding xenotransplanted tumor; see also Fig. 5A) and 20 (B; no heparanase expression was detected; for comparison with corresponding xenotransplanted tumor, see also Fig. 5C). C and D, heparanase expression by nonmalignant cells in tumor tissue. The tumors were derived from patients 4 (A), 20 (B), 15 (C), and 11 (D). Original magnification, x400 (A), x200 (B and D), and x25 (C). All slides were counterstained with hemalaun for visualization of nuclei.

 


View larger version (137K):
[in this window]
[in a new window]
  		Fig. 5. A-D, immunohistology of xenotransplanted tumor cells from HNSCC cultures [4 (A and B) and 20 (C and D)] stained for expression of heparanase (A and C) or with isotype antibody as control (B and D). Original magnification, x400 (A and B) and x250 (C and D). All slides were counterstained with hemalaun for visualization of nuclei.

 
Heparanase expression in head and neck squamous cell carcinoma tumor cell cultures. We established short-term tumor cell cultures from altogether 25 HNSCCs. The original tumors were localized in the oral cavity (n = 9), oropharynx (n = 6), larynx (n = 4), hypopharynx (n = 3), maxillary sinus (n = 1), or carcinoma of unknown primary (n = 2). Thus, the tumors represent a broad variety of HNSCC. The tumor cell cultures were extensively characterized: all of them showed a uniform cobblestone morphology and expression of cytokeratins and were free of other cell types. Heparanase mRNA was detected by reverse transcription-PCR in all tumor cell cultures (Fig. 3A; Table 1). Analysis of heparanase expression on the protein level by Western blot of tumor cell lysates confirmed the observed mRNA expression (Fig. 3B; Table 1). As positive control, the heparanase-transfected breast cancer cell line MCF-7 hpa was used, which strongly overexpresses heparanase (data not shown; the cell line was kindly provided by I. Vlodavsky). Interestingly, some cultures showed an even higher amount of heparanase protein compared with MCF-7 hpa (Fig. 3B). We next analyzed heparanase protein expression on cells of 16 representative tumor cell cultures by immunocytology to clarify if heparanase was expressed homogeneously by all cells or by a minority of tumor cells. We found a rather homogeneous expression of the protein in the cytoplasm of all tumor cells (Fig. 4A and C). Thus, heparanase was expressed homogeneously by all tumor cultures analyzed on the mRNA as well as on the protein level.



View larger version (57K):
[in this window]
[in a new window]
  		Fig. 3. A, heparanase mRNA expression in HNSCC tumor cell cultures analyzed by reverse transcription-PCR. Expression of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as positive control for RNA integrity. Patient #, patient no. (for comparison, see Table 1). B, expression of the enzymatically active 50-kDa heparanase fragment in HNSCC cell cultures as determined by Western blot analysis. One representative blot containing samples from 12 of 25 different patients and from heparanase-transfected breast cancer cell line MCF-7 hpa as control.

 


View larger version (118K):
[in this window]
[in a new window]
  		Fig. 4. Immunohistochemical analysis of heparanase protein expression in HNSCC cell cultures. A-D, heparanase staining of HNSCC cultures derived from 4 (A) and 20 (C) and control stainings for cytokeratins (B; 4) or isotype control (D; 20). Original magnification, x400 (A-D). All slides were counterstained with hemalaun for visualization of nuclei.

 
Regulation of heparanase expression in vivo. We wondered if the observed differences in the proportion of heparanase-expressing cells between cell cultures and patient tumors were due to regulatory influences in vivo. We therefore transplanted cultured tumor cells from patient 4 (which showed ~80% heparanase expression in the tumor tissue and strong expression in culture; Figs. 2A, 3A and B, and 4A; Table 1) and tumor cells from patient 20 (which showed no heparanase expression in the tumor tissue but strong heparanase expression in vitro; Figs. 2B, 3A and B, and 4C; Table 1) into NOD/Scid mice and analyzed heparanase protein expression using immunohistochemistry after tumor engraftment. Interestingly, heparanase was strongly expressed in tumors derived from culture 4 (Fig. 5A) and expression was lost in tumors from culture 20 (Fig. 5C). Thus, an expression pattern was restored in the engrafted mice, which was similar to that of the original patient's tumor but clearly differed from that in culture, suggesting regulatory influences in vivo (e.g., by the tumor stroma).

Heparanase expression in situ and prognosis of head and neck squamous cell carcinoma patients. Because heparanase expression was shown previously to influence the prognosis of some malignancies, we did comparative analysis of the observed heparanase expression in tumor tissues (Table 1) and survival times of the respective patients. Patients lacking heparanase-expressing cells (<5%) in their primary or relapsed tumors had a prolonged disease-free survival of 25.8 ± 31.4 months compared with patients containing heparanase-positive tumors (≥5% heparanase expression, mean disease-free survival, 8.2 ± 7.8 months; P = 0.04; Fig. 6A; Table 1). Similarly, overall survival was higher in patients lacking heparanase-expressing tumor cells in their primary tumors compared with those with heparanase expression (mean, 28.8 ± 30.2 versus 12.5 ± 6.4 months, respectively; P = 0.03; Fig. 6A; Table 1). Similarly, low numbers of heparanase-expressing tumor cells in lymph node metastases (<15%) were correlated with better disease-free survival and overall survival (23.8 ± 4.3 and 30.6 ± 6.0 months, respectively) compared with metastases with high numbers of heparanase-expressing tumor cells (≥15%) with disease-free survival and overall survival of 13.0 ± 8.7 and 17.4 ± 7.0 months, respectively (P = 0.03, disease-free survival; P < 0.01, overall survival; Fig. 6B).



View larger version (16K):
[in this window]
[in a new window]
  		Fig. 6. Prolonged survival of patients bearing heparanase-low tumors. All survival times depict time interval between first diagnosis of tumor and tumor relapse (disease-free survival, DFS) or death (overall survival, OS) of the patient. A, survival times of all patients from which heparanase expression in primary or locally relapsed tumor tissue (PT) could be analyzed (see Table 1). Left, mean disease-free survival of patients with heparanase-positive (≥5% heparanase expression, black columns, n = 13) or heparanase-negative (<5% heparanase expression, gray columns, n = 6) tumors; right, mean overall survival of patients with heparanase-positive (black columns, n = 13) or heparanase-negative (gray columns, n = 7) tumors. B, survival times of those patients from which heparanase expression in lymph node metastases (LN metastases) could be analyzed (see Table 1). Left, mean disease-free survival of patients with heparanase-high (≥15% heparanase expression, black columns, n = 7) or heparanase-low (<15% heparanase expression, gray columns, n = 4) tumors; right, mean overall survival of patients with heparanase-high (black columns, n = 7) or heparanase-low (gray columns, n = 5) tumors. C, relative numbers of heparanase-positive tumor cells in lymph node metastases of patients with (black columns) or without (gray columns) distant metastases. Bars, SE. Asterisk, significant differences between the respective groups.

 
Interestingly, high levels of heparanase expression in lymph node metastases (≥15%) were associated with occurrence of distant metastases in six of seven patients, whereas none of four patients containing low levels of heparanase expression (<15%) in their lymph node metastases developed distant metastases (P = 0.02; Table 1). In accordance, heparanase expression was higher in lymph node metastases from patients with distant metastases compared with those without distant metastases (Fig. 6C).

No correlation of prognostic variables was found with expression levels of heparanase in tumor cell cultures. Moreover, no other clinicopathologic variable, including sex, age, tumor-node-metastasis stage, tumor grade, or presence of distant metastases, showed a correlation with heparanase expression in primary tumors or tumor cell cultures (Table 1).


   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
In the present study, we report for the first time a comparative analysis of heparanase expression in primary head and neck cancers of various locations and in corresponding short-term tumor cell cultures. All HNSCC cultures showed a homogeneous heparanase expression in vitro. In contrast, in tumor tissues, only a minority of tumor cells expressed the active form of heparanase and if at all most frequently in the vicinity of stromal areas or was even completely absent in some tumors. Interestingly, after xenotransplantation of tumor cells showing a marked heparanase expression in vitro, the resulting tumors adjusted their heparanase expression to levels similar to that of the original primary tumor. Thus, heparanase expression seems to be regulated in vivo by factors present in or released by stromal tissue.

In accordance with our results, three other studies recently reported heparanase mRNA expression by reverse transcription-PCR in all of 10 oral cancer cell lines and in 10 of 22 (45%) unrelated oral cancer tissues (1, 25, 26). Interestingly, one study reported a predominant heparanase expression in some metastasized tumors, although the number of patients analyzed was to low for statistical evaluation (25). Similarly, the invasiveness of three oral squamous cell carcinoma cell lines orthotopically transplanted into Scid mice seemed to correlate with increased heparanase mRNA expression in situ (26). Analysis of mRNA levels was used in these studies probably due to the lack of commercially available antibodies specific for heparanase protein. However, mRNA analysis in tumor tissue lysates may provide misleading results due to heparanase expression by nonmalignant cells or due to neglect in case of very low proportions of heparanase-expressing tumor cells. In contrast to these studies, by the use of a specific antibody, we were not only able to detect expression of heparanase by tumor cells in a higher number (68% in primary/relapsed tumors and 75% in lymph node metastases) of tumor tissues but also able to add important information on the localization of the protein within the tumor tissue.

Most interestingly, we found a specific distribution pattern in all HNSCC tissues presenting with heparanase-positive tumor cells. Whereas central areas expressed little heparanase, strong heparanase expression was localized at the invasion front of the tumor and in disseminated tumor cells. This observation suggests the possibility of dynamic regulation of heparanase expression in tumor cells. Such regulation may be driven by Ets transcription factors, which can be activated by a variety of cytokines and are involved in heparanase induction (28). The observed expression pattern strikingly correlates with animal experiments on heparanase-transfected tumor cell lines: low expression levels induced angiogenesis and promoted cell survival and proliferation, whereas high expression of heparanase had an antiproliferative effect and enhanced cell migration and invasion (21). Thus, high expression of heparanase even by a few tumor cells may be sufficient to promote dissemination of single tumor cells into adjacent tissues—a potential origin of tumor relapses or distant metastases commonly observed in HNSCC. In accordance with this assumption, disease-free survival, and even overall survival, was significantly enhanced in patients containing heparanase-negative tumors, and distant metastasis occurred especially in those patients with high numbers of heparanase-positive tumor cells in their lymph node metastases. In this study, 31 tumor tissues from altogether 24 patients could be analyzed and correlated with patient outcome. Although statistically significant differences were obtained with respect to the patient outcome in heparanase-low and heparanase-high groups, the limited number of patients demands a subsequent study based on immunohistologic quantitation of heparanase expression in a larger number of cases to validate the promising data presented in this study. Such validation seems of clinical importance, because heparanase is the only heparan sulfate proteoglycan–degrading enzyme in humans. Therefore, its selective inhibition may provide an additional adjuvant therapy to prolong the disease-free survival of HNSCC cancer patients.

We conclude that heparanase expression is regulated in vivo and involved in the invasiveness of HNSCC. Even small numbers of heparanase-expressing tumor cells may be sufficient to promote tumor dissemination and formation of local metastases. Therefore, use of heparanase as a prognostic marker in HNSCC should be based on histologic analysis rather than mRNA detection.


   Acknowledgments
 
We thank I. Vlodavsky for providing the heparanase-transfected cell line MCF-7 hpa and the heparanase-specific monoclonal antibody HP130.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 4/ 7/04; revised 12/10/04; accepted 1/31/05.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Simizu S, Ishida K, Wierzba MK, Sato TA, Osada H. Expression of heparanase in human tumor cell lines and human head and neck tumors. Cancer Lett 2003;193:83–9.[CrossRef][Medline]
  2. Parkin DM, Pisani P, Ferlay J. Global cancer statistics. CA Cancer J Clin 1999;49:33–64.[Abstract/Free Full Text]
  3. Vlodavsky I, Friedmann Y, Elkin M, et al. Mammalian heparanase: gene cloning, expression and function in tumor progression and metastasis. Nat Med 1999;7:793–802.
  4. Vlodavsky I, Friedmann Y. Molecular properties and involvement of heparanase in cancer metastasis and angiogenesis. J Clin Invest 2001;108:341–7.[CrossRef][Medline]
  5. Wight TN, Kinsella MG, Qwarnstromn EE. The role of proteoglycans in cell adhesion, migration and proliferation. Curr Opin Cell Biol 1992;4:793–801.[CrossRef][Medline]
  6. Vlodavsky I, Goldshmidt O, Zcharia E, et al. Mammalian heparanase: involvement in cancer metastasis, angiogenesis and normal development. Semin Cancer Biol 2002;12:121–9.[CrossRef][Medline]
  7. Goldshmidt O, Zcharia E, Cohen M, et al. Heparanase mediates cell adhesion independent of its enzymatic activity. FASEB J 2003;17:1015–25.[Abstract/Free Full Text]
  8. Hulett MD, Freeman C, Hamdorf BJ, Baker RT, Harris MJ, Parish CR. Cloning of mammalian heparanase, an important enzyme in tumor invasion and metastasis. Nat Med 1999;5:803–9.[CrossRef][Medline]
  9. McKenzie E, Tyson K, Stamps A, et al. Cloning and expression profiling of hpa2, a novel mammalian heparanase family member. Biochem Biophys Res Commun 2000;276:1170–7.[CrossRef][Medline]
  10. Friedmann Y, Vlodavsky I, Aingorn H, et al. Expression of heparanase in normal, dysplastic, and neoplastic human colonic mucosa and stroma. Evidence for its role in colonic tumorigenesis. Am J Pathol 2000;157:1167–75.[Abstract/Free Full Text]
  11. Ginath S, Menczer J, Friedmann Y, et al. Expression of heparanase, Mdm2, and erbB2 in ovarian cancer. Int J Oncol 2001;18:1133–44.[Medline]
  12. Elkin M, Cohen I, Zcharia E, et al. Regulation of heparanase gene expression by estrogen in breast cancer. Cancer Res 2003;63:8821–6.[Abstract/Free Full Text]
  13. Uno F, Fujiwara T, Takata Y, et al. Antisense-mediated suppression of human heparanase gene expression inhibits pleural dissemination of human cancer cells. Cancer Res 2001;61:7855–60.[Abstract/Free Full Text]
  14. Tang W, Nakamura Y, Tsujimoto M, et al. Heparanase: a key enzyme in invasion and metastasis of gastric carcinoma. Mod Pathol 2002;6:593–8.[CrossRef]
  15. Endo K, Maejara U, Baba H, et al. Heparanase gene expression and metastatic potential in human gastric cancer. Anticancer Res 2001;5:3365–9.
  16. Gohji K, Okamoto M, Kitazawa S, et al. Heparanase protein and gene expression in bladder cancer. J Urol 2001;166:1286–90.[CrossRef][Medline]
  17. Ikeguchi M, Fukuda K, Yamaguchi K, Kondo A, Tsujitani S, Kaibara N. Quantitative analysis of heparanase gene expression in esophageal squamous cell carcinoma. Ann Surg Oncol 2003;10:297–304.[Abstract/Free Full Text]
  18. Kim AW, Xu X, Hollinger EF, Gattuso P, Godellas CV, Prinz RA. Human heparanase-1 gene expression in pancreatic adenocarcinoma. J Gastrointest Surg 2002;6:167–72.[CrossRef][Medline]
  19. Kuniyasu H, Chihara Y, Kubozoe T, Takahashi T. Co-expression of CD44v3 and heparanase is correlated with metastasis of human colon cancer. Int J Mol Med 2002;10:333–7.[Medline]
  20. Shinyo Y, Kodama J, Hongo A, Yoshinouchi M, Hiramatsu Y. Heparanase expression is an independent prognostic factor in patients with invasive cervical cancer. Ann Oncol 2003;14:1505–10.[Abstract/Free Full Text]
  21. Zetser A, Bashenko Y, Miao HQ, Vlodavsky I, Ilan N. Heparanase affects adhesive and tumorigenic potential of human glioma cells. Cancer Res 2003;63:7733–41.[Abstract/Free Full Text]
  22. Goldshmidt O, Zcharia E, Abramovitch R, et al. Cell surface expression and secretion of heparanase markedly promote tumor angiogenesis and metastasis. Proc Natl Acad Sci U S A 2002;99:10031–6.[Abstract/Free Full Text]
  23. Kelly T, Miao HQ, Yang Y, et al. High heparanase activity in multiple myeloma is associated with elevated microvessel density. Cancer Res 2003;63:8749–56.[Abstract/Free Full Text]
  24. Takaoka M, Naomoto Y, Ohkawa T, et al. Heparanase expression correlates with invasion and poor prognosis in gastric cancers. Lab Invest 2003;83:613–22.[Medline]
  25. Ikuta M, Podyma KA, Maruyama K, Enomoto S, Yanagishita M. Expression of heparanase in oral cancer cell lines and oral cancer tissues. Oral Oncol 2001;37:177–84.[CrossRef][Medline]
  26. Kurokawa H, Katsube K, Podyma KA, et al. Heparanase and tumor invasion patterns in human oral squamous cell carcinoma xenografts. Cancer Sci 2003;94:277–85.[Medline]
  27. Ninck S, Reisser C, Dyckhoff G, Helmke B, Bauer H, Herold-Mende C. Expression profiles of angiogenic growth factors in squamous cell carcinomas of the head and neck. Int J Cancer 2003;106:34–44.[CrossRef][Medline]
  28. Lu WC, Liu YN, Kang BB, Chen JH. Transactivation of heparanase promoter by Ets transcription factors. Oncogene 2003;22:919–23.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Molecular Cancer TherapeuticsHome page
G. W. Yip, M. Smollich, and M. Gotte
Therapeutic value of glycosaminoglycans in cancer.
Mol. Cancer Ther., September 1, 2006; 5(9): 2139 - 2148.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
F. H. Schmitz-Winnenthal, C. Volk, K. Z'graggen, L. Galindo, D. Nummer, Y. Ziouta, M. Bucur, J. Weitz, V. Schirrmacher, M. W. Buchler, et al.
High Frequencies of Functional Tumor-Reactive T Cells in Bone Marrow and Blood of Pancreatic Cancer Patients
Cancer Res., November 1, 2005; 65(21): 10079 - 10087.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Beckhove, P.
Right arrow Articles by Herold-Mende, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Beckhove, P.
Right arrow Articles by Herold-Mende, C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online