Clinical Cancer Research Grants Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baldi, A.
Right arrow Articles by Paggi, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baldi, A.
Right arrow Articles by Paggi, M. G.
Clinical Cancer Research Vol. 11, 3175-3183, May 1, 2005
© 2005 American Association for Cancer Research

Human Cancer Biology

Ferritin Contributes to Melanoma Progression by Modulating Cell Growth and Sensitivity to Oxidative Stress

Alfonso Baldi1,5, Daniela Lombardi6, Patrizia Russo1, Emanuele Palescandolo1, Antonio De Luca1, Daniele Santini3, Feliciano Baldi5, Luigi Rossiello5, Maria Lucia Dell'Anna4, Arianna Mastrofrancesco4, Vittoria Maresca4, Enrica Flori4, Pier Giorgio Natali2, Mauro Picardo4 and Marco G. Paggi1

Authors' Affiliations: 1 Laboratory "C," Department for the Development of Therapeutic Programs and 2 Laboratory of Immunology, Center for Experimental Research, Regina Elena Cancer Institute; 3 Service of Oncology, Campus BioMedico University; 4 San Gallicano Dermatological Institute, Rome, Italy; 5 Deparment of Biochemistry and Biophysics "F. Cedrangolo," Section of Anatomic Pathology, Second University of Naples, Naples, Italy; and 6 Department of Experimental Medicine, University of L'Aquila, L'Aquila, Italy

Requests for reprints: Marco G. Paggi, Laboratory "C," Department for the Development of Therapeutic Programs, Regina Elena Cancer Institute, Center for Experimental Research, Via E. Chianesi 53, 00128 Rome, Italy. Phone: 39-06-5266-2550; Fax: 39-06-5266-2572; E-mail: paggi{at}ccd.inemm.cnr.it.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Purpose: Employing an in vitro model system of human melanoma progression, we previously reported ferritin light chain (L-ferritin) gene overexpression in the metastatic phenotype. Here, we attempted to characterize the role of ferritin in the biology of human melanoma and in the progression of this disease.

Experimental Design: Starting from the LM human metastatic melanoma cell line, we engineered cell clones in which L-ferritin gene expression was down-regulated by the stable expression of a specific antisense construct. These cells were then assayed for their growth capabilities, chemoinvasive properties, and sensitivity to oxidative stress. Additionally, ferritin protein content in primary and metastatic human melanomas was determined by immunohistochemistry.

Results: Artificial L-ferritin down-regulation in the LM cells strongly inhibited proliferation and chemoinvasion in vitro and cell growth in vivo. In addition, L-ferritin down-regulated cells displayed enhanced sensitivity to oxidative stress and to apoptosis. Concurrently, immunohistochemical analysis of a human melanoma tissue array revealed that ferritin expression level in metastatic lesions was significantly higher (P < 0.0001) than in primary melanomas. Furthermore, ferritin expression was constantly up-regulated in autologous lymph node melanoma metastases when compared with the respective primary tumors in a cohort of 11 patients.

Conclusions: These data suggest that high ferritin expression can enhance cell growth and improve resistance to oxidative stress in metastatic melanoma cells by interfering with their cellular antioxidant system. The potential significance of these findings deserves to be validated in a clinical setting.

Key Words: chemoinvasion • metastasis • apoptosis • lipid peroxidation

The hierarchy of the molecular events underlying human melanoma progression is still largely unknown. For this reason, more information is clearly needed regarding genetic changes triggering melanoma onset and progression (1–3). In the past years, several genes have been identified as differentially expressed during melanocytic tumor progression (4–10), and the technology of the cDNA arrays has been recently successful in pointing out genes whose expression is associated with metastatic potential in melanoma cells (11, 12). Indeed, the identification of genes that are differentially regulated when melanoma cells attain metastatic potential may lead to the characterization of patients with high risk of developing metastasis and possibly to the recognition of more specific therapeutic targets.

Recently, we took advantage of an in vitro model of melanoma progression consisting of two cell lines: LP, which is derived from a primary human melanoma, and LM, which is derived from a supraclavicular lymph node metastasis of the same patient, the latter showing enhanced cell proliferation and clonogenic capacity (13). By means of cDNA arrays, we identified several genes whose expression was modulated in our model system and, among these, the gene encoding for ferritin light chain (L-ferritin) whose expression was found up-regulated in the LM cell line (14).

Ferritins are important regulators of the intracellular iron content. Pharmacologically obtained iron depletion induces major cellular alterations, including cell cycle arrest and apoptosis (15), but at elevated tissue concentrations, iron results as a potential toxicant (16). Storage of intracellular iron in the ferritin molecules together with a down-modulation of transferrin receptor are the two key mechanisms through which the human tissues are shielded from the toxic effects of excess iron ions (17). Ferritins are made of 24 subunits assembled to form the apoferritin shell. The protein subunits are of two types, light chain and heavy chain, which share extensive homology. The heavy chain is predominant in the so-called acidic isoferritins, prevalently detectable in heart, kidney, and placenta. The light chain is usually found in the so-called basic isoferritins, detected in liver and spleen. Light and heavy chain ferritin subunits are encoded by two specific genes that are under separate transcriptional control. To date, the independent function and regulation of light and heavy chain ferritins still remains an open issue (16, 18, 19). Translation of both ferritin subunits is thought to be activated by iron through interactions with the iron regulatory element motifs present in the promoter region of the two genes and through cytoplasmic iron sensors called iron regulatory proteins (20). Tissue ferritin expression changes during development as well as in various pathologic states. In the past years, there has been considerable interest in ferritin as an oncofetal protein and as a marker associated with cellular proliferation (19). Findings regarding the relationship between ferritin and cancer seem, at least in part, conflicting, which reflects the relative paucity of experiments in this area. Nevertheless, increased ferritin concentration in tumor versus normal tissue has been reported in several malignancies, such as colon and breast cancer (21–23) and seminoma (24).

Melanoma progression is associated with aberrant redox regulation leading to a continuous oxidative stress and production of reactive oxygen species (ROS), chemical species containing one or more unpaired electrons (25).

Due to the considerable novel interest raising on the mechanisms linking iron metabolism and cancer cells (15, 26), we have sought to assess the functional significance of ferritin in the biology of human melanoma, a tumor type characterized by a peculiar iron metabolism (27, 28). By means of artificial down-regulation of L-ferritin in metastatic human melanoma cells, we investigated the possible role of ferritin in the progression of this tumor and in its peculiar response to oxidative stress. Additionally, we determined immunohistochemically ferritin expression level in primary and metastatic melanomas.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Cell lines. The in vitro model system used consisted of two cell lines derived from a primary cutaneous melanoma (Clark's level V; Breslow 12 mm; LP) or from its supraclavicular lymph node metastasis (LM). LP and LM cells were cultured in RPMI 1640 plus 10% FCS in a 5% CO2 atmosphere. LM cells have enhanced proliferation rate and clonogenic capacity (13). After ~10 in vitro passages, LP cells showed a different, more malignant, phenotype.7

To maintain cells in fatty acid precursor–supplemented culture conditions, linoleic acid was added to the medium at the final concentration of 7 x 10–5 mol/L from a stock solution in absolute ethanol. An equal volume of absolute ethanol was added to the medium of control cells. Bovine serum albumin at the final concentration of 0.02% was added as a fatty acid carrier to both control and treated cells. Cells were exposed to fatty acids precursors for 6 days before analysis.

cDNA constructs. The human L-ferritin (Genbank accession no. M11147) cDNA was cloned in sense or antisense orientation in the pcDNA3-T7-Tag vector (Invitrogen, Carlsbad, CA) between BamHI and EcoRI sites. The primers used for the L-ferritin construct were (forward) AGCGGATCCATGAGCTCCCAGATTCGTCAG and (reverse) AGCGAATTCTTAGTCGTGCTTGAGAGTGAG. The primers used for the antisense-L-ferritin (AS-L-ferritin) construct were (forward) AGCGAATTCATGAGCTCCCAGATTCGTCAG and (reverse) AGCGGATCCTTAGTCGTGCTTGAGAGTGAG.

Northern blot analysis. Northern blot analysis was done as described (14) using the human L-ferritin cDNA as a probe. A subsequent hybridization with ß-actin was used for normalization. Quantification of the bands was obtained by the ImageQuant 5.0 software (Molecular Dynamics, Sunnyvale, CA).

Western blot analysis. Western blotting on cell lysates was done as described (29) using a rabbit anti-human ferritin antibody (DAKO, Carpinteria, CA) at a working dilution of 1:500. Normalization was done using an anti-HSP70 mouse monoclonal antibody (Oncogene Science, Manhasset, NY). Quantification of the bands was obtained by the ImageQuant 5.0 software.

Transfections. LM cells (7 x 105) were transfected with 30 µg pcDNA3-T7-Tag plasmid as control, with the pcDNA3-T7-L-ferritin-Tag construct (sense), or with the pcDNA3-T7-AS-L-ferritin-Tag construct, containing the ferritin light chain cDNA sequence in antisense orientation, by electroporation as described (30). Under these conditions, 55% transfection efficiency was achieved. After growing electroporated cells in G418-containing medium (250 µg/mL) for 14 days, single clones were isolated and grown. Control clones were propagated at 60% to 70% of confluence. Because L-ferritin down-regulated LM clones underwent apoptosis when kept >3 days in culture, these cells were propagated every other day at 40% to 50% of confluence.

Proliferation assay. Cells were seeded in a 96-well plate (5 x 103 per well) 12 hours before the experiment. Cell growth was evaluated using the Cell Proliferation Kit II (Roche Molecular Biochemicals, Indianapolis, IN) following manufacturer's instructions. This method employs a colorimetric procedure based on the tetrazolium salt sodium, 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide inner salt, which is transformed in a formazan dye only in metabolically active cells. The formazan dye was measured after 4 hours at a 492 nm wavelength. Values ± SD are the average of three experiments done in decuplicate.

In vitro invasion assay. The chemoinvasion assay was done as described (31) with some minor modifications. Briefly, cell culture inserts incorporating 6.4 mm diameter membranes (8 µm pore size, Becton Dickinson, Franklin Lakes, NJ) were used. Membranes were coated with 10 µg each of Matrigel basement membrane matrix (Becton Dickinson). Results were expressed as the number of invaded cells on the lower surface of the membrane. Ten microscope fields per each membrane were counted. Each experiment was done at least five times.

Terminal deoxynucleotidyl transferase–mediated dUTP nick end labeling assay. Cells were fixed in paraformaldehyde, washed in distilled water, and exposed briefly to 3% H2O2 to inactivate endogenous peroxidase. The terminal deoxynucleotidyl transferase–mediated dUTP nick end labeling (TUNEL) reaction was done using the peroxidase-based Apoptag kit (Intergene, Purchase, NY). The TUNEL-positive cells were revealed by diaminobenzidine and H2O2 according to the manufacturer's instructions. Finally, stained cells were slightly counterstained with hematoxylin. TUNEL-positive cells were considered as apoptotic.

Induction and evaluation of apoptosis. Cells were grown up to 70% confluence; then, apoptosis was induced by the addition of H2O2 (at the final concentrations of 25, 50, 100, and 200 µmol/L) or the anti-Fas antibody CH11 (Upstate Biotechnology, Lake Placid, NY; at the final concentrations of 15, 30, 60, and 120 ng/mL). Cells were assayed after 60 minutes. Cell cycle analysis was done by flow cytometry using the CycleTest Plus DNA Reagent kit (Becton Dickinson) following manufacturer's instructions. Cells were analyzed by a FACSCalibur flow cytometer (Becton Dickinson; 1 x 104 events per sample). To estimate apoptosis, the acquired data were elaborated with the CellQuest version 3.3 software and analyzed with the ModFit LT version 3.0 software.

In vivo analysis of tumor growth inhibition. LM cells (1 x 106) stably transfected with pcDNA3-T7-Tag plasmid or with the pcDNA3-T7-AS-L-ferritin-Tag construct were injected s.c. into the flanks of male CD1 nu/nu mice (Charles River, Calco, Italy) in a final volume of 350 µL. Eight mice for each experimental point were employed. Tumor volume was monitored by standard procedures. After 39 days, animals were sacrificed and tumors were removed and processed for RNA extraction and for histology.

Descriptive statistical analysis was used to monitor tumor volume modifications (expressed as median value and 95% confidential interval of tumor volumes). Sheffe test and two-way ANOVA analysis were used to compare tumor growth (tumor volume) of different cancer clones (multiple comparisons). Ps ≤ 0.05 were regarded as statistically significant in two-tailed tests. SPSS software version 10.00 (SPSS, Chicago, IL) was used for statistical analysis.

All procedures involving animals and their care were conducted in conformity with the institutional guidelines in compliance with national (D.L. No. 116, G.U., Suppl. 40, Feb. 18, 1992; Circolare No. 8, G.U., July 1994) and international laws (EEC Council Directive 86/609, OJ L 358. 1, Dec 12, 1987; Guide for the Care and Use of Laboratory Animals, U.S. National Research Council, 1996).

Antioxidant enzymatic activities assay. Superoxide dismutase (SOD) activity was evaluated as described (32). The results were reported as units/mg of protein.

Catalase activity was determined by the disappearance of H2O2 (10 mmol/L) measured at 240 nm in PBS (pH 7.4; ref. 33). The results were reported as units/mg of protein.

Reactive oxygen species detection. ROS production was detected by 2',7'-dichlorofluorescein diacetate (Fluka AG, Buchs, Switzerland), a substance oxidizable to fluorescent dichlorofluorescein by several different ROS and peroxides. Cells were gently detached, washed, and incubated (30 minutes at 37°C, 5% CO2) in the presence of 2.5 µmol/L 2',7'-dichlorofluorescein diacetate in PBS plus 5 mmol/L glucose. Flow cytometric analysis was immediately done by a Cytoron Absolute (Ortho Diagnostic System, Raritan, NJ) with excitation and emission setting at 488 and 530 nm, respectively. The intracellular ROS were quantified using the median of FL1 channel of fluorescence, which matches with the maximal number of cells with the highest fluorescence.

Vitamin E analysis. Vitamin E was extracted (34) and measured (35) as described. Results are reported as the mean of two determinations from two different experiments and expressed as ng/mg protein.

Thiobarbituric acid–reactive substances analysis. The evaluation of thiobarbituric acid–reactive substances (TBARS) was done as described (36). The assay reveals mainly malondialdehyde, which forms a spectrophotometrically detectable adduct with thiobarbituric acid. For TBARS quantitative determination, malondialdehyde standard solutions of known concentration were used instead of the cell lysate. We did three different determinations in duplicate. TBARS, detected as pmol/mg of protein, were expressed as percentage variations due to intrinsic variability of the detection system itself.

Polyunsaturated fatty acid analysis. Lysed cells were extracted twice in chloroform/methanol (2:1) in the presence of butylated hydroxytoluene (100 µg) as antioxidant. Phospholipid fraction was purified by TLC, and tricosanoic acid ethyl ester (100 µg) was added as internal standard. The fatty acids of phospholipid fraction were transmethylated with sodium methoxide in methanol and analyzed by a combined gas chromatography-mass spectrometry system (Hewlett-Packard, Palo Alto, CA, 5890 II gas chromatography combined with 5989 mass spectrometry) on capillary column (FFA-P, 60 m x 0.32 µm x 0.25 mm, Hewlett-Packard). Helium was used as carrier gas. Oven temperature gradient from 80°C to 220°C at 10°C/min was used (37). The results were obtained after time integration of the chromatogram and final processing of the peak areas and reported as polyunsaturated fatty acid (PUFA) µg/mg of protein.

Protein determination. Protein determination was done according to Bradford (38).

Immunohistochemistry. Immunohistochemistry on the human malignant melanoma tissue array CK1 slide (SuperBioChips Laboratory, Seoul, South Korea) as well as on 11 primary melanomas and matched lymph node metastases was done as described previously (14) using the rabbit anti-human ferritin antibody (A0133) at 1:250 dilution or the monoclonal mouse antibody to human melanoma (clone HMB45, DBS, Pleasanton, CA) at 1:50 dilution after a 10-minute Pronase treatment (DAKO). 3-Amino-9-ethylcarbazide was the final chromogen and hematoxylin is the nuclear counterstain. The percentage of ferritin-stained cells per field (x250) at light microscopy was calculated and compared in different specimens by three separate observers (A.B., L.R., and F.B.) in a double-blind fashion, choosing areas almost completely composed by HMB45-positive cells. The score was as follows: +, up to 5% positive cells per field; ++, 6% to 15% positive cells per field; +++, 16% to 25% positive cells per field; and ++++, >25% positive cells per field. The level of concordance, expressed as the percentage of agreement between the observers, was 92%. In the remaining specimens, the score was obtained after collegial revision and agreement. Spearman's rank correlation or Fisher's exact test was used to assess relationship between ordinal data. Ferritin values in the different subset of tumor (primary tumors, metastases) and in different pathologic stages of disease (tumor-node-metastasis) were compared according to Mann-Whitney U test for nonparametric independent variables. Ps ≤ 0.05 were regarded as statistically significant in two-tailed tests. SPSS software was used for statistical analysis.

The LF03 anti-human ferritin light chain monoclonal antibody was elicited by human liver ferritin and selected for its specificity to ferritin light chain (39). The suitability of this antibody for immunohistochemical analysis has been described elsewhere (40). The antibody was used at a 1:500 dilution and incubated for 1 hour at room temperature.

The immunohistochemical results obtained with the polyclonal rabbit anti-human ferritin antibody raised against liver ferritin (prevalently L-ferritin) were confirmed in a selected number of specimens using the LF03 monoclonal antibody.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
Ferritin light chain gene expression in LP and LM cells. Northern and Western blot analyses (Fig. 1A and B, respectively) revealed higher L-ferritin gene and ferritin protein expression in the metastatic LM cells when compared with the LP cells, the ones derived from the primary tumor. Quantitative results are reported in the legend of Fig. 1. This result confirmed our previous findings in which, by cDNA arrays, we identified the L-ferritin gene as up-regulated in the LM cell line (14). In addition, immunohistochemical ferritin expression was found from very low to undetectable in 10 benign nevi. Figure 1C shows a representative staining.



View larger version (70K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Up-regulation of L-ferritin mRNA in the LM cell line. A, Northern blot analysis revealed L-ferritin up-regulation in the highly metastatic LM cell line. Total RNA (10 µg) from LP and LM cell lines was probed with 32P-labeled full-length L-ferritin cDNA. After normalization by ß-actin detection, L-ferritin mRNA content resulted 2.5-fold higher in LM cells. B, Western blot analysis after a 10% SDS-PAGE showed ferritin protein amounts in LP and LM cells. After normalization by HSP70 detection, ferritin protein content resulted 3.3-fold higher in LM cells. C, immunohistochemical detection in a nevus showed a barely detectable amount of ferritin.

 
Effect of L-ferritin down-regulation on proliferative and chemoinvasive properties of LM cells in vitro. These findings prompted us to investigate the possible role of L-ferritin down-modulation in the phenotypic differences observed between LP and LM melanoma cell lines. To this end, we subcloned the L-ferritin cDNA in antisense orientation (AS-L-ferritin) into a constitutive expression vector and transfected it into the LM cell line. Isolated individual clones of stable transfectants were grown up to 40% to 50% confluence for 48 hours. Cell lysates were analyzed for ferritin protein expression by Western blot using a commercial polyclonal rabbit antibody raised against ferritin isolated from human liver, a tissue in which the light chain of ferritin is prevalent over the heavy chain molecule (19). Six of nine selected transfectant clones displayed lower levels of ferritin when compared with the LM cells transfected with the control vector (Fig. 2A). All these clones actually displayed a ferritin amount lower than the amount detectable in the LP cell line itself. Ferritin, when in lower amount, was detected as a doublet in 12% acrylamide gels possibly due to a partial cross-reaction with H-ferritin. Quantitative results are reported in the legend of Fig. 2. Among the selected clones, we chose those with the lowest ferritin protein expression (i.e., clones 2, 4, and 6). These clones were tested for their proliferative and chemoinvasive properties. L-ferritin down-regulation resulted in a major decrease in the proliferative activity of the LM cells (Fig. 2B). Sense L-ferritin-transfected LM cells did not display significant changes neither in ferritin amount expression by Western blot nor in proliferation rate (data not shown). Furthermore, L-ferritin down-regulation strongly inhibited the ability of LM cells to invade an in vitro–constituted extracellular matrix (Fig. 2C).



View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. L-ferritin down-regulated LM clones and their in vitro growth and invasive properties. A, Western blot analysis after a 12% SDS-PAGE. LM cells transfected with the empty vector (control) or with the AS-L-ferritin cDNA (clones 1-6) were assayed for ferritin expression. HSP70 detection was used for normalization. Each lane was loaded with 30 µg protein. After normalization by HSP70 detection, ferritin protein content in control LM cells resulted 10.1-, 13.8-, 4.8-, 10.1-, 3.7-, and 8.8-fold higher than in AS-L-ferritin LM clones 1, 2, 3, 4, 5, and 6, respectively. B, proliferation assay: in vitro effects of L-ferritin down-modulation in LM cells (control, clones 2, 4, and 6). Proliferation rate was expressed as the amount of formazan detected spectrophotometrically after 4 hours. C, chemoinvasion assay: in vitro effects of L-ferritin down-modulation in LM cells (control, clones 2, 4, and 6). Invasiveness was expressed as the number of invaded cells on the lower surface of the coated membrane.

 
Effect of L-ferritin down-regulation on apoptosis of LM cells in vitro. TUNEL analysis, done on cells cultured for >48 hours, provided the first indication that apoptosis was more evident in L-ferritin down-regulated LM cells stably expressing AS-L-ferritin rather than in LM control transfectants (56.0 ± 13% versus 11.9 ± 4%; Fig. 3A). With the aim of further investigating the higher apoptotic rate of L-ferritin down-regulated cells, we did cell cycle analysis by flow cytometry of either control or AS-L-ferritin stable LM transfectants after incubation in the presence of either H2O2 (25) or the anti-Fas monoclonal antibody CH11 (41–44). Both these stimuli produced a remarkable increase in apoptotic events in AS-L-ferritin stable LM transfectants rather than in control LM cells (Fig. 3B and C), demonstrating that ferritin down-regulation significantly lowered the threshold of apoptosis in LM human melanoma cells.



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. Susceptibility to apoptosis of L-ferritin down-regulated LM cells. A, TUNEL analysis in control and in L-ferritin down-regulated LM cells; cells with dark nuclei were considered as apoptotic. B, induction of apoptosis in control and in L-ferritin down-regulated LM cells (AS-L-ferr.) by H2O2 at the concentrations indicated. C, induction of apoptosis in control and in L-ferritin down-regulated LM cells by addition of the CH11 anti-Fas monoclonal antibody at the concentrations indicated. Columns, mean from four to six independent assays; bars, SD. *, P < 0.05, significant; **, P < 0.001, highly significant, calculated by the Student's t test. These results apply to the AS-L-ferritin stable transfectant LM clone 2; the behavior of clones 4 and 6 was essentially overlapping.

 
Effect of L-ferritin down-regulation on tumorigenicity of LM cells in vivo. L-ferritin down-regulated LM clones as well as control cells were injected into the flanks of nude mice, and tumor volumes were measured thrice weekly. Tumors originated from the L-ferritin down-regulated LM clones grew significantly slower than controls, with clones 2 and 4 showing the strongest growth inhibition (Fig. 4A). Both Northern blot and immunohistochemistry confirmed the decrease in L-ferritin gene and protein expression in the xenograft explants derived by L-ferritin down-regulated LM cells (Fig. 4B and C, respectively). The extent of tumor growth inhibition reached statistical significance at different times [i.e., control cells versus L-ferritin down-regulated LM clones 2 and 4 at day 22 (P = 0.039 and 0.045, respectively)], whereas control cells versus AS-L-ferritin LM clone 6 reached a borderline statistical significance at day 34 (P = 0.08).



View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. LM clones stably expressing AS-L-ferritin and their in vivo growth properties. A, in vivo growth rates of the control and L-ferritin down-regulated LM cells (clones 2, 4, and 6). Bars, 95% confidential interval. Tumor volumes (median values) were expressed in mm3. B, Northern blot analysis for L-ferritin in xenografts derived from control or L-ferritin down-regulated LM cells (clone 2). After normalization by ß-actin detection, L-ferritin mRNA content resulted 1.5-fold lower in L-ferritin down-regulated LM cells. C, immunohistochemical determination of ferritin in xenografts derived from control or L-ferritin down-regulated LM cells (clone 2, top and bottom, respectively).

 
L-ferritin down-modulation is associated with the development of an oxidative stress. To investigate whether L-ferritin down-regulation could impair the antioxidant defense system, thus causing lipoperoxidative effects and cell damage, we evaluated lipophilic and enzymatic antioxidants PUFA and TBARS content in AS-L-ferritin-transfected and control-transfected LM cells.

In L-ferritin down-regulated LM cells, SOD activity was significantly higher (12.71 ± 2.46 versus 4.54 ± 1.21 units/mg protein), whereas catalase activity resulted significantly lower (6.61 ± 1.52 versus 16.21 ± 3.09 units/mg protein) when compared with control LM cells (P < 0.005). Consequently, the SOD/catalase ratio was higher in L-ferritin down-regulated LM cells (1.92) with respect to control cells (0.28), thus facilitating H2O2 accumulation in the former.

The amounts of total PUFAs were 0.11 ± 0.032 and 0.39 ± 0.066 µg/mg of protein in L-ferritin down-regulated LM cells and control cells, respectively (P < 0.005). TBARS, expressed as percentage variations, were significantly higher (41 ± 18%) in L-ferritin down-regulated LM cells than in control cells (P < 0.001). Moreover, vitamin E levels were found higher in L-ferritin down-regulated LM cells than in control cells (7.64 ± 1.22 and 5.84 ± 0.86 ng/mg of protein, respectively; P < 0.01) as a possible compensatory mechanism to counteract oxidative stress (35, 45). All these data are summarized in Table 1.


View this table:
[in this window]
[in a new window]

  		Table 1. Pattern of the antioxidants and oxidative stress variables in control LM cells and L-ferritin down-regulated LM cells

 
The intracellular ROS level, however, as evaluated by the 2',7'-dichlorofluorescein diacetate fluorescence, was not significantly increased in L-ferritin down-regulated LM cells with respect to controls (2',7'-dichlorofluorescein diacetate fluorescence median of 134 and 130, respectively).

To counteract the effects of fatty acid precursor depletion, a phenomenon generally occurring in cultured cells (46), in a separated set of experiments, we supplemented the culture medium of both control LM and L-ferritin down-regulated LM cells with the fatty acid precursor linoleic acid (added as specified in Materials and Methods). Cells were then assayed for TBARS and PUFA content and for proliferative capabilities. The data obtained from two different determinations, each done in triplicate, indicated that linoleic acid–supplemented cells showed increased TBARS content, which was more pronounced in L-ferritin down-regulated LM than in control LM cells (20.4% and 50.5%, respectively). As far as PUFAs are concerned, we evaluated linoleic (C18:2{Delta}9,12) and arachidonic acid (C20:4{Delta}5,8,11,14), which are the most relevant cell membrane unsaturated components. In cells supplemented with linoleic acid, we found a more pronounced increase in control LM cells than in L-ferritin down-regulated LM cells (8.27- and 4.92-fold, respectively). In turn, arachidonic acid, a key target of lipoperoxidative damage, was found considerably more reduced in L-ferritin down-regulated LM than in control LM cells (8.83- and 3.55-fold reduction, respectively).

Furthermore, linoleic acid supplementation produced a 48.26% decrease in control LM cells and a 38.17% decrease in L-ferritin down-regulated LM cells, which were already growth inhibited by the expression of the AS-L-ferritin construct (Fig. 5).



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. In vitro growth properties of LM cells after supplementation of the culture medium with linoleic acid. Control and L-ferritin down-regulated LM cells (clone 2) were assayed in standard growth conditions or after supplementation of the culture medium with linoleic acid as specified in Materials and Methods. Proliferation rate was expressed as the amount of formazan detected spectrophotometrically after 4 hours.

 
Immunohistochemical analysis of ferritin expression in human melanomas. The expression patterns of ferritin were assessed by immunohistochemistry done on a tissue array consisting of 50 samples of human melanomas ranging from in situ to metastatic. Ferritin was found always expressed in the cytoplasm. Of interest, strong ferritin staining was also detected in spindle-shaped cells or histiocytes of the stroma surrounding the neoplastic tissue. A broad range of ferritin expression ranging from no staining to a high number of positive cells per field (>25%) was observed. Interestingly, we found higher ferritin expression level in metastatic lesions, which resulted statistically significant when compared with primary melanomas (P < 0.0001). Moreover, a significant direct correlation was also found between ferritin expression and T or M status of the primary melanomas (P < 0.0001 and P = 0.003, respectively). These data are summarized in Table 2. In addition, ferritin expression in 11 human primary melanomas and in the respective autologous lymph node metastases showed, in all these cases, a more abundant ferritin expression in the metastatic lesions (Fig. 6; Table 3). Interestingly, ferritin expression was dramatically up-regulated also in two cases of metastatic lesion to the skin when compared with the respective primary melanoma, as shown in Fig. 5, where the insets (top right) show immunostaining for HMB45 expression in the consecutive tissue section.


View this table:
[in this window]
[in a new window]

  		Table 2. Immunohistochemical detection of ferritin in heterologous primary and metastatic melanomas

 


View larger version (77K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 6. Expression pattern of ferritin in human melanomas and autologous lymph node and cutaneous metastases. Low ferritin expression in a primary human melanoma (A) and high ferritin expression in the autologous lymph node metastasis (A1) and autologous cutaneous metastasis (A2). Very low ferritin expression in a primary human melanoma (B) and high ferritin expression in the autologous lymph node metastasis (B1) and autologous cutaneous metastasis (B2). Original magnification for all the panels, x250. Insets, immunostaining for HMB45 antigen in the respective consecutive tissue section. The melanomas represented as "A" and "B" correspond to cases 1 and 7, respectively, reported in Table 3.

 

View this table:
[in this window]
[in a new window]

  		Table 3. Immunohistochemical detection of ferritin in autologous primary and metastatic melanomas

 

   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
In this study, we show that high levels of L-ferritin are correlated with the metastatic phenotype in an in vitro model of melanoma progression. Artificial down-regulation of L-ferritin in LM metastatic melanoma cells is capable in fact of reducing their proliferation rate in vitro and in vivo as well as their invasive potential. Furthermore, in these cells, biochemical changes due to an oxidative stress and increased apoptotic rate were observed. Finally, in vivo analysis of human melanomas showed that ferritin expression in primary tumors was significantly correlated with T and M status, being also significantly higher in metastatic versus primary melanomas.

Although the biological role of ferritin in tumor cells is still not completely understood, various studies suggest that intracellular ferritin level is a reliable marker of cell proliferation (19). Iron deprivation has been shown to significantly inhibit cell cycle and proliferation in cancer cells (15). In fact, in iron-deprived human breast cancer cells, down-regulation of cyclin-dependent kinase activities, and decrease in cyclin D/cyclin-dependent kinase 4 protein levels is found, thus reducing their proliferative potential (47). In addition, it has been reported that iron chelators induce apoptosis in tumor cells, indicating a potential role of intracellular iron in the regulation of programmed cell death (15, 48–51). Several studies have confirmed the expression of ferritin in tumor cells, where high concentrations often correlate with higher degrees of cell proliferation (16, 21–24, 52–56). It is well known that cancer patients often exhibit an elevated level of serum ferritin usually correlated with a poor prognosis (16, 19, 57). This is also true in the case of human melanoma, where increased serum ferritin concentrations are associated with progressive metastatic disease (58). In addition, ferritin is produced and secreted as a cell growth factor by several cancer cells in vitro (59) and is considered responsible for some of the melanoma-induced immunosuppressive effects (60).

Melanoma cells often display an increased state of chronic oxidative stress when compared with melanocytes (35, 61). High levels of H2O2 stimulate the activity of several transcriptional factors, including nuclear factor-{kappa}B (25, 62), known to enhance survival pathways by inducing gene expression for different growth factors; therefore, melanoma cells, with endogenous high ferritin levels, can be endowed with higher survival and biological aggressiveness (62). Recently, ferritin heavy chain (H-ferritin) has been shown to play a key role in regulating apoptosis during inflammation. In fact, H-ferritin, induced by nuclear factor-{kappa}B, is required to prevent sustained c-Jun NH2-terminal kinase cascade activation, thus inhibiting ROS-mediated tumor necrosis factor-{alpha}-induction and the consequent apoptosis. In essence, H-ferritin-driven inhibition of c-Jun NH2-terminal kinase signaling depends on suppressing ROS accumulation and is achieved through its ability to sequester iron ions (63).

In our experimental model, LM metastatic cells clearly seem to depend on their high intracellular ferritin content as indicated by the reduction of their proliferative and invasive potential when L-ferritin was experimentally down-regulated. Thus, we can hypothesize that enhanced proliferation of cancer cells is supported by high ferritin level with resulting decrease of the overall oxidative stress and the associated apoptosis.

L-ferritin down-modulation in LM cells was also associated with increased SOD and decreased catalase activities. Chronic pro-oxidant stimuli can induce SOD activity both in vitro and in vivo (64–66), whereas catalase, a heme-containing enzyme, is more susceptible to inactivation by exposure to high doses of peroxidizing substances, including its own substrate (H2O2; ref. 67). The unbalance between SOD and catalase activities predisposes to intracellular H2O2 production because catalase, in association with glutathione peroxidase, is devoted to remove H2O2 (68). When the production of H2O2 overwhelms catalase activity, in the presence of free transitional metals, such as iron, Fenton reaction is promoted, generating extremely reactive hydroxyl radical (69, 70). In fact, alteration of SOD and catalase activities in LM ferritin down-modulated cells was associated with peroxidation of the cell membrane unsaturated lipid and apoptosis. In addition, after linoleic acid supplementation, the increase of linoleic acid content in the cell membrane was more evident in control than in L-ferritin down-regulated transfected cells, suggesting that, in the latter, linoleate could be quickly consumed by the lipoperoxidative damage. The pronounced decrease in arachidonic acid level and TBARS accumulation strongly suggest a higher susceptibility to lipid peroxidation as well.

The attempt we made to up-regulate L-ferritin expression in LM cells via transfection of the L-ferritin cDNA in "sense" orientation resulted in the generation of clones unable to express any detectable increase in ferritin content; moreover, these cells did not show any significantly altered proliferative activity. This can be possibly ascribed to threshold or saturation effects.

In association with the lipid peroxidation process, we observed an increase in vitamin E concentration as an effort to counteract cell membrane alterations. Comparable alterations have been described in cultured melanocytes from pheomelanic patients, which are more susceptible to proapoptotic stimuli (71). Similar events can possibly occur in L-ferritin down-regulated LM cells as well, thus increasing their sensitivity to the cytotoxic effect of proapoptotic chemotherapeutic drugs. In fact, we observed a significantly higher rate of spontaneous or induced apoptosis in L-ferritin down-regulated LM cells than in control. All these events are essentially in agreement with the increased production of Fenton-generated hydroxyl radicals. As an alternative explanation, ROS-induced genomic damage could favor the selection of a phenotype particularly resistant to apoptosis. These hypotheses are not mutually exclusive.

A synergistic effect between ferritin down-modulation and the effect of chemotherapeutic anticancer agents able to raise the intracellular iron content (72) could be envisaged as candidates for clinical testing.

To the best of our knowledge, this is the first study showing that ferritin may be a growth regulatory element of the molecular pathway controlling proliferation and invasiveness of melanoma cells. Furthermore, we show that metastatic melanomas express higher ferritin levels, which may account for the elevated serum levels of ferritin in melanoma patients with progressive metastatic disease. Recently, comparative analysis of human Serial Analysis of Gene Expression libraries from primary and metastatic melanomas and other malignances has identified L-ferritin as one of the genes whose expression best distinguishes the melanoma libraries from the other ones (73).

It has been proposed that during melanomagenesis the intrinsic antioxidant control of melanocytes is lost, and inappropriate redox-sensitive transcription factors activation occurs, contributing to the establishment of an antiapoptotic phenotype and possibly concurring in determining the resistance of melanoma cells to chemotherapeutic agents (50). As the transformed melanocyte population expands, restrictions due to the high redox cycling can generate a selective growth advantage for tumor cells expressing high levels of ferritin, which contributes to lower the toxic effects of excess intracellular iron ions. In conclusion, this generates a phenotype more resistant to apoptosis.

In view that the in vivo analysis has shown a significant increase of ferritin amount in melanoma metastases, further studies are required to determine whether ferritin up-regulation is a common and biologically critical event during melanoma progression. The present findings may be relevant in generating therapeutic protocols that include modulation of intracellular iron content in cancer cells.


   Acknowledgments
 
We thank Dr. C. Leonetti for providing the LP and LM cell lines, Prof. P. Arosio for the LF03 anti-human ferritin light chain monoclonal antibody, and Drs. B. Vincenzi and A. Abbate for the statistical analysis. This work is dedicated to the memory of Tullio Battista who gave his invaluable contribution during the early phases of this project.


   Footnotes
 
Grant support: Associazione Italiana per la Ricerca sul Cancro grant (M.G. Paggi), Ministero della Salute grants (M.G. Paggi and M. Picardo), General Broker Service, International Society for the Study of Comparative Oncology, and Istituto per l'Ambiente e l'Educazione Scholé Futuro grants (ISSCO and Futura-ONLUS) (A. Baldi, F. Baldi, and D. Santini), and Ateneo ex 60% grant (D. Lombardi).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

7 C. Leonetti, personal communication. Back

Received 4/ 1/04; revised 1/11/05; accepted 2/ 3/05.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Newton Bishop JA. Molecular pathology of melanoma. Cancer Metastasis Rev 1997;16:141–54.[CrossRef][Medline]
  2. Welch DR, Goldberg SF. Molecular mechanisms controlling human melanoma progression and metastasis. Pathobiology 1997;65:311–30.[CrossRef][Medline]
  3. Nyormoi O, Bar-Eli M. Transcriptional regulation of metastasis-related genes in human melanoma. Clin Exp Metastasis 2003;20:251–63.[CrossRef][Medline]
  4. van Groningen JJ, Bloemers HP, Swart GW. Identification of melanoma inhibitory activity and other differentially expressed messenger RNAs in human melanoma cell lines with different metastatic capacity by messenger RNA differential display. Cancer Res 1995;55:6237–43.[Abstract/Free Full Text]
  5. Hashimoto Y, Shindo-Okada N, Tani M, Takeuchi K, Toma H, Yokota J. Identification of genes differentially expressed in association with metastatic potential of K-1735 murine melanoma by messenger RNA differential display. Cancer Res 1996;56:5266–71.[Abstract/Free Full Text]
  6. Simon HG, Risse B, Jost M, Oppenheimer S, Kari C, Rodeck U. Identification of differentially expressed messenger RNAs in human melanocytes and melanoma cells. Cancer Res 1996;56:3112–7.[Abstract/Free Full Text]
  7. Ishiguro T, Nakajima M, Naito M, Muto T, Tsuruo T. Identification of genes differentially expressed in B16 murine melanoma sublines with different metastatic potentials. Cancer Res 1996;56:875–9.[Abstract/Free Full Text]
  8. Duncan LM, Deeds J, Hunter J, et al. Down-regulation of the novel gene melastatin correlates with potential for melanoma metastasis. Cancer Res 1998;58:1515–20.[Abstract/Free Full Text]
  9. Zendman AJ, Cornelissen IM, Weidle UH, Ruiter DJ, van Muijen GN. TM7XN1, a novel human EGF-TM7-like cDNA, detected with mRNA differential display using human melanoma cell lines with different metastatic potential. FEBS Lett 1999;446:292–8.[CrossRef][Medline]
  10. Huang F, Adelman J, Jiang HP, Goldstein NI, Fisher PB. Identification and temporal expression pattern of genes modulated during irreversible growth arrest and terminal differentiation in human melanoma cells. Oncogene 1999;18:3546–52.[CrossRef][Medline]
  11. Clark EA, Golub TR, Lander ES, Hynes RO. Genomic analysis of metastasis reveals an essential role for RhoC. Nature 2000;406:532–5.[CrossRef][Medline]
  12. Bittner M, Meltzer P, Chen Y, et al. Molecular classification of cutaneous malignant melanoma by gene expression profiling. Nature 2000;406:536–40.[CrossRef][Medline]
  13. Leonetti C, Biroccio A, Candiloro A, et al. Increase of cisplatin sensitivity by c-myc antisense oligodeoxynucleotides in a human metastatic melanoma inherently resistant to cisplatin. Clin Cancer Res 1999;5:2588–95.[Abstract/Free Full Text]
  14. Baldi A, Battista T, De Luca A, et al. Identification of genes down-regulated during melanoma progression: a cDNA array study. Exp Dermatol 2003;12:213–8.[CrossRef][Medline]
  15. Le NT, Richardson DR. The role of iron in cell cycle progression and the proliferation of neoplastic cells. Biochim Biophys Acta 2002;1603:31–46.[Medline]
  16. Torti FM, Torti SV. Regulation of ferritin genes and protein. Blood 2002;99:3505–16.[Free Full Text]
  17. Harrison PM, Arosio P. The ferritins: molecular properties, iron storage function and cellular regulation. Biochim Biophys Acta 1996;1275:161–203.[Medline]
  18. Boyd D, Vecoli C, Belcher DM, Jain SK, Drysdale JW. Structural and functional relationships of human ferritin H and L chains deduced from cDNA clones. J Biol Chem 1985;260:11755–61.[Abstract/Free Full Text]
  19. Bomford AB, Munro HN. Ferritin gene expression in health and malignancy. Pathobiology 1992;60:10–8.[Medline]
  20. Hentze MW, Kuhn LC. Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress. Proc Natl Acad Sci U S A 1996;93:8175–82.[Abstract/Free Full Text]
  21. Vaughn CB, Weinstein R, Bond B, et al. Ferritin content in human cancerous and noncancerous colonic tissue. Cancer Invest 1987;5:7–10.[Medline]
  22. Guner G, Kirkali G, Yenisey C, Tore IR. Cytosol and serum ferritin in breast carcinoma. Cancer Lett 1992;67:103–12.[CrossRef][Medline]
  23. Weinstein RE, Bond BH, Silberberg BK. Tissue ferritin concentration in carcinoma of the breast. Cancer 1982;50:2406–9.[CrossRef][Medline]
  24. Cohen C, Shulman G, Budgeon LR. Immunohistochemical ferritin in testicular seminoma. Cancer 1984;54:2190–4.[CrossRef][Medline]
  25. Meyskens FL Jr, McNulty SE, Buckmeier JA, et al. Aberrant redox regulation in human metastatic melanoma cells compared to normal melanocytes. Free Radic Biol Med 2001;31:799–808.[CrossRef][Medline]
  26. Kwok JC, Richardson DR. The iron metabolism of neoplastic cells: alterations that facilitate proliferation? Crit Rev Oncol Hematol 2002;42:65–78.[Medline]
  27. Richardson DR. The role of the membrane-bound tumour antigen, melanotransferrin (p97), in iron uptake by the human malignant melanoma cell. Eur J Biochem 2000;267:1290–8.[Medline]
  28. Food MR, Des RR. Iron uptake by melanoma cells from the soluble form of the transferrin homologue, melanotransferrin. Redox Rep 2002;7:279–82.[CrossRef][Medline]
  29. Baldi A, De Luca A, Claudio PP, et al. The Rb2/p130 gene product is a nuclear protein whose phosphorylation is cell cycle regulated. J Cell Biochem 1995;59:402–8.[CrossRef][Medline]
  30. Lombardi D, Palescandolo E, Giordano A, Paggi MG. Interplay between the antimetastatic nm23 and the retinoblastoma-related Rb2/p130 genes in promoting neuronal differentiation of PC12 cells. Cell Death Differ 2001;8:470–6.[CrossRef][Medline]
  31. Albini A, Iwamoto Y, Kleinman HK, et al. A rapid in vitro assay for quantitating the invasive potential of tumor cells. Cancer Res 1987;47:3239–45.[Abstract/Free Full Text]
  32. Spitz DR, Oberley LW. An assay for superoxide dismutase activity in mammalian tissue homogenates. Anal Biochem 1989;179:8–18.[CrossRef][Medline]
  33. Clairborne A. Catalase activity. In: Greenwald RA, editor. Handbook of methods for oxygen radical research. Boca Raton (FL): CRC; 1985. p. 283–4.
  34. Burton GW, Webb A, Ingold KU. A mild, rapid, and efficient method of lipid extraction for use in determining vitamin E/lipid ratios. Lipids 1985;20:29–39.[Medline]
  35. Picardo M, Grammatico P, Roccella F, et al. Imbalance in the antioxidant pool in melanoma cells and normal melanocytes from patients with melanoma. J Invest Dermatol 1996;107:322–6.[CrossRef][Medline]
  36. Jentzsch AM, Bachmann H, Furst P, Biesalski HK. Improved analysis of malondialdehyde in human body fluids. Free Radic Biol Med 1996;20:251–6.[CrossRef][Medline]
  37. Passi S, Morrone A, De Luca C, Picardo M, Ippolito F. Blood levels of vitamin E, polyunsaturated fatty acids of phospholipids, lipoperoxides and glutathione peroxidase in patients affected with seborrheic dermatitis. J Dermatol Sci 1991;2:171–8.[CrossRef][Medline]
  38. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248–54.[CrossRef][Medline]
  39. Luzzago A, Arosio P, Iacobello C, et al. Immunochemical characterization of human liver and heart ferritins with monoclonal antibodies. Biochim Biophys Acta 1986;872:61–71.[CrossRef][Medline]
  40. Francanzani AL, Fargion S, Romano R, et al. Immunohistochemical evidence for a lack of ferritin in duodenal absorptive epithelial cells in idiopathic hemochromatosis. Gastroenterology 1989;96:1071–8.[Medline]
  41. Garrone P, Neidhardt EM, Garcia E, Galibert L, van Kooten C, Banchereau J. Fas ligation induces apoptosis of CD40-activated human B lymphocytes. J Exp Med 1995;182:1265–73.[Abstract/Free Full Text]
  42. Nagata S, Golstein P. The Fas death factor. Science 1995;267:1449–56.[Abstract/Free Full Text]
  43. Fulda S, Sieverts H, Friesen C, Herr I, Debatin KM. The CD95 (APO-1/Fas) system mediates drug-induced apoptosis in neuroblastoma cells. Cancer Res 1997;57:3823–9.[Abstract/Free Full Text]
  44. Ariza ME, Broome-Powell M, Lahti JM, Kidd VJ, Nelson MA. Fas-induced apoptosis in human malignant melanoma cell lines is associated with the activation of the p34(cdc2)-related PITSLRE protein kinases. J Biol Chem 1999;274:28505–13.[Abstract/Free Full Text]
  45. Chow CK. Vitamin E and oxidative stress. Free Radic Biol Med 1991;11:215–32.[CrossRef][Medline]
  46. Sheridan AM, Fitzpatrick S, Wang C, Wheeler DC, Lieberthal W. Lipid peroxidation contributes to hydrogen peroxide induced cytotoxicity in renal epithelial cells. Kidney Int 1996;49:88–93.[Medline]
  47. Kulp KS, Green SL, Vulliet PR. Iron deprivation inhibits cyclin-dependent kinase activity and decreases cyclin D/CDK4 protein levels in asynchronous MDA-MB-453 human breast cancer cells. Exp Cell Res 1996;229:60–8.[CrossRef][Medline]
  48. Hileti D, Panayiotidis P, Hoffbrand AV. Iron chelators induce apoptosis in proliferating cells. Br J Haematol 1995;89:181–7.[Medline]
  49. Leardi A, Caraglia M, Selleri C, et al. Desferioxamine increases iron depletion and apoptosis induced by ara-C of human myeloid leukaemic cells. Br J Haematol 1998;102:746–52.[CrossRef][Medline]
  50. Meyskens FL Jr, Farmer P, Fruehauf JP. Redox regulation in human melanocytes and melanoma. Pigment Cell Res 2001;14:148–54.[CrossRef][Medline]
  51. Cen D, Gonzalez RI, Buckmeier JA, Kahlon RS, Tohidian NB, Meyskens FL Jr. Disulfiram induces apoptosis in human melanoma cells: a redox-related process. Mol Cancer Ther 2002;1:197–204.[Abstract/Free Full Text]
  52. Rossiello R, Carriero MV, Giordano GG. Distribution of ferritin, transferrin and lactoferrin in breast carcinoma tissue. J Clin Pathol 1984;37:51–5.[Abstract/Free Full Text]
  53. Fleming S. Immunocytochemical localization of ferritin in the kidney and renal tumours. Eur Urol 1987;13:407–11.[Medline]
  54. Carter RL, Hall JM, Corbett RP. Immunohistochemical staining for ferritin in neuroblastomas. Histopathology 1991;18:465–8.[Medline]
  55. Yang HB, Hsu PI, Lee JC, Chan SH, Lin XZ, Chow NH. Adenoma-carcinoma sequence: a reappraisal with immunohistochemical expression of ferritin. J Surg Oncol 1995;60:35–40.[Medline]
  56. Weber A, Engers R, Nockemann S, Gohr LL, Zur HA, Gabbert HE. Differentially expressed genes in association with in vitro invasiveness of human epithelioid sarcoma. Mol Pathol 2001;54:324–30.[Abstract/Free Full Text]
  57. Hazard JT, Drysdale JW. Ferritinaemia in cancer. Nature 1977;265:755–6.[CrossRef][Medline]
  58. Luger TA, Linkesch W, Knobler R, Kokoschka EM. Serial determination of serum ferritin levels in patients with malignant melanoma. Oncology 1983;40:263–7.[Medline]
  59. Kikyo N, Suda M, Kikyo N, et al. Purification and characterization of a cell growth factor from a human leukemia cell line: immunological identity with ferritin. Cancer Res 1994;54:268–71.[Abstract/Free Full Text]
  60. Gray CP, Franco AV, Arosio P, Hersey P. Immunosuppressive effects of melanoma-derived heavy-chain ferritin are dependent on stimulation of IL-10 production. Int J Cancer 2001;92:843–50.[CrossRef][Medline]
  61. Chedekel MR. Photochemistry and photobiology of epidermal melanins. Photochem Photobiol 1982;35:881–5.[Medline]
  62. Meyskens FL Jr, Buckmeier JA, McNulty SE, Tohidian NB. Activation of nuclear factor-{kappa}B in human metastatic melanoma cells and the effect of oxidative stress. Clin Cancer Res 1999;5:1197–202.[Abstract/Free Full Text]
  63. Pham CG, Bubici C, Zazzeroni F, et al. Ferritin heavy chain upregulation by NF-{kappa}B inhibits TNF{alpha}-induced apoptosis by suppressing reactive oxygen species. Cell 2004;119:529–42.[CrossRef][Medline]
  64. Rohrdanz E, Schmuck G, Ohler S, Tran-Thi QH, Kahl R. Changes in antioxidant enzyme expression in response to hydrogen peroxide in rat astroglial cells. Arch Toxicol 2001;75:150–8.[CrossRef][Medline]
  65. Meewes C, Poswig A, Dissemond J, Brenneisen P, Scharffetter-Kochanek K. Adaptive antioxidant defence in human dermal fibroblasts. Br J Dermatol 2000;143:662–3.[CrossRef][Medline]
  66. Meewes C, Brenneisen P, Wenk J, et al. Adaptive antioxidant response protects dermal fibroblasts from UVA-induced phototoxicity. Free Radic Biol Med 2001;30:238–47.[CrossRef][Medline]
  67. Armeni T, Battino M, Stronati A, et al. Total antioxidant capacity and nuclear DNA damage in keratinocytes after exposure to H2O2. Biol Chem 2001;382:1697–705.[CrossRef][Medline]
  68. Yohn JJ, Norris DA, Yrastorza DG, et al. Disparate antioxidant enzyme activities in cultured human cutaneous fibroblasts, keratinocytes, and melanocytes. J Invest Dermatol 1991;97:405–9.[CrossRef][Medline]
  69. Gutteridge JM. Biological origin of free radicals, and mechanisms of antioxidant protection. Chem Biol Interact 1994;91:133–40.[CrossRef][Medline]
  70. Minotti G, Aust SD. The role of iron in oxygen radical mediated lipid peroxidation. Chem Biol Interact 1989;71:1–19.[CrossRef][Medline]
  71. Maresca V, Roccella M, Roccella F, et al. Increased sensitivity to peroxidative agents as a possible pathogenic factor of melanocyte damage in vitiligo. J Invest Dermatol 1997;109:310–3.[CrossRef][Medline]
  72. Kwok JC, Richardson DR. Anthracyclines induce accumulation of iron in ferritin in myocardial and neoplastic cells: inhibition of the ferritin iron mobilization pathway. Mol Pharmacol 2003;63:849–61.[Abstract/Free Full Text]
  73. Weeraratna AT, Becker D, Carr KM, et al. Generation and analysis of melanoma SAGE libraries: SAGE advice on the melanoma transcriptome. Oncogene 2004;23:2264–74.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baldi, A.
Right arrow Articles by Paggi, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baldi, A.
Right arrow Articles by Paggi, M. G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online