Clinical Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium Infection and Cancer: Biology, Therapeutics, and Prevention
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miura, N.
Right arrow Articles by Shiota, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miura, N.
Right arrow Articles by Shiota, G.
Clinical Cancer Research Vol. 11, 3205-3209, May 1, 2005
© 2005 American Association for Cancer Research

Imaging, Diagnosis, Prognosis

Serum Human Telomerase Reverse Transcriptase Messenger RNA as a Novel Tumor Marker for Hepatocellular Carcinoma

Norimasa Miura1, Yoshiko Maeda2, Takamasa Kanbe3,5, Hiroaki Yazama1, Yohei Takeda1, Reina Sato1, Tomoe Tsukamoto1, Emi Sato1, Akira Marumoto1, Tomomi Harada1, Akiko Sano1, Yosuke Kishimoto1, Yasuaki Hirooka4, Yoshikazu Murawaki2, Junichi Hasegawa1 and Goshi Shiota3

Authors' Affiliations: 1 Division of Pharmacotherapeutics, Department of Pathophysiological and Therapeutic Science, 2 Division of Medicine and Clinical Science, Department of Multidisciplinary Internal Medicine, 3 Division of Molecular and Genetic Medicine, Department of Genetic Medicine and Regenerative Therapeutics, 4 Division of Surgery and Clinical Medicine, Department of Surgery, Tottori University School of Medicine; and 5 Internal Medicine, San-in Labor Welfare Hospital, Yonago, Japan

Requests for reprints: Norimasa Miura, Division of Pharmacotherapeutics, Department of Pathophysiological and Therapeutic Science, Tottori University Schol of Medicine, 86 Nishicho, Yonago, Tottori 683-8503, Japan. Phone: 81-859-34-8014; Fax: 81-859-34-8140; E-mail: mnmiura{at}grape.med.tottori-u.ac.jp.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Purpose: We previously reported the usefulness of a qualified highly sensitive detection method for human telomerase reverse transcriptase (hTERT) mRNA in serum with 89.7% sensitivity for hepatocellular carcinoma (HCC). In this study, we developed a quantitative detection method for serum hTERT mRNA and examined the clinical significance in HCC diagnosis.

Experimental Background: In 64 patients with HCC, 20 with liver cirrhosis, 20 with chronic hepatitis, and 50 healthy individuals, we measured serum hTERT mRNA by using the newly developed real-time quantitative reverse transcription-PCR with SYBR Green I. We examined its sensitivity and specificity in HCC diagnosis, clinical significance in comparison with other tumor markers, and its correlations with the clinical variables by using multivariate analyses.

Results: Serum hTERT mRNA showed higher values in patients with HCC than those with chronic liver diseases. hTERT mRNA expression was shown to be independently correlated with clinical variables such as tumor size, number, and degree of differentiation (P < 0.001, each). The sensitivity/specificity of hTERT mRNA and alpha;-fetoprotein (AFP) mRNA in HCC diagnosis were 88.2%/70.0% for hTERT and 71.6%/67.5% for AFP, respectively. hTERT mRNA proved to be superior to AFP mRNA, AFP, and des-{gamma}-carboxy prothrombin in HCC diagnosis. Furthermore, hTERT mRNA in serum was associated with that in HCC tissue.

Conclusions: The usefulness of hTERT mRNA expression in HCC diagnosis and its superiority to conventional tumor markers were shown. Therefore, serum hTERT mRNA is a novel and available marker for HCC diagnosis.

Key Words: hTERT • real-time RT-PCR • cancer diagnosis • hepatocellular carcinoma • tumor marker

Telomeres shorten by being fractionated at each cell cycle during aging, and they exhibit cell divisions eventually resulting in cell death (1). However, cancer cells can maintain telomere lengths by reactivated telomerase, a ribonucleoprotein enzyme responsible for one strand of the telomere terminal repeats. The key protein subunit of the telomerase complex, known as human telomerase reverse transcriptase (hTERT), directly mediates nucleotide addition using its reverse transcriptase (RT)–like motifs to prevent senescence in immortalized cells (2). Because many kinds of mRNAs could be found in the plasma or serum of healthy individuals and cancer patients (3), it has been suggested that detection of cancer-related gene expressions in serum is very useful for diagnosis and follow-up of cancer patients. hTERT mRNA in serum was detected in breast cancer but not in benign diseases, suggesting that hTERT is available for cancer diagnosis (4).

Hepatocellular carcinoma (HCC) is one of the most common and fatal malignancies associated with hepatitis B virus (HBV) and hepatitis C virus (HCV) infection (5). Although HCC patients undergo medical and surgical treatment for primary tumors, intrahepatic and extrahepatic reccurence frequently limit patient's survival (6). Although the modalities such as ultrasonography and conventional tumor markers are important for detection of HCC (7), they are not still sensitive enough to detect HCC at the early stage.

We previously reported that telomerase was significantly reactivated in HCC, and that in chronic liver diseases such as liver cirrhosis (LC) and chronic hepatitis (CH) it was significantly lower than that in atypical adenomatous hyperplasia and HCC. In this study, we focused on HCC of all malignancies due to the following reasons. First, hTERT mRNA is up-regulated in the multistep process of hepatocarcinogenesis (8). Second, other conventional tumor markers such as {alpha}-fetoprotein (AFP) and des-{gamma}-carboxy prothrombin (DCP) are widely used in clinical scenes of HCC. In our previous study, we reported that the sensitive method for detecting tumor-derived hTERT mRNA in serum was superior to AFP level for the early detection of HCC patients whose AFP levels were low (9). In the present study, by newly developed quantified detection system of serum hTERT, we mainly focused on the comparison of hTERT mRNA with AFP mRNA, AFP, and DCP for HCC diagnosis because AFP mRNA is the most sensitive marker of the known markers for HCC, and show for the first time that measurement of hTERT mRNA is superior to the conventional tumor markers, such as AFP, DCP, and AFP mRNA, in HCC diagnosis.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Patients and sample collection. One hundred-four consecutive patients (64 patients with HCC, 20 with LC, and 20 with CH), who were admitted to Tottori University Hospital between December, 2001 and October, 2002, were enrolled in this study. All the HCC patients had LC as underlying liver disease. The mean ages of patients with HCC, LC, and CH were 66, 64, and 55 years, respectively. HBV and HCV infection were diagnosed by HBs antigen (LP1A-200, Diatron Laboratories, Inc., Tokyo, Japan) and HCV antibody (Immunocheck-HCVAb, International Reagent Corporation, Kobe, Japan) in serum, respectively. Sixty-six patients were infected with HCV, 30 with HBV, 3 with both viruses, and 5 with no viral markers. The patients were diagnosed by blood chemistry, ultrasonography, computed tomography, AFP, and/or biopsy under ultrasonography. The clinicopathologic findings (gender, age, etiology, Pugh score, Child classification, underlying liver disease, total bilirubin, albumin, alanine aminotransferase, AFP, AFP-L3, DCP, HCV titer, HCV subtype, tumor number, tumor size, degree of tumor differentiation, and presence of metastasis) were evaluated. Fifty healthy individuals including 12 females (22-83 years old; mean age, 58 years) served as controls. Informed consent was obtained from each patient and study protocols followed the ethical guidelines of the 1975 Declaration of Helsinki and were approved by the human research committee of Tottori University (approval nos. 138 and 138-1, 2001).

Centrifugation of collected blood and harvesting serum samples were done by using three steps of centrifugation (800 x g with 0.45 µm filtration, 1,000 x g, and 1,500 x g) to decrease lymphocyte to a minimum as previously described (9). To confirm the effective removal of lymphocytes which are contained in serum, CD2, CD3, CD8, CD19, CD22, and CD68 expressions were examined by using ß2-microglobin as an expression control.

To study whether hTERT mRNA in serum is originated and released from HCC in liver, we harvested the surgically resected HCC tissues and sera in 10 HCC patients.

RNA extraction and real-time quantitative reverse transcription-PCR. RNA was extracted with DNase treatment from serum as reported previously (4, 9). RNA from 200 µL of serum was dissolved in 200 µL of H2O. The quantitative reverse transcription-PCR (RT-PCR) was done by using 1 µL of RNA extract and 2 µL of SYBR Green I (Roche, Basel, Switzerland) in a One Step RT-PCR kit (Qiagen, Tokyo, Japan), in which ß2-microglobin RNA was used as a PCR quality control. RNA was extracted from HCC tissues by using the same volume of serum and dried up to 20-fold concentration. RNAs from HCC tissues were extracted using TRIzol Reagent according to the instructions of the manufacturer (Invitrogen Corp., Carlsbad, CA). Primers used in the experiment were as follows (5, 10): (a) for AFP-F, CCAGTAAACCCTGGTGTTGG, and AFP-R, TCTTGCTCATCGTTTGCAG; (b) CD8-F, GGTTGGAGCAGTAGCTGGAG, and CD8-R, TCTGCCAAAGGCAGTTCTCT; (c) CD68-F, ACCAAGAGCCACAAAACCAC, and CD68-R, GGACTGTGAGTGGCAGTTGA; and (d) ß2-microglobin-F, TGAGTGCTGTCTCCATGTTTGA, and ß2-microglobin-R, TCTGCTCCCCACCTCTAAGTTG. The RT-PCR condition was an initial incubation at 50°C for 30 minutes followed by a 12-minute incubation at 95°C, then 50 cycles at 95°C (0 second), 55°C (10 seconds), and 72°C (15 seconds), and a 20-second melting at 40°C. The dynamic ranges of real-time PCR analysis for hTERT mRNA and AFP mRNA were more than 5 copies in this assay and we were able to exclude the possibility of false negativity in serum samples from patients with CH, LC, and controls. The PCR yielded products of 131 bp for hTERT, of 150 bp for AFP, and of 88 bp for ß2-microglobin RNA, respectively (data not shown). The RT-PCR assay was repeated twice and the quantification was confirmed by using LightCycler (Roche) with reproducibility.

Statistical analysis. To examine significant clinicopathologic findings affecting hTERT and other markers, multivariate analysis was done using SPSS II (SPSS Corp., Tokyo, Japan). Stratified categories in each clinical variable were evaluated by multivariate analysis using a logistic regression analysis model. In each tumor marker, we examined the significant difference among liver diseases by multivariate analysis. To examine correlations among hTERT mRNA, AFP mRNA, and conventional tumor markers, we calculated Pearson's relative index. Probability values less than 0.05 were considered to be statistically significant. To assess the accuracy of diagnostic tests, the matched data sets (chronic liver diseases patients and HCC patients) regarding AFP, AFP-L3, DCP, AFP mRNA, and hTERT mRNA were analyzed by using receiver-operator characteristic curve analysis in SPSS-II. This assay showed a strong linear relation between copy number and PCR cycles using RNA controls (r2 > 0.99). A correlation of hTERT mRNA between HCC tissue and serum was analyzed by using both paired t test and Spearman's test.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
In this assay, the expression of CD2, CD19, CD22, and CD68 was not detected after routine centrifugation but CD3 and CD8 were expressed faintly even after centrifugation at 3,000 x g to 8,000 x g (data not shown). In each quantitative assay, a strong linear relation was shown between copy number and PCR cycles using RNA controls for concentration (r2 > 0.99; data not shown). Both hTERT mRNA and AFP mRNA expressions showed stepwise up-regulation with disease progression and the quantification was significantly higher in HCC than in LC, CH, and healthy individuals (P < 0.0001, P < 0.0001, and P < 0.0001 in hTERT; P = 0.011, P = 0.044, and P < 0.0001 in AFP; Fig. 1A). The hTERT mRNA level was significantly associated with AFP mRNA level by Pearson's relative index (P < 0.05). Paired t test and Spearman's test showed significant correlation of hTERT mRNA in HCC tissue with that in serum (P < 0.01 and P = 0.017, respectively). The correlation between tissue and serum suggests that hTERT mRNA in serum is derived from HCC tissue (Fig. 1B).



View larger version (20K):
[in this window]
[in a new window]
  		Fig. 1. A, hTERT mRNA and AFP mRNA levels (on logarithmic scales) in serum from patients with HCC, LC, CH, and healthy individuals by real-time RT-PCR. The 95% confidence interval in each group is shown beside the dots. Significant differences between five groups are shown in the upper part of the figure. NL, individual with normal liver; OL, other liver diseases; CH, chronic hepatitis; LC, liver cirrhosis. B, significant correlation of hTERT mRNA level in serum with that in HCC tissues in 10 patients. Data were analyzed by paired t test (P = 0.01) and nonparametric Spearman's test (P = 0.017).

 
By multivariate analysis, clinicopathologic findings did not show any relations to hTERT expression in the serum (Table 1). However, albumin, tumor size, tumor number, degree of tumor differentiation, and the presence of intrahepatic metastasis were significantly associated with hTERT mRNA expression (P < 0.05, P = 0.001, P < 0.0001, P < 0.0001, and P < 0.05, respectively). No factors described above showed any correlations with AFP mRNA expression.


View this table:
[in this window]
[in a new window]
  		Table 1. Multivariate analysis of comparison of tumor with clinicopathologic findings

 
In HCC, all tumor markers showed no significant relations with etiology. Although the AFP level did not show any association with tumor size or tumor differentiation, DCP did with Child-Pugh score and tumor size (P < 0.05, each). The AFP level and AFP-L3 showed a significant correlation only with tumor size (P < 0.05, each) when it was stratified as <20, 20 to 30 mm, and >30 mm in diameter by a logistic regression analysis model. However, any conventional markers did not show significant correlations with tumor number, degree of tumor differentiation, or presence of metastasis by multivariate analysis (Table 1). Furthermore, hTERT mRNA expression was closely associated with well to moderate differentiation of HCC (P < 0.05).

We examined the factors that change during the progression from chronic liver diseases to HCC by multivariate analysis (Table 2). In the present study, AFP, AFP-L3, and DCP were not able to distinguish HCC from noncancerous liver diseases, however, hTERT mRNA and AFP mRNA were superior to other tumor markers in differentiating HCC from chronic liver disease (P < 0.01, each). Receiver-operator characteristic curve analyses showed that the sensitivity/specificity of hTERT mRNA and AFP mRNA for HCC were 88.2%/68.7% and 70.1%/65.8%, respectively (Fig. 2). Optimal cutoff values for both mRNA expressions were statistically calculated as 12,500 and 3,000 copies/0.2 mL, respectively.


View this table:
[in this window]
[in a new window]
  		Table 2. The sensitivity/specificity of each tumor marker for HCC

 


View larger version (17K):
[in this window]
[in a new window]
  		Fig. 2. Receiver-operator characteristic curve analysis of hTERT mRNA and AFP mRNA expressions. The curves shown were obtained by importing quantified raw data into SPSS II software and the sensitivity/specificity values were calculated. The dotted line, bold dotted line, solid line, and bold solid line correspond to DCP, AFP, AFP mRNA, and hTERT mRNA, respectively. Each line has a cutoff point for a marker.

 
Eight HCC patients were negative below the calculated cutoff values for both serum hTERT mRNA and AFP mRNA. In the present assay, the sensitivity/specificity in each tumor marker during hepatocarcinogenesis are shown in Table 2. Positive predictive value (PPV)/negative predictive value (NPV) during hepatocarcinogenesis was 0.862/0.870 in hTERT mRNA and 0.695/0.741 in AFP mRNA. PPV/NPV in AFP, AFP-L3, and DCP was 0.812/0.389, 0.778/0.277, and 0.852/0.405, respectively. By comparison of sensitivity/specificity with PPV/NPV, the setup of the exact cutoff value using the quantification in large number of patients could further improve the statistical evaluation in PPV/NPV of hTERT mRNA and AFP mRNA.


   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
Because an epoch-making assay to detect telomerase activity was established, telomerase has been examined in many kinds of cancers, precancerous lesions, and normal tissues using the telomeric repeat amplification protocol (11). Although telomerase was regarded as an unprecedented candidate tumor marker due to its specificity to cancer, its clinical application has remained unavailable because significant telomerase expression has not been detected in blood and urine samples (12). The hTERT mRNA or endogenous RNA component derived from cancer cells did not seem to be detectable in serum due to its instability by RNase in serum. Because RNAs in serum are stable within 24 hours after drawing blood (13, 14), it has been suggested that they can be detected even in blood. Actually, hTERT mRNA can be detected in serum from breast cancer patients and its maximum sensitivity and specificity were at most 40% and 100%, respectively (4). The sensitivity in patients with HCC rose to 89.7% in the semiquantitative assay and thus compared favorably with the previous findings in which the sensitivity and specificity of AFP mRNA were 69% and 50% for HCC, respectively (15). In the present study, we improved the sensitivity to detect the instable nucleotides in blood in the process of RNA extraction, including centrifugation steps to remove cellular proteins in serum and a primer set which can detect hTERT mRNA more efficiently than primers in the previous reports (data not shown).

We previously reported that hTERT expression was very faint in the serum from normal individuals, indicating that lymphocytes and circulating normal cells express very low level of hTERT mRNA (9). Because hTERT mRNA in lymphocytes is very low, elevated hTERT mRNA in serum may mean that hTERT mRNA is derived from cancer cells. Because we could detect negligible amounts of lymphocyte markers after three steps of centrifugation of blood samples, the RNA extraction procedure seemed to remove lymphocytes effectively. In addition, normal or damaged hepatocytes express negligible amounts of hTERT (16, 17). Furthermore, the correlation of hTERT mRNA between tumor tissue and serum was shown in Fig. 1B. These data suggest that hTERT mRNA detected in serum is derived from tumor cells.

Previously, we reported that qualitative analysis of serum hTERT mRNA was superior to AFP for the early detection of HCC because hTERT mRNA was detectable in HCC patients with normal AFP levels (9). AFP is being widely used as a reliable marker of HCC not in earlier stage but in the advanced stage (18). However, in this study, AFP did not distinguish HCC from noncancerous liver diseases, and hTERT mRNA showed no correlation with AFP level (P = 0.201), suggesting that quantitative analysis of serum hTERT mRNA was much more sensitive for HCC diagnosis even in the early stage. Because the induction of the abdominal ultrasound examination and computed tomography into the clinical scene enabled us to detect smaller-sized HCC, the sensitivity of AFP in the early detection of HCC became less than 70%. Unlike AFP level, AFP mRNA was significantly correlated with hTERT mRNA (P < 0.001) and was more sensitive than AFP. In the present study, we measured AFP-L3 because AFP-L3 has been reported to be a more HCC-specific marker than AFP (19). Indeed, the level of AFP-L3 was significantly correlated with size and number of HCC although that of AFP was not.

In the present study, of 64 HCC patients, eight patients were negative below the calculated cutoff value for serum hTERT mRNA. Although the reason why hTERT mRNA was negative in these patients is not clear, five of eight hTERT mRNA-negative HCC patients had decompensated LC as the underlying disease. It has been reported that decompensated LC had higher levels of serum transforming growth factor ß, which promotes apoptosis of immortalized hepatocytes (20). Therefore, in these cases, elevated transforming growth factor ß may stimulate apoptosis of immortalized cells, resulting in reduction of hTERT mRNA (21). In the other three hTERT mRNA-negative patients, HCC did not progress for a year. In five HCC patients, hTERT mRNA was followed for a year after resection of their HCC. The two patients who had a relapse of HCC showed increased levels of serum hTERT mRNA. The hTERT mRNA levels in two of the other three patients who had no relapse of HCC remained unchanged. The one patient who had no relapse of HCC had an increased level of hTERT mRNA. Although the reason for the increase in hTERT mRNA in this patient is not clear, underlying severe hepatitis may affect the increase.

hTERT mRNA is not only improved in both sensitivity and specificity but has closely correlation with tumor size and number. Because HCC repeatedly recurs polyclonally after any treatment as a biological characteristic, the measurement of serum hTERT mRNA makes it possible to comprehend reccurence or therapeutic effect in detail as well as one-point diagnosis. In this respect, we have to undergo follow-up study after the treatment of HCC. hTERT mRNA expression was found to be closely associated with well to moderate differentiation of HCC. Takahashi et al. (22) previously reported the significant correlation of HCC differentiation with telomerase expression. The results in the present study confirmed their findings. hTERT mRNA showed more sensitivity and specificity compared with AFP mRNA in HCC patients. However, in liver diseases other than HCC, hTERT mRNA was not correlated with AFP mRNA. The higher specificity of hTERT mRNA in HCC may be related to that AFP mRNA is produced in HCC cells and injured hepatocytes and hTERT is produced mainly in HCC cells.

Waguri et al. (23) proved that there exist circulating cancer cells derived from original HCC tissues in blood and they can detect hTERT mRNA in blood. The present study suggests that quantification of hTERT mRNAs in serum has diagnostic implications for HCC. We will evaluate the correlation of prognosis with hTERT mRNA (24) and the availability of hTERT mRNA in other cancers by comparison of hTERT mRNA with other tumor markers, and will study its usefulness for inflammatory diseases in which cellular reactions are active. In the future, a large-scale study may be required to confirm our results for monitoring HCC as well as its detection.


   Footnotes
 
Grant support: Grant-in-Aid (10670473) for scientific research from the Ministry of Education, Science, and Culture and the Foundation for the Promotion of Cancer Research, and Kurozumi Medical Foundation, Japan.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 7/28/04; revised 1/31/05; accepted 2/ 9/05.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Moyzis RK, Buckingham JM, Cram LS, et al. A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the telomeres of human chromosomes. Proc Natl Acad Sci U S A 1988;85:6622–6.[Abstract/Free Full Text]
  2. Paradis V, Dargere D, Laurendeau I, et al. Expression of the RNA component of human telomerase (hTR) in prostate cancer, prostatic intraepithelial neoplasia, and normal prostate tissue. J Pathol 1999;189:213–8.[CrossRef][Medline]
  3. Kopreski MS, Benko FA, Kwak LW, Gocke CD. Detection of tumor messenger RNA in the serum of patients with malignant melanoma. Clin Cancer Res 1999;5:1961–5.[Abstract/Free Full Text]
  4. Chen XQ, Bonnefoi H, Pelte M-F, et al. Telomerase RNA as a detection marker in the serum of breast cancer patients. Clin Cancer Res 2000;6:3823–6.[Abstract/Free Full Text]
  5. El-Serag HB, Mason AC. Rising incidence of hepatocellular carcinoma in the United States. N Engl J Med 1999;340:745–50.[Abstract/Free Full Text]
  6. Shirabe K, Takenaka K, Taketomi A, et al. Postoperative hepatitis status as a significant risk factor for recurrence in cirrhotic patients with small hepatocellular carcinoma. Cancer 1996;15:1050–5.
  7. Dohmen K, Shirahama M, Onohama S, et al. Differences in survival based on the type of follow-up for the detection of hepatocellular carcinoma: an analysis of 547 patients. Hepatol Res 2000;18:110–21.[CrossRef][Medline]
  8. Miura N, Horikawa I, Nishimoto A, et al. Progressive telomere shortening and telomerase reactivation during hepatocellular carcinogenesis. Cancer Genet Cytogenet 1997;93:56–62.[CrossRef][Medline]
  9. Miura N, Shiota G, Nakagawa T, et al. Sensitive detection of hTERT mRNA in the serum of patients with hepatocellular carcinoma. Oncology 2003;64:430–4.[CrossRef][Medline]
  10. Mitas M, Mikhitarian K, Walters C, et al. Quantitative real-time RT-PCR detection of breast cancer micrometastasis using a multigene marker panel. Int J Cancer 2001;93:162–71.[CrossRef][Medline]
  11. Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994;266:2011–5.[Abstract/Free Full Text]
  12. Tatsuma T, Goto S, Kitano S, Lin YC, Lee CM, Chen CL. Telomerase activity in peripheral blood for diagnosis of hepatoma. J Gastroenterol Hepatol 2000;15:1064–70.[CrossRef][Medline]
  13. Ng EK, Tsui NB, Lam NY, et al. Presence of filterable and non filterable mRNA in the plasma of cancer patients and healthy individuals. Clin Chem 2002;48:1212–7.[Abstract/Free Full Text]
  14. Tsui NB, Ng EK, Lo YM. Stability of Endogeneous and added RNA in blood specimens, serum, and plasma. Clin Chem 2002;48:1647–53.[Abstract/Free Full Text]
  15. Wong Ih-N, Leung T, Ho S, Lau WY, Chan M, Johnson PJ. Semiquantification of circulating hepatocellular carcinoma cells by reverse transcriptase polymerase chain reaction. Br J Cancer 1997;76:628–33.[Medline]
  16. Onishi T, Nouso K, Higashi T, et al. Cellular distribution of telomerase reverse transcriptase in human hepatocellular carcinoma. J Gastroenterol Hepatol 2003;18:1168–74.[CrossRef][Medline]
  17. Wege H, Chui MS, Le HT, Strom SC, Zern MA. In vitro expansion of human hepatocytes is restricted by telomere-dependent replicative aging. Cell Transplant 2003;12:897–906.[Medline]
  18. Peng SY, Chen WJ, Lai PL, Jeng YM, Sheu JC, Hsu HC. High {alpha}-fetoprotein level correlates with high stage, early recurrence and poor prognosis of hepatocellular carcinoma: significance of hepatitis virus infection, age, p53 and ß-catenin mutations. Int J Cancer 2004;112:44–50.[CrossRef][Medline]
  19. Okuda H, Nakanishi T, Takatsu K, et al. Clinicopathologic features of patients with hepatocellular carcinomaseropositive for a-fetoprotein-L3 and seronegative for des-g-carboxyprothrombin in comparison with those seropositive for des-g-carboxy prothrombin alone. J Gastroenterol Hepatol 2002;17:772–8.[CrossRef][Medline]
  20. Cavin LG, Romieu-Mourez R, Panta GR, et al. Inhibition of CK2 activity by TGF-ß 1 promotes I{kappa}B-{alpha} protein stabilization and apoptosis of immortalized hepatocytes. Hepatology 2003;38:1540–51.[Medline]
  21. Lin SY, Elledge SJ. Multiple tumor suppressor pathways negatively regulate telomerase. Cell 2003;27;113:881–9.
  22. Takahashi S, Kitamoto M, Takaishi H, et al. Expression of telomerase component genes in hepatocellular carcinoma. Eur J Cancer 2000;36:496–502.
  23. Waguri N, Suda T, Nomoto M, et al. Sensitive and specific detection of circulating cancer cells in patients with hepatocellular carcinoma; detection of human telomerase reverse transcriptase messenger RNA after immunomagnetic separation. Cancer Res 2003;9:3004–11.
  24. Fujita Y, Fujikane T, Fujiuchi S, et al. The diagnostic and prognostic relevance of human telomerase reverse transcriptase mRNA expression detected in situ in patients with non small cell lung carcinoma. Cancer 2003;98:1008–13.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Ann. N. Y. Acad. Sci.Home page
F DASI, P MARTINEZ-RODES, J.A MARCH, J SANTAMARIA, J.M MARTINEZ-JAVALOYAS, M GIL, and S.F ALINO
Real-Time Quantification of Human Telomerase Reverse Transcriptase mRNA in the Plasma of Patients with Prostate Cancer.
Ann. N.Y. Acad. Sci., September 1, 2006; 1075: 204 - 210.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miura, N.
Right arrow Articles by Shiota, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miura, N.
Right arrow Articles by Shiota, G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation