
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Imaging, Diagnosis, Prognosis |
Authors' Affiliations: 1 Division of Pharmacotherapeutics, Department of Pathophysiological and Therapeutic Science, 2 Division of Medicine and Clinical Science, Department of Multidisciplinary Internal Medicine, 3 Division of Molecular and Genetic Medicine, Department of Genetic Medicine and Regenerative Therapeutics, 4 Division of Surgery and Clinical Medicine, Department of Surgery, Tottori University School of Medicine; and 5 Internal Medicine, San-in Labor Welfare Hospital, Yonago, Japan
Requests for reprints: Norimasa Miura, Division of Pharmacotherapeutics, Department of Pathophysiological and Therapeutic Science, Tottori University Schol of Medicine, 86 Nishicho, Yonago, Tottori 683-8503, Japan. Phone: 81-859-34-8014; Fax: 81-859-34-8140; E-mail: mnmiura{at}grape.med.tottori-u.ac.jp.
| Abstract |
|---|
|
|
|---|
Experimental Background: In 64 patients with HCC, 20 with liver cirrhosis, 20 with chronic hepatitis, and 50 healthy individuals, we measured serum hTERT mRNA by using the newly developed real-time quantitative reverse transcription-PCR with SYBR Green I. We examined its sensitivity and specificity in HCC diagnosis, clinical significance in comparison with other tumor markers, and its correlations with the clinical variables by using multivariate analyses.
Results: Serum hTERT mRNA showed higher values in patients with HCC than those with chronic liver diseases. hTERT mRNA expression was shown to be independently correlated with clinical variables such as tumor size, number, and degree of differentiation (P < 0.001, each). The sensitivity/specificity of hTERT mRNA and alpha;-fetoprotein (AFP) mRNA in HCC diagnosis were 88.2%/70.0% for hTERT and 71.6%/67.5% for AFP, respectively. hTERT mRNA proved to be superior to AFP mRNA, AFP, and des-
-carboxy prothrombin in HCC diagnosis. Furthermore, hTERT mRNA in serum was associated with that in HCC tissue.
Conclusions: The usefulness of hTERT mRNA expression in HCC diagnosis and its superiority to conventional tumor markers were shown. Therefore, serum hTERT mRNA is a novel and available marker for HCC diagnosis.
Key Words: hTERT real-time RT-PCR cancer diagnosis hepatocellular carcinoma tumor marker
Hepatocellular carcinoma (HCC) is one of the most common and fatal malignancies associated with hepatitis B virus (HBV) and hepatitis C virus (HCV) infection (5). Although HCC patients undergo medical and surgical treatment for primary tumors, intrahepatic and extrahepatic reccurence frequently limit patient's survival (6). Although the modalities such as ultrasonography and conventional tumor markers are important for detection of HCC (7), they are not still sensitive enough to detect HCC at the early stage.
We previously reported that telomerase was significantly reactivated in HCC, and that in chronic liver diseases such as liver cirrhosis (LC) and chronic hepatitis (CH) it was significantly lower than that in atypical adenomatous hyperplasia and HCC. In this study, we focused on HCC of all malignancies due to the following reasons. First, hTERT mRNA is up-regulated in the multistep process of hepatocarcinogenesis (8). Second, other conventional tumor markers such as
-fetoprotein (AFP) and des-
-carboxy prothrombin (DCP) are widely used in clinical scenes of HCC. In our previous study, we reported that the sensitive method for detecting tumor-derived hTERT mRNA in serum was superior to AFP level for the early detection of HCC patients whose AFP levels were low (9). In the present study, by newly developed quantified detection system of serum hTERT, we mainly focused on the comparison of hTERT mRNA with AFP mRNA, AFP, and DCP for HCC diagnosis because AFP mRNA is the most sensitive marker of the known markers for HCC, and show for the first time that measurement of hTERT mRNA is superior to the conventional tumor markers, such as AFP, DCP, and AFP mRNA, in HCC diagnosis.
| Materials and Methods |
|---|
|
|
|---|
Centrifugation of collected blood and harvesting serum samples were done by using three steps of centrifugation (800 x g with 0.45 µm filtration, 1,000 x g, and 1,500 x g) to decrease lymphocyte to a minimum as previously described (9). To confirm the effective removal of lymphocytes which are contained in serum, CD2, CD3, CD8, CD19, CD22, and CD68 expressions were examined by using ß2-microglobin as an expression control.
To study whether hTERT mRNA in serum is originated and released from HCC in liver, we harvested the surgically resected HCC tissues and sera in 10 HCC patients.
RNA extraction and real-time quantitative reverse transcription-PCR. RNA was extracted with DNase treatment from serum as reported previously (4, 9). RNA from 200 µL of serum was dissolved in 200 µL of H2O. The quantitative reverse transcription-PCR (RT-PCR) was done by using 1 µL of RNA extract and 2 µL of SYBR Green I (Roche, Basel, Switzerland) in a One Step RT-PCR kit (Qiagen, Tokyo, Japan), in which ß2-microglobin RNA was used as a PCR quality control. RNA was extracted from HCC tissues by using the same volume of serum and dried up to 20-fold concentration. RNAs from HCC tissues were extracted using TRIzol Reagent according to the instructions of the manufacturer (Invitrogen Corp., Carlsbad, CA). Primers used in the experiment were as follows (5, 10): (a) for AFP-F, CCAGTAAACCCTGGTGTTGG, and AFP-R, TCTTGCTCATCGTTTGCAG; (b) CD8-F, GGTTGGAGCAGTAGCTGGAG, and CD8-R, TCTGCCAAAGGCAGTTCTCT; (c) CD68-F, ACCAAGAGCCACAAAACCAC, and CD68-R, GGACTGTGAGTGGCAGTTGA; and (d) ß2-microglobin-F, TGAGTGCTGTCTCCATGTTTGA, and ß2-microglobin-R, TCTGCTCCCCACCTCTAAGTTG. The RT-PCR condition was an initial incubation at 50°C for 30 minutes followed by a 12-minute incubation at 95°C, then 50 cycles at 95°C (0 second), 55°C (10 seconds), and 72°C (15 seconds), and a 20-second melting at 40°C. The dynamic ranges of real-time PCR analysis for hTERT mRNA and AFP mRNA were more than 5 copies in this assay and we were able to exclude the possibility of false negativity in serum samples from patients with CH, LC, and controls. The PCR yielded products of 131 bp for hTERT, of 150 bp for AFP, and of 88 bp for ß2-microglobin RNA, respectively (data not shown). The RT-PCR assay was repeated twice and the quantification was confirmed by using LightCycler (Roche) with reproducibility.
Statistical analysis. To examine significant clinicopathologic findings affecting hTERT and other markers, multivariate analysis was done using SPSS II (SPSS Corp., Tokyo, Japan). Stratified categories in each clinical variable were evaluated by multivariate analysis using a logistic regression analysis model. In each tumor marker, we examined the significant difference among liver diseases by multivariate analysis. To examine correlations among hTERT mRNA, AFP mRNA, and conventional tumor markers, we calculated Pearson's relative index. Probability values less than 0.05 were considered to be statistically significant. To assess the accuracy of diagnostic tests, the matched data sets (chronic liver diseases patients and HCC patients) regarding AFP, AFP-L3, DCP, AFP mRNA, and hTERT mRNA were analyzed by using receiver-operator characteristic curve analysis in SPSS-II. This assay showed a strong linear relation between copy number and PCR cycles using RNA controls (r2 > 0.99). A correlation of hTERT mRNA between HCC tissue and serum was analyzed by using both paired t test and Spearman's test.
| Results |
|---|
|
|
|---|
|
|
We examined the factors that change during the progression from chronic liver diseases to HCC by multivariate analysis (Table 2). In the present study, AFP, AFP-L3, and DCP were not able to distinguish HCC from noncancerous liver diseases, however, hTERT mRNA and AFP mRNA were superior to other tumor markers in differentiating HCC from chronic liver disease (P < 0.01, each). Receiver-operator characteristic curve analyses showed that the sensitivity/specificity of hTERT mRNA and AFP mRNA for HCC were 88.2%/68.7% and 70.1%/65.8%, respectively (Fig. 2). Optimal cutoff values for both mRNA expressions were statistically calculated as 12,500 and 3,000 copies/0.2 mL, respectively.
|
|
| Discussion |
|---|
|
|
|---|
We previously reported that hTERT expression was very faint in the serum from normal individuals, indicating that lymphocytes and circulating normal cells express very low level of hTERT mRNA (9). Because hTERT mRNA in lymphocytes is very low, elevated hTERT mRNA in serum may mean that hTERT mRNA is derived from cancer cells. Because we could detect negligible amounts of lymphocyte markers after three steps of centrifugation of blood samples, the RNA extraction procedure seemed to remove lymphocytes effectively. In addition, normal or damaged hepatocytes express negligible amounts of hTERT (16, 17). Furthermore, the correlation of hTERT mRNA between tumor tissue and serum was shown in Fig. 1B. These data suggest that hTERT mRNA detected in serum is derived from tumor cells.
Previously, we reported that qualitative analysis of serum hTERT mRNA was superior to AFP for the early detection of HCC because hTERT mRNA was detectable in HCC patients with normal AFP levels (9). AFP is being widely used as a reliable marker of HCC not in earlier stage but in the advanced stage (18). However, in this study, AFP did not distinguish HCC from noncancerous liver diseases, and hTERT mRNA showed no correlation with AFP level (P = 0.201), suggesting that quantitative analysis of serum hTERT mRNA was much more sensitive for HCC diagnosis even in the early stage. Because the induction of the abdominal ultrasound examination and computed tomography into the clinical scene enabled us to detect smaller-sized HCC, the sensitivity of AFP in the early detection of HCC became less than 70%. Unlike AFP level, AFP mRNA was significantly correlated with hTERT mRNA (P < 0.001) and was more sensitive than AFP. In the present study, we measured AFP-L3 because AFP-L3 has been reported to be a more HCC-specific marker than AFP (19). Indeed, the level of AFP-L3 was significantly correlated with size and number of HCC although that of AFP was not.
In the present study, of 64 HCC patients, eight patients were negative below the calculated cutoff value for serum hTERT mRNA. Although the reason why hTERT mRNA was negative in these patients is not clear, five of eight hTERT mRNA-negative HCC patients had decompensated LC as the underlying disease. It has been reported that decompensated LC had higher levels of serum transforming growth factor ß, which promotes apoptosis of immortalized hepatocytes (20). Therefore, in these cases, elevated transforming growth factor ß may stimulate apoptosis of immortalized cells, resulting in reduction of hTERT mRNA (21). In the other three hTERT mRNA-negative patients, HCC did not progress for a year. In five HCC patients, hTERT mRNA was followed for a year after resection of their HCC. The two patients who had a relapse of HCC showed increased levels of serum hTERT mRNA. The hTERT mRNA levels in two of the other three patients who had no relapse of HCC remained unchanged. The one patient who had no relapse of HCC had an increased level of hTERT mRNA. Although the reason for the increase in hTERT mRNA in this patient is not clear, underlying severe hepatitis may affect the increase.
hTERT mRNA is not only improved in both sensitivity and specificity but has closely correlation with tumor size and number. Because HCC repeatedly recurs polyclonally after any treatment as a biological characteristic, the measurement of serum hTERT mRNA makes it possible to comprehend reccurence or therapeutic effect in detail as well as one-point diagnosis. In this respect, we have to undergo follow-up study after the treatment of HCC. hTERT mRNA expression was found to be closely associated with well to moderate differentiation of HCC. Takahashi et al. (22) previously reported the significant correlation of HCC differentiation with telomerase expression. The results in the present study confirmed their findings. hTERT mRNA showed more sensitivity and specificity compared with AFP mRNA in HCC patients. However, in liver diseases other than HCC, hTERT mRNA was not correlated with AFP mRNA. The higher specificity of hTERT mRNA in HCC may be related to that AFP mRNA is produced in HCC cells and injured hepatocytes and hTERT is produced mainly in HCC cells.
Waguri et al. (23) proved that there exist circulating cancer cells derived from original HCC tissues in blood and they can detect hTERT mRNA in blood. The present study suggests that quantification of hTERT mRNAs in serum has diagnostic implications for HCC. We will evaluate the correlation of prognosis with hTERT mRNA (24) and the availability of hTERT mRNA in other cancers by comparison of hTERT mRNA with other tumor markers, and will study its usefulness for inflammatory diseases in which cellular reactions are active. In the future, a large-scale study may be required to confirm our results for monitoring HCC as well as its detection.
| Footnotes |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 7/28/04; revised 1/31/05; accepted 2/ 9/05.
| References |
|---|
|
|
|---|
-fetoprotein level correlates with high stage, early recurrence and poor prognosis of hepatocellular carcinoma: significance of hepatitis virus infection, age, p53 and ß-catenin mutations. Int J Cancer 2004;112:4450.[CrossRef][Medline]
B-
protein stabilization and apoptosis of immortalized hepatocytes. Hepatology 2003;38:154051.[Medline]
This article has been cited by other articles:
![]() |
L. Terrin, E. Rampazzo, S. Pucciarelli, M. Agostini, R. Bertorelle, G. Esposito, P. DelBianco, D. Nitti, and A. De Rossi Relationship Between Tumor and Plasma Levels of hTERT mRNA in Patients with Colorectal Cancer: Implications for Monitoring of Neoplastic Disease Clin. Cancer Res., November 15, 2008; 14(22): 7444 - 7451. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |