
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Human Cancer Biology |
Authors' Affiliations: 1 Laboratory "C," Department for the Development of Therapeutic Programs and 2 Laboratory of Immunology, Center for Experimental Research, Regina Elena Cancer Institute; 3 Service of Oncology, Campus BioMedico University; 4 San Gallicano Dermatological Institute, Rome, Italy; 5 Deparment of Biochemistry and Biophysics "F. Cedrangolo," Section of Anatomic Pathology, Second University of Naples, Naples, Italy; and 6 Department of Experimental Medicine, University of L'Aquila, L'Aquila, Italy
Requests for reprints: Marco G. Paggi, Laboratory "C," Department for the Development of Therapeutic Programs, Regina Elena Cancer Institute, Center for Experimental Research, Via E. Chianesi 53, 00128 Rome, Italy. Phone: 39-06-5266-2550; Fax: 39-06-5266-2572; E-mail: paggi{at}ccd.inemm.cnr.it.
| Abstract |
|---|
|
|
|---|
Experimental Design: Starting from the LM human metastatic melanoma cell line, we engineered cell clones in which L-ferritin gene expression was down-regulated by the stable expression of a specific antisense construct. These cells were then assayed for their growth capabilities, chemoinvasive properties, and sensitivity to oxidative stress. Additionally, ferritin protein content in primary and metastatic human melanomas was determined by immunohistochemistry.
Results: Artificial L-ferritin down-regulation in the LM cells strongly inhibited proliferation and chemoinvasion in vitro and cell growth in vivo. In addition, L-ferritin down-regulated cells displayed enhanced sensitivity to oxidative stress and to apoptosis. Concurrently, immunohistochemical analysis of a human melanoma tissue array revealed that ferritin expression level in metastatic lesions was significantly higher (P < 0.0001) than in primary melanomas. Furthermore, ferritin expression was constantly up-regulated in autologous lymph node melanoma metastases when compared with the respective primary tumors in a cohort of 11 patients.
Conclusions: These data suggest that high ferritin expression can enhance cell growth and improve resistance to oxidative stress in metastatic melanoma cells by interfering with their cellular antioxidant system. The potential significance of these findings deserves to be validated in a clinical setting.
Key Words: chemoinvasion metastasis apoptosis lipid peroxidation
Recently, we took advantage of an in vitro model of melanoma progression consisting of two cell lines: LP, which is derived from a primary human melanoma, and LM, which is derived from a supraclavicular lymph node metastasis of the same patient, the latter showing enhanced cell proliferation and clonogenic capacity (13). By means of cDNA arrays, we identified several genes whose expression was modulated in our model system and, among these, the gene encoding for ferritin light chain (L-ferritin) whose expression was found up-regulated in the LM cell line (14).
Ferritins are important regulators of the intracellular iron content. Pharmacologically obtained iron depletion induces major cellular alterations, including cell cycle arrest and apoptosis (15), but at elevated tissue concentrations, iron results as a potential toxicant (16). Storage of intracellular iron in the ferritin molecules together with a down-modulation of transferrin receptor are the two key mechanisms through which the human tissues are shielded from the toxic effects of excess iron ions (17). Ferritins are made of 24 subunits assembled to form the apoferritin shell. The protein subunits are of two types, light chain and heavy chain, which share extensive homology. The heavy chain is predominant in the so-called acidic isoferritins, prevalently detectable in heart, kidney, and placenta. The light chain is usually found in the so-called basic isoferritins, detected in liver and spleen. Light and heavy chain ferritin subunits are encoded by two specific genes that are under separate transcriptional control. To date, the independent function and regulation of light and heavy chain ferritins still remains an open issue (16, 18, 19). Translation of both ferritin subunits is thought to be activated by iron through interactions with the iron regulatory element motifs present in the promoter region of the two genes and through cytoplasmic iron sensors called iron regulatory proteins (20). Tissue ferritin expression changes during development as well as in various pathologic states. In the past years, there has been considerable interest in ferritin as an oncofetal protein and as a marker associated with cellular proliferation (19). Findings regarding the relationship between ferritin and cancer seem, at least in part, conflicting, which reflects the relative paucity of experiments in this area. Nevertheless, increased ferritin concentration in tumor versus normal tissue has been reported in several malignancies, such as colon and breast cancer (2123) and seminoma (24).
Melanoma progression is associated with aberrant redox regulation leading to a continuous oxidative stress and production of reactive oxygen species (ROS), chemical species containing one or more unpaired electrons (25).
Due to the considerable novel interest raising on the mechanisms linking iron metabolism and cancer cells (15, 26), we have sought to assess the functional significance of ferritin in the biology of human melanoma, a tumor type characterized by a peculiar iron metabolism (27, 28). By means of artificial down-regulation of L-ferritin in metastatic human melanoma cells, we investigated the possible role of ferritin in the progression of this tumor and in its peculiar response to oxidative stress. Additionally, we determined immunohistochemically ferritin expression level in primary and metastatic melanomas.
| Materials and Methods |
|---|
|
|
|---|
10 in vitro passages, LP cells showed a different, more malignant, phenotype.7 To maintain cells in fatty acid precursorsupplemented culture conditions, linoleic acid was added to the medium at the final concentration of 7 x 105 mol/L from a stock solution in absolute ethanol. An equal volume of absolute ethanol was added to the medium of control cells. Bovine serum albumin at the final concentration of 0.02% was added as a fatty acid carrier to both control and treated cells. Cells were exposed to fatty acids precursors for 6 days before analysis.
cDNA constructs. The human L-ferritin (Genbank accession no. M11147) cDNA was cloned in sense or antisense orientation in the pcDNA3-T7-Tag vector (Invitrogen, Carlsbad, CA) between BamHI and EcoRI sites. The primers used for the L-ferritin construct were (forward) AGCGGATCCATGAGCTCCCAGATTCGTCAG and (reverse) AGCGAATTCTTAGTCGTGCTTGAGAGTGAG. The primers used for the antisense-L-ferritin (AS-L-ferritin) construct were (forward) AGCGAATTCATGAGCTCCCAGATTCGTCAG and (reverse) AGCGGATCCTTAGTCGTGCTTGAGAGTGAG.
Northern blot analysis. Northern blot analysis was done as described (14) using the human L-ferritin cDNA as a probe. A subsequent hybridization with ß-actin was used for normalization. Quantification of the bands was obtained by the ImageQuant 5.0 software (Molecular Dynamics, Sunnyvale, CA).
Western blot analysis. Western blotting on cell lysates was done as described (29) using a rabbit anti-human ferritin antibody (DAKO, Carpinteria, CA) at a working dilution of 1:500. Normalization was done using an anti-HSP70 mouse monoclonal antibody (Oncogene Science, Manhasset, NY). Quantification of the bands was obtained by the ImageQuant 5.0 software.
Transfections. LM cells (7 x 105) were transfected with 30 µg pcDNA3-T7-Tag plasmid as control, with the pcDNA3-T7-L-ferritin-Tag construct (sense), or with the pcDNA3-T7-AS-L-ferritin-Tag construct, containing the ferritin light chain cDNA sequence in antisense orientation, by electroporation as described (30). Under these conditions, 55% transfection efficiency was achieved. After growing electroporated cells in G418-containing medium (250 µg/mL) for 14 days, single clones were isolated and grown. Control clones were propagated at 60% to 70% of confluence. Because L-ferritin down-regulated LM clones underwent apoptosis when kept >3 days in culture, these cells were propagated every other day at 40% to 50% of confluence.
Proliferation assay. Cells were seeded in a 96-well plate (5 x 103 per well) 12 hours before the experiment. Cell growth was evaluated using the Cell Proliferation Kit II (Roche Molecular Biochemicals, Indianapolis, IN) following manufacturer's instructions. This method employs a colorimetric procedure based on the tetrazolium salt sodium, 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide inner salt, which is transformed in a formazan dye only in metabolically active cells. The formazan dye was measured after 4 hours at a 492 nm wavelength. Values ± SD are the average of three experiments done in decuplicate.
In vitro invasion assay. The chemoinvasion assay was done as described (31) with some minor modifications. Briefly, cell culture inserts incorporating 6.4 mm diameter membranes (8 µm pore size, Becton Dickinson, Franklin Lakes, NJ) were used. Membranes were coated with 10 µg each of Matrigel basement membrane matrix (Becton Dickinson). Results were expressed as the number of invaded cells on the lower surface of the membrane. Ten microscope fields per each membrane were counted. Each experiment was done at least five times.
Terminal deoxynucleotidyl transferasemediated dUTP nick end labeling assay. Cells were fixed in paraformaldehyde, washed in distilled water, and exposed briefly to 3% H2O2 to inactivate endogenous peroxidase. The terminal deoxynucleotidyl transferasemediated dUTP nick end labeling (TUNEL) reaction was done using the peroxidase-based Apoptag kit (Intergene, Purchase, NY). The TUNEL-positive cells were revealed by diaminobenzidine and H2O2 according to the manufacturer's instructions. Finally, stained cells were slightly counterstained with hematoxylin. TUNEL-positive cells were considered as apoptotic.
Induction and evaluation of apoptosis. Cells were grown up to 70% confluence; then, apoptosis was induced by the addition of H2O2 (at the final concentrations of 25, 50, 100, and 200 µmol/L) or the anti-Fas antibody CH11 (Upstate Biotechnology, Lake Placid, NY; at the final concentrations of 15, 30, 60, and 120 ng/mL). Cells were assayed after 60 minutes. Cell cycle analysis was done by flow cytometry using the CycleTest Plus DNA Reagent kit (Becton Dickinson) following manufacturer's instructions. Cells were analyzed by a FACSCalibur flow cytometer (Becton Dickinson; 1 x 104 events per sample). To estimate apoptosis, the acquired data were elaborated with the CellQuest version 3.3 software and analyzed with the ModFit LT version 3.0 software.
In vivo analysis of tumor growth inhibition. LM cells (1 x 106) stably transfected with pcDNA3-T7-Tag plasmid or with the pcDNA3-T7-AS-L-ferritin-Tag construct were injected s.c. into the flanks of male CD1 nu/nu mice (Charles River, Calco, Italy) in a final volume of 350 µL. Eight mice for each experimental point were employed. Tumor volume was monitored by standard procedures. After 39 days, animals were sacrificed and tumors were removed and processed for RNA extraction and for histology.
Descriptive statistical analysis was used to monitor tumor volume modifications (expressed as median value and 95% confidential interval of tumor volumes). Sheffe test and two-way ANOVA analysis were used to compare tumor growth (tumor volume) of different cancer clones (multiple comparisons). Ps
0.05 were regarded as statistically significant in two-tailed tests. SPSS software version 10.00 (SPSS, Chicago, IL) was used for statistical analysis.
All procedures involving animals and their care were conducted in conformity with the institutional guidelines in compliance with national (D.L. No. 116, G.U., Suppl. 40, Feb. 18, 1992; Circolare No. 8, G.U., July 1994) and international laws (EEC Council Directive 86/609, OJ L 358. 1, Dec 12, 1987; Guide for the Care and Use of Laboratory Animals, U.S. National Research Council, 1996).
Antioxidant enzymatic activities assay. Superoxide dismutase (SOD) activity was evaluated as described (32). The results were reported as units/mg of protein.
Catalase activity was determined by the disappearance of H2O2 (10 mmol/L) measured at 240 nm in PBS (pH 7.4; ref. 33). The results were reported as units/mg of protein.
Reactive oxygen species detection. ROS production was detected by 2',7'-dichlorofluorescein diacetate (Fluka AG, Buchs, Switzerland), a substance oxidizable to fluorescent dichlorofluorescein by several different ROS and peroxides. Cells were gently detached, washed, and incubated (30 minutes at 37°C, 5% CO2) in the presence of 2.5 µmol/L 2',7'-dichlorofluorescein diacetate in PBS plus 5 mmol/L glucose. Flow cytometric analysis was immediately done by a Cytoron Absolute (Ortho Diagnostic System, Raritan, NJ) with excitation and emission setting at 488 and 530 nm, respectively. The intracellular ROS were quantified using the median of FL1 channel of fluorescence, which matches with the maximal number of cells with the highest fluorescence.
Vitamin E analysis. Vitamin E was extracted (34) and measured (35) as described. Results are reported as the mean of two determinations from two different experiments and expressed as ng/mg protein.
Thiobarbituric acidreactive substances analysis. The evaluation of thiobarbituric acidreactive substances (TBARS) was done as described (36). The assay reveals mainly malondialdehyde, which forms a spectrophotometrically detectable adduct with thiobarbituric acid. For TBARS quantitative determination, malondialdehyde standard solutions of known concentration were used instead of the cell lysate. We did three different determinations in duplicate. TBARS, detected as pmol/mg of protein, were expressed as percentage variations due to intrinsic variability of the detection system itself.
Polyunsaturated fatty acid analysis. Lysed cells were extracted twice in chloroform/methanol (2:1) in the presence of butylated hydroxytoluene (100 µg) as antioxidant. Phospholipid fraction was purified by TLC, and tricosanoic acid ethyl ester (100 µg) was added as internal standard. The fatty acids of phospholipid fraction were transmethylated with sodium methoxide in methanol and analyzed by a combined gas chromatography-mass spectrometry system (Hewlett-Packard, Palo Alto, CA, 5890 II gas chromatography combined with 5989 mass spectrometry) on capillary column (FFA-P, 60 m x 0.32 µm x 0.25 mm, Hewlett-Packard). Helium was used as carrier gas. Oven temperature gradient from 80°C to 220°C at 10°C/min was used (37). The results were obtained after time integration of the chromatogram and final processing of the peak areas and reported as polyunsaturated fatty acid (PUFA) µg/mg of protein.
Protein determination. Protein determination was done according to Bradford (38).
Immunohistochemistry. Immunohistochemistry on the human malignant melanoma tissue array CK1 slide (SuperBioChips Laboratory, Seoul, South Korea) as well as on 11 primary melanomas and matched lymph node metastases was done as described previously (14) using the rabbit anti-human ferritin antibody (A0133) at 1:250 dilution or the monoclonal mouse antibody to human melanoma (clone HMB45, DBS, Pleasanton, CA) at 1:50 dilution after a 10-minute Pronase treatment (DAKO). 3-Amino-9-ethylcarbazide was the final chromogen and hematoxylin is the nuclear counterstain. The percentage of ferritin-stained cells per field (x250) at light microscopy was calculated and compared in different specimens by three separate observers (A.B., L.R., and F.B.) in a double-blind fashion, choosing areas almost completely composed by HMB45-positive cells. The score was as follows: +, up to 5% positive cells per field; ++, 6% to 15% positive cells per field; +++, 16% to 25% positive cells per field; and ++++, >25% positive cells per field. The level of concordance, expressed as the percentage of agreement between the observers, was 92%. In the remaining specimens, the score was obtained after collegial revision and agreement. Spearman's rank correlation or Fisher's exact test was used to assess relationship between ordinal data. Ferritin values in the different subset of tumor (primary tumors, metastases) and in different pathologic stages of disease (tumor-node-metastasis) were compared according to Mann-Whitney U test for nonparametric independent variables. Ps
0.05 were regarded as statistically significant in two-tailed tests. SPSS software was used for statistical analysis.
The LF03 anti-human ferritin light chain monoclonal antibody was elicited by human liver ferritin and selected for its specificity to ferritin light chain (39). The suitability of this antibody for immunohistochemical analysis has been described elsewhere (40). The antibody was used at a 1:500 dilution and incubated for 1 hour at room temperature.
The immunohistochemical results obtained with the polyclonal rabbit anti-human ferritin antibody raised against liver ferritin (prevalently L-ferritin) were confirmed in a selected number of specimens using the LF03 monoclonal antibody.
| Results |
|---|
|
|
|---|
|
|
|
|
In L-ferritin down-regulated LM cells, SOD activity was significantly higher (12.71 ± 2.46 versus 4.54 ± 1.21 units/mg protein), whereas catalase activity resulted significantly lower (6.61 ± 1.52 versus 16.21 ± 3.09 units/mg protein) when compared with control LM cells (P < 0.005). Consequently, the SOD/catalase ratio was higher in L-ferritin down-regulated LM cells (1.92) with respect to control cells (0.28), thus facilitating H2O2 accumulation in the former.
The amounts of total PUFAs were 0.11 ± 0.032 and 0.39 ± 0.066 µg/mg of protein in L-ferritin down-regulated LM cells and control cells, respectively (P < 0.005). TBARS, expressed as percentage variations, were significantly higher (41 ± 18%) in L-ferritin down-regulated LM cells than in control cells (P < 0.001). Moreover, vitamin E levels were found higher in L-ferritin down-regulated LM cells than in control cells (7.64 ± 1.22 and 5.84 ± 0.86 ng/mg of protein, respectively; P < 0.01) as a possible compensatory mechanism to counteract oxidative stress (35, 45). All these data are summarized in Table 1.
|
To counteract the effects of fatty acid precursor depletion, a phenomenon generally occurring in cultured cells (46), in a separated set of experiments, we supplemented the culture medium of both control LM and L-ferritin down-regulated LM cells with the fatty acid precursor linoleic acid (added as specified in Materials and Methods). Cells were then assayed for TBARS and PUFA content and for proliferative capabilities. The data obtained from two different determinations, each done in triplicate, indicated that linoleic acidsupplemented cells showed increased TBARS content, which was more pronounced in L-ferritin down-regulated LM than in control LM cells (20.4% and 50.5%, respectively). As far as PUFAs are concerned, we evaluated linoleic (C18:2
9,12) and arachidonic acid (C20:4
5,8,11,14), which are the most relevant cell membrane unsaturated components. In cells supplemented with linoleic acid, we found a more pronounced increase in control LM cells than in L-ferritin down-regulated LM cells (8.27- and 4.92-fold, respectively). In turn, arachidonic acid, a key target of lipoperoxidative damage, was found considerably more reduced in L-ferritin down-regulated LM than in control LM cells (8.83- and 3.55-fold reduction, respectively).
Furthermore, linoleic acid supplementation produced a 48.26% decrease in control LM cells and a 38.17% decrease in L-ferritin down-regulated LM cells, which were already growth inhibited by the expression of the AS-L-ferritin construct (Fig. 5).
|
|
|
|
| Discussion |
|---|
|
|
|---|
Although the biological role of ferritin in tumor cells is still not completely understood, various studies suggest that intracellular ferritin level is a reliable marker of cell proliferation (19). Iron deprivation has been shown to significantly inhibit cell cycle and proliferation in cancer cells (15). In fact, in iron-deprived human breast cancer cells, down-regulation of cyclin-dependent kinase activities, and decrease in cyclin D/cyclin-dependent kinase 4 protein levels is found, thus reducing their proliferative potential (47). In addition, it has been reported that iron chelators induce apoptosis in tumor cells, indicating a potential role of intracellular iron in the regulation of programmed cell death (15, 4851). Several studies have confirmed the expression of ferritin in tumor cells, where high concentrations often correlate with higher degrees of cell proliferation (16, 2124, 5256). It is well known that cancer patients often exhibit an elevated level of serum ferritin usually correlated with a poor prognosis (16, 19, 57). This is also true in the case of human melanoma, where increased serum ferritin concentrations are associated with progressive metastatic disease (58). In addition, ferritin is produced and secreted as a cell growth factor by several cancer cells in vitro (59) and is considered responsible for some of the melanoma-induced immunosuppressive effects (60).
Melanoma cells often display an increased state of chronic oxidative stress when compared with melanocytes (35, 61). High levels of H2O2 stimulate the activity of several transcriptional factors, including nuclear factor-
B (25, 62), known to enhance survival pathways by inducing gene expression for different growth factors; therefore, melanoma cells, with endogenous high ferritin levels, can be endowed with higher survival and biological aggressiveness (62). Recently, ferritin heavy chain (H-ferritin) has been shown to play a key role in regulating apoptosis during inflammation. In fact, H-ferritin, induced by nuclear factor-
B, is required to prevent sustained c-Jun NH2-terminal kinase cascade activation, thus inhibiting ROS-mediated tumor necrosis factor-
-induction and the consequent apoptosis. In essence, H-ferritin-driven inhibition of c-Jun NH2-terminal kinase signaling depends on suppressing ROS accumulation and is achieved through its ability to sequester iron ions (63).
In our experimental model, LM metastatic cells clearly seem to depend on their high intracellular ferritin content as indicated by the reduction of their proliferative and invasive potential when L-ferritin was experimentally down-regulated. Thus, we can hypothesize that enhanced proliferation of cancer cells is supported by high ferritin level with resulting decrease of the overall oxidative stress and the associated apoptosis.
L-ferritin down-modulation in LM cells was also associated with increased SOD and decreased catalase activities. Chronic pro-oxidant stimuli can induce SOD activity both in vitro and in vivo (6466), whereas catalase, a heme-containing enzyme, is more susceptible to inactivation by exposure to high doses of peroxidizing substances, including its own substrate (H2O2; ref. 67). The unbalance between SOD and catalase activities predisposes to intracellular H2O2 production because catalase, in association with glutathione peroxidase, is devoted to remove H2O2 (68). When the production of H2O2 overwhelms catalase activity, in the presence of free transitional metals, such as iron, Fenton reaction is promoted, generating extremely reactive hydroxyl radical (69, 70). In fact, alteration of SOD and catalase activities in LM ferritin down-modulated cells was associated with peroxidation of the cell membrane unsaturated lipid and apoptosis. In addition, after linoleic acid supplementation, the increase of linoleic acid content in the cell membrane was more evident in control than in L-ferritin down-regulated transfected cells, suggesting that, in the latter, linoleate could be quickly consumed by the lipoperoxidative damage. The pronounced decrease in arachidonic acid level and TBARS accumulation strongly suggest a higher susceptibility to lipid peroxidation as well.
The attempt we made to up-regulate L-ferritin expression in LM cells via transfection of the L-ferritin cDNA in "sense" orientation resulted in the generation of clones unable to express any detectable increase in ferritin content; moreover, these cells did not show any significantly altered proliferative activity. This can be possibly ascribed to threshold or saturation effects.
In association with the lipid peroxidation process, we observed an increase in vitamin E concentration as an effort to counteract cell membrane alterations. Comparable alterations have been described in cultured melanocytes from pheomelanic patients, which are more susceptible to proapoptotic stimuli (71). Similar events can possibly occur in L-ferritin down-regulated LM cells as well, thus increasing their sensitivity to the cytotoxic effect of proapoptotic chemotherapeutic drugs. In fact, we observed a significantly higher rate of spontaneous or induced apoptosis in L-ferritin down-regulated LM cells than in control. All these events are essentially in agreement with the increased production of Fenton-generated hydroxyl radicals. As an alternative explanation, ROS-induced genomic damage could favor the selection of a phenotype particularly resistant to apoptosis. These hypotheses are not mutually exclusive.
A synergistic effect between ferritin down-modulation and the effect of chemotherapeutic anticancer agents able to raise the intracellular iron content (72) could be envisaged as candidates for clinical testing.
To the best of our knowledge, this is the first study showing that ferritin may be a growth regulatory element of the molecular pathway controlling proliferation and invasiveness of melanoma cells. Furthermore, we show that metastatic melanomas express higher ferritin levels, which may account for the elevated serum levels of ferritin in melanoma patients with progressive metastatic disease. Recently, comparative analysis of human Serial Analysis of Gene Expression libraries from primary and metastatic melanomas and other malignances has identified L-ferritin as one of the genes whose expression best distinguishes the melanoma libraries from the other ones (73).
It has been proposed that during melanomagenesis the intrinsic antioxidant control of melanocytes is lost, and inappropriate redox-sensitive transcription factors activation occurs, contributing to the establishment of an antiapoptotic phenotype and possibly concurring in determining the resistance of melanoma cells to chemotherapeutic agents (50). As the transformed melanocyte population expands, restrictions due to the high redox cycling can generate a selective growth advantage for tumor cells expressing high levels of ferritin, which contributes to lower the toxic effects of excess intracellular iron ions. In conclusion, this generates a phenotype more resistant to apoptosis.
In view that the in vivo analysis has shown a significant increase of ferritin amount in melanoma metastases, further studies are required to determine whether ferritin up-regulation is a common and biologically critical event during melanoma progression. The present findings may be relevant in generating therapeutic protocols that include modulation of intracellular iron content in cancer cells.
| Acknowledgments |
|---|
| Footnotes |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
7 C. Leonetti, personal communication. ![]()
Received 4/ 1/04; revised 1/11/05; accepted 2/ 3/05.
| References |
|---|
|
|
|---|
B in human metastatic melanoma cells and the effect of oxidative stress. Clin Cancer Res 1999;5:1197202.
B inhibits TNF
-induced apoptosis by suppressing reactive oxygen species. Cell 2004;119:52942.[CrossRef][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |