
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Imaging, Diagnosis, Prognosis |
Authors' Affiliations: 1 Digestive Diseases Branch, National Institute of Diabetes and Digestive and Kidney Diseases, 2 Hematopathology Section, Laboratory of Pathology, National Cancer Institute, 3 Metabolic Diseases Branch, National Institute of Diabetes and Digestive and Kidney Diseases, 4 Center for Cancer Research, National Cancer Institute, and 5 Biostatistics and Data Management Section, National Cancer Institute, NIH, Bethesda, Maryland
Request for reprints: Robert T. Jensen, NIH/National Institutes of Diabetes, Digestive and Kidney Diseases/DDB, Room 9C-103, Building 10, 10 Center Drive MSC 1804, Bethesda, MD 20892-1804. Phone: 301-496-4201; Fax: 301-402-0600; E-mail: robertj{at}bdg10.niddk.nih.gov.
| Abstract |
|---|
|
|
|---|
Experimental Design: IGF-I and IGF-IR expression in gastrinomas from 54 patients with Zollinger-Ellison syndrome were analyzed and correlated with clinical/tumor characteristics. IGF-I and IGF-IR mRNA levels were determined by competitive reverse transcription-PCR. IGF-IR expression, assessed by immunohistochemistry, was done on a subset.
Results: IGF-IR mRNA was found in 100% and IGF-I in 89%. IGF-I mRNA expression varied by >254-fold, IGF-IR by 2,670-fold, and the levels correlated in a given tumor. The IGF-IR level was lower in gastrinomas of patients who were rendered disease free and increased levels correlated with tumor growth, aggressiveness, extent, and with liver metastases. Increased IGF-I levels correlated with increased growth, tumor extent, and aggressiveness. Neither IGF-IR nor IGF-I levels correlated with tumor location, size, or its clinical/functional features. The IGF-IR correlated with disease-free survival. IGF-IRß was found in 31 of 32 tumors (97%) by immunohistochemistry.
Conclusions: These results indicate that IGF-I and IGF-IR are expressed in almost all gastrinomas. Furthermore, assessment of IGF-I/IGF-IR expression in gastrinomas may be clinically useful in identifying those patients with more aggressive tumors who might benefit from more aggressive treatment.
Key Words: insulin-like growth factor I gastrinoma pancreatic endocrine tumor carcinoid Zollinger-Ellison syndrome
In contrast to nonendocrine tumors, neither alterations in common oncogenes (ras, myc, etc.) nor alterations in common tumor suppressor genes (retinoblastoma gene, p53) are found in the typical neuroendocrine tumor (7). Alterations in the p16INKa/CDKN2A tumor suppressor gene occur in 17% to 92% (7, 8), and alterations in the MEN1 gene on chromosome 11q13 occur in 16% to 42% of sporadic gastrointestinal neuroendocrine tumors (7, 9). Unfortunately, neither the presence of p16INKa/CDKN2A nor MEN1 gene abnormalities in sporadic neuroendocrine tumors correlates with the aggressiveness of the neuroendocrine tumor (79). Gene abnormalities at the DPC4 locus on 18q21 are reported in 18% to 88% of neuroendocrine tumors as well as in the region of the VHL locus on 3p25, which correlate with neuroendocrine tumor growth in some studies, but not others (7).
Growth factor receptor overexpression is associated with tumor growth and invasiveness in a number of nonendocrine and some endocrine tumors (7, 10, 11). Recently, the level of epidermal growth factor receptor/hepatocyte growth factor receptor expression in gastrinomas was shown to correlate with the presence of liver metastases and decreased curability (12). The epidermal growth factor receptor, even when overexpressed, may require a functional IGF-I receptor to exert its mitogenic/transforming potential (13). Similarly, activation of the platelet-derived growth factor receptor can influence IGF-I gene activity (14). These studies suggest that the presence of IGF-I receptors may be particularly important for mediating growth factor effects on tumor growth.
IGF-IR is a member of the tyrosine kinase receptor superfamily with a 70% homology to the insulin receptor (15). IGF-IR activation can induce numerous cellular effects including differentiation, transformation, and prevention of apoptosis. The activation of the IGF-IR increases tumor growth and up-regulates vascular endothelial growth factor expression, promoting tumor invasion (16, 17). A number of studies show overexpression of IGF-I and/or its receptors by different tumors and that this expression is associated with aggressive growth, decreased survival, or poor prognosis (17). IGF-I and/or IGF-IR are reported in a few studies to be present in some neuroendocrine tumors (7, 1820). In isolated neuroendocrine tumors, IGF-I can stimulate tumor growth (19); however, no correlation has been found between IGF-IR expression in neuroendocrine tumors and tumor aggressiveness in a small number of patients examined in two studies (18, 20). Therefore, it remains unclear whether increased IGF-I/IGF-IR expression in neuroendocrine tumors, including gastrinomas, is associated with increased tumor growth or decreased survival.
| Materials and Methods |
|---|
|
|
|---|
Competitive reverse transcription-PCR. Tumor samples were snap-frozen in liquid nitrogen during surgery or after harvesting and stored at 70°C. Tumor mRNA was extracted from 5-µm cryosections of the gastrinomas after analyzing an adjacent slide to determine that
80% of the section contained tumor tissue as described previously (12). Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Inc., Santa Clarita, CA). Random hexamer-primed first-strand complementary DNA was prepared with RT (RNA PCR Kit; Applied Biosystems, Foster City, CA). After RT, PCR was carried out for amplification of a 301-bp fragment of the human IGF-I or a 208-bp fragment of the IGF-IR. PCR was done in a total volume of 25 µL containing 5 to 10 ng of cDNA, 0.5 microunit DNA-polymerase (Amplitaq Gold, Applied Biosystems), 10x PCR buffer, deoxynucleotides (Applied Biosystems), and gene-specific primers in a DNA thermal cycler (GeneAmp PCR System 9700, PE Applied Biosystems). The conditions for the PCR reactions were the following: initial denaturation at 94°C for 5 minutes was followed by denaturation at 94°C for 40 seconds, annealing at 58°C to 62°C for 40 seconds, depending upon the specific primers (IGF-I: 60°C, IGF-IR: 62°C, and ß-actin: 58°C) and extension at 72°C for 40 seconds. The final elongation step was extended to 5 minutes at 72°C. All reactions underwent 40 amplification cycles. The amplified products were visualized on an agarose gel (Relian Gel system, 4% NuSieve 3:1 agarose, CAMBREX, Rockland, ME).
IGF-I and IGF-IR primers were derived from sequence deposited in Genbank (IGF-I accession no. AY260957 and IGF-IR accession no. AY332722). For each gene, the set of primers used and length of the product were as follows: IGF-I: sense (IGF-Is) 5'-AAAATCAGCAGTCTTCCAAC-3' (IGF-I nucleotides 2,100-2,119) and antisense (IGF-I-as) 5'-AGATCACAGCTCCGGAAGCA-3' (IGF-I nucleotides 62,852-62,871) which span a large intron. IGF-IR: (IGF-IR-s) 5'-GGGGAATGGAGTGCTGTATG-3' (IGF-IR nucleotides 281,072-281,091) and antisense (IGF-IR-as) 5'-AATGGCCACTCTGGTTTCAG-3' (IGF-IR nucleotides 285,766-285,785) which also span a large intron.
To carry out quantitative PCR, both an IGF-I mimic (PCR product, 188 bp) and an IGF-IR mimic (PCR product, 290 bp) were made. For the IGF-I mimic DNA, a fragment of 188 bp was amplified from MEN1 gene (Genbank accession no. BC002544) using a sense primer (MEN1-s) 5'-GAAGATGAAGGGCATGAAGG-3' (MEN1 nucleotides 1,631-1,650), an antisense primer (MEN1-as) of 5'-CCGCTTGAGGAAAGACAGAG-3' (MEN1 nucleotides 1,759-1,778) and the conditions described above. For the preparation of the IGF-IR mimic DNA, a fragment of 290 bp was amplified using a fragment of the human hypoxanthine phosphoribosyltransferase (HPRT) gene (Genbank accession no. M26434). The sense primer (HPRT-s) was 5'-CATTGTAGCCCTCTGTGTGC-3' (HPRT nucleotides 222-241) and an antisense primer (HPRT-as) of 5'-CTGCATTGTTTTGCCAGTGT-3' (HPRT nucleotides 452-471). The product was then amplified using gene-specific primers IGF-I mimic-sense 5'-AAAATCAGCAGTCTTCCAACGAAGATGAAGGGCATGAAGG-3' and antisense 5'-AGATCACAGCTCCGGAAGCACCGCTTGAGGAAAGACAGAG-3' and for the IGF-IR mimic-sense 5'-GGGGAATGGAGTGCTGTATGCATTGTAGCCCTCTGTGTGC-3' and antisense 5'-AATGGCCACTCTGGTTTCAGCTGCATTGTTTTGCCAGTGT-3'. The mimic was gel fractionated and purified using the Wizard PCR Preps DNA Purification System (Promega Co., Madison, WI). The molar concentration of the purified mimic solution was measured by UV absorption at 260 nm. Aliquots were frozen at 20°C.
To allow quantitative correction for any differences in input amounts of total RNA as described previously (26), a quantitative PCR for ß-actin was done on all samples. The PCR conditions were as described previously (26) with a sense primer 5'-CCTCGCCTTTGCCGATCC-3' and an antisense primer, 5'-GGAATCCTTCTGACCCATGC-3'. The PCR product was 204 bp and was only seen when complementary DNA was used as the template because the two primers spanned two introns (26). A ß-actin mimic (PCR product 289 bp; ref. 26) was synthesized as described above for the other mimics using a sense primer 5'-CCTCGCCTTTGCCGATACCCCACGAAGTGTTGGATA-3' and an antisense primer 5'-GGAATCCTTCTGACCCATGCAAGCAGATGGCCACAGAACT-3'.
Competitive PCR was done by amplifying the target complementary DNA in the presence of increasing concentrations of the corresponding mimic with the respective primer pairs (IGF-I-s/as, IGF-IR-s/as, or ß-actin-s/as). The concentration of target complementary DNA was calculated by comparison to the concentration of the mimic, as determined by equal intensity of ethidium bromide staining in a 4% agarose gel. The results of the competitive PCR were expressed as the ratio of the number of molecules of the IGF-I mRNA or IGF-IR mRNA to ß-actin mRNA present.
Differential PCR. DNA was extracted from tumor and blood, using the DNeasy Tissue and QiAmp Blood Kits, respectively (Qiagen), of nine patients with the highest IGF-IR mRNA levels. Differential PCR for IGF-IR gene amplification was done using the method of Frye et al. with comparison with the single copy IFN-
gene (27). Briefly, a 221-bp fragment of the IGF-IR gene was amplified using the following primers: sense TGCTTTTCAGAGACACATG and antisense CCTGTCAACAGAATGGCAT; a 150-bp fragment of the IFN-
gene was produced using the following primers: sense TCTTTTCTTTCCCGATAGGT and antisense CAGGGATGCTCTTCGACCTC (28). Both fragments were amplified in the same vial using the following conditions: initial denaturation at 94°C for 10 minutes was followed by denaturation at 94°C for 1 minute, annealing at 53°C for 1 minute, and extension at 72°C for 1 minute. The final elongation step was extended to 7 minutes at 72°C. All reactions underwent 36 amplification cycles, which were on the linear portion of the product accumulation curve. The amplified products were separated on agarose gels (Relian Gel System, 4% NuSieve 3:1 agarose, CAMBREX), stained with ethidium bromide, and band intensities were measured with an AlphaImager 2200 Analysis Systems (Alpha Innotech Co., San Leandro, CA).
Immunohistochemistry. IGF-IR immunohistochemistry was done on formalin-fixed, paraffin-embedded tissues. Immunohistochemistry against IGF-I was not done because adequate antibodies for paraffin-embedded material are not available. The breast cancer cell line, MCF-7 (American Type Culture Collection, Rockville, MD), which overexpresses IGF-IR (29), was used as a positive control. IGF-IR immunohistochemistry was done on tissue samples from 32 patients who had mRNA levels analyzed by competitive reverse transcription-PCR, in which formalin-fixed gastrinoma tissue was available. Serial sections (5 µm) of gastrinomas were cut, deparaffinized in xylene and rehydrated in a series of graded alcohol. Sections were then incubated for 30 minutes in 3% hydrogen peroxide diluted with methanol (Fisher Chemicals, Fair Lawn, NJ). Antigen retrieval was done by immersing slides in 10 mmol/L sodium citrate buffer (pH 6.0), 900 mL of H2O, and 100 mL of 10x Antigen Retrieval Citra (Biogenex, San Ramon, CA) and placing in a pressure cooker containing water. Slides were microwaved for 8 minutes at maximum power (i.e., 1,300 W) and after making sure to boil it, continued for 15 minutes at 260 W. Sections were blocked in PBS containing 5% normal goat serum (Vector Laboratories, Burlingame, CA) for 20 minutes, and by using the Streptavidin/Biotin Blocking Kit (Vector Laboratories) before incubation with the primary antibody. A rabbit polyclonal anti-IGF-IRß (C-20) antibody was used that was raised against a peptide corresponding to the last 20 amino acid of the NH2 terminus of human IGF-IRß (Santa Cruz Biotechnology, Santa Cruz, CA). Sections were incubated overnight at 4°C with the anti-IGF-IRß antibody diluted 1:750 or 1:1,500 in PBS followed by washing in PBS (3 x 5 minutes) and incubated with biotinylated goat anti-rabbit IgG (Vector Laboratories) diluted 1:200 in PBS for 1 hour. The Vectastain Avidin-Biotin Complex kit (Vector Laboratories) was used for detection with diaminobenzidine tetrahydrochloride (Zymed, San Francisco, CA) as the substrate. Antibody specificity was assessed by preincubating the IGF-IRß antibody with a 5-fold by weight excess of the peptide to which the antibody has been raised. Slides were conterstained with hematoxylin, dehydrated, a coverslip applied and viewed under a light microscope. Distribution of staining was recorded as focal or homogeneous, and staining intensity was graded on an arbitrary four-point scale: 0, no staining; 1+, faint or weak staining; 2+, moderate staining; and 3+, strong staining. For quality control purposes, each staining run included a section of normal pancreas containing islets that was scored as 3+.
Statistical analysis. All values were expressed as mean ± SE. Discontinuous variables were compared using the Fisher exact test or the
2 test, the Mann-Whitney U test (two variables) and for more than two variables, the Kruskal-Wallis test or an ANOVA with the Bonferroni Dunn test as a post hoc test. In tables and figures with multiple tests, Ps < 0.005 were considered significant even after conservative correction.
| Results |
|---|
|
|
|---|
|
|
|
|
|
49 or <49, 0.048 ± 0.016 versus 0.039 ± 0.011 IGF-IR/ß-actin ratio.) Comparison of insulin-like growth factor I and insulin-like growth factor I receptor expression with gastrinoma characteristics. Disease-free status, relapse, liver metastases, presence of a duodenal primary tumor, any primary location or size, or largest tumor size, did not show a significant correlation with the amount of IGF-I mRNA expression in the gastrinomas (Fig. 4, top). However, postoperative gastrinoma growth (P = 0.046), the presence of aggressive disease (P = 0.036), or tumor extent (P = 0.018) were associated with a higher expression of the IGF-I mRNA (Fig. 4, top). Disease-free immediately after resection, the presence of a duodenal tumor, location and size of primary tumor or size of largest tumor found, also did not show a significant correlation with the amount of IGF-IR mRNA expression in the gastrinomas (Fig. 4, top). However, increased postoperative growth (P = 0.0002), aggressive disease (P = 0.0003), the presence of liver metastases (P = 0.0018), increased tumor extent (P = 0.0044) were all associated with a significantly higher expression of the IGF-IR mRNA in the gastrinomas, whereas disease-free status at the time of the study (P = 0.020) and occurrence of a relapse postresection (P = 0.049) also tended toward higher IGF-IR expression (Fig. 4, top).
Prognostic studies: disease-free survival. The IGF-I level did not correlate with disease-free survival (Fig. 4, bottom). Specifically, the 5-year disease-free survival rate postresection in patients with gastrinomas with IGF-I ratios above or below 0.0160 were not significantly different (70% [95% confidence interval, 46-87] versus 69% [95% confidence interval, 44-86], respectively; P = 0.84; Fig. 4, bottom). In contrast, survival was significantly better in patients with gastrinomas with lower IGF-IR levels (Fig. 4, bottom). Specifically, the 5-year survival rate postresection in patients with gastrinomas with IGF-IR levels below or above 0.040 was (92% [95% confidence interval, 65-99] versus 55% [95% confidence interval, 34-75], respectively; P = 0.034; Fig. 4, bottom).
Amplification of the IGF-IR gene. Rarely increased IGF-IR PCR gene copy number has been reported in other tumors (31). To determine whether IGF-IR gene amplification could contribute to the increased mRNA expression in some gastrinomas, we assessed IGF-IR gene copy number in the nine gastrinomas with the highest IGF-IR mRNA levels using differential PCR (Fig. 1, bottom). Differential PCR of IGF-IR compared with the single copy gene, IFN-
(expressed as the IGF-IR/IFN-
ratio), was not significantly different in the gastrinomas compared with the patients' WBC (mean ± 1 SD) 1.75 ± 0.14 versus 1.68 ± 0.24 (Fig. 1, bottom). Furthermore, no gastrinoma showed increased IGF-IR gene amplification over that seen in WBCs (Fig. 1, bottom).
Immunohistochemistry. To examine IGF-IR protein's expression, immunohistochemistry was done using paraffin-embedded tissue from the breast cancer cell line MCF-7, which is known to overexpress IGF-IR (29) as well as normal pancreas, and 32 gastrinomas that had IGF-IR mRNA levels in which formalin-fixed gastrinoma tissue was available. In the MCF-7 cells, strong membranous staining pattern occurred in virtually all of the breast cancer cells (data not shown). In the normal pancreas, some normal islet cells stained strongly, normal acinar cells stained faintly whereas the epithelial cells of the normal pancreatic duct did not stain (Fig. 5A). In 31 of 32 gastrinomas (97%), immunohistochemistry detected IGF-IR. Twenty-seven samples showed a diffuse and homogeneous distribution pattern (Fig. 5E) and four gastrinomas showed a focal staining pattern (Fig. 5B and C). In gastrinomas, the IGF-IR immunostaining was predominantly localized to the cytoplasm, with no staining in the stroma or in the vascular structures (Fig. 5). No significant staining was seen when the IGF-IR antibody was preabsorbed with the IGF-IR peptide to which it had been raised (Fig. 5D and F). In the 27 gastrinomas showing a diffuse and homogeneous distribution pattern, 7 (26%) showed weak staining, 13 (48%) showed moderate staining, and 7 (26%) showed strong staining. In the four gastrinomas showing a focal staining pattern, three (75%) showed strong staining and one (25%) showed moderate staining. Each of the four patients (100%) with focal staining had tumors showing aggressive growth and postoperative tumor growth compared with 10 of 27 patients (37%) who showed diffuse staining (P = 0.032). Furthermore, three of the four patients (75%) with gastrinomas showing an IGF-IR focal staining pattern developed liver metastases, whereas only 5 of the 27 patients (18%) with an homogeneous staining pattern had liver metastases (P = 0.043).
|
| Discussion |
|---|
|
|
|---|
Recent studies report that various growth factors such as those for vascular endothelial growth factor, platelet-derived growth factor, epidermal growth factor, hepatocyte growth factor, and IGF play an important role in growth, progression, and development of metastases by various tumors (7, 10, 11, 15, 32). IGF-I and/or its receptor's expression in various tumors, particularly breast, prostate, colorectal, and lung cancers may be especially important in tumor growth/progression (15, 33). Increased serum levels of IGF-I are reported to be associated with increased risks of breast, prostate, colorectal, and lung cancer (15), and the IGF-IR is reported to play an important role in cell growth, proliferation, DNA synthesis, antidifferentiation, and antiapoptosis in various cancers (15, 33).
Numerous nonendocrine tumors (pancreatic adenocarcinoma, breast cancer, colorectal, and prostate; refs. 3337), and some endocrine tumors (thyroid, adrenocortical, and pheochromocytomas; refs. 3841) produce IGF-I and possess or overexpress IGF-IR. Furthermore, numerous studies show IGF-I and/or IGF-IR activation are mitogens for a wide variety of cancer (33, 34). Expression of IGF-I and/or IGF-IR in various tumors has been reported in some studies to be associated with advanced tumor stage (35, 36, 39), increased tumor size (39), proliferative activity (42), recurrence (43) or metastases (35), and a poor prognosis/survival (31, 42, 44). Other studies have reported no association of IGF-I/IGF-IR with tumor stage (36, 37, 41, 43, 44), size (43), or survival (35, 43).
In general, the expression of IGF-I and/or IGF-IR in neuroendocrine tumors, the effects of activating IGF-IR on neuroendocrine tumor growth, or clinically correlating their presence with tumor behavior, have been investigated in only a few studies involving small numbers of cases. IGF-I or IGF-IR mRNA has been reported in different neuroendocrine tumors (7, 1820, 45, 46), as well as IGF-I synthesis and release by these tumors (19, 45, 47) and the release of the IGF-I has been shown to have an autocrine growth effect on the tumor cells (19, 47). In our study, IGF-IR and IGF-I mRNA were detected in 100% and 89% of gastrinomas, respectively, and IGF-IR protein in 97% using immunohistochemistry. These results have some similarities and differences from other studies on neuroendocrine tumors. We found IGF-I and IGF-IR mRNA in a higher percentage of pancreatic endocrine tumors than the 65% and 71%, respectively, detected by PCR in two studies (18, 20), and the results from four studies of carcinoid tumors (1820, 46) where IGF-I was present in 84% and IGF-IR in 40%. These differences may be partially explained by differences in different neuroendocrine tumors (20). In one recent study (20), IGF-I mRNA was detected by PCR in 89% of gastrinomas, 67% to 70% of insulinomas/gastrointestinal carcinoids, and only 44% of nonfunctional pancreatic endocrine tumors. Furthermore, IGF-IR was detected in 89% to 90% of gastrinomas/insulinomas, 67% of gastrointestinal carcinoids, and 33% of nonfunctional pancreatic endocrine tumors (20). These results raise the possibility that importance of IGF-I/IGF-IR as an autocrine growth in these different neuroendocrine tumors may differ. In other endocrine malignancies, IGF-I and IGF-IR were similarly detected in a high percentage of tumors and frequently overexpressed. Specifically, IGF-I and IGF-IR were detected in 80% to 100% and 92% of undifferentiated/poorly differentiated thyroid tumors (39), respectively; 67% to 100% and 50% to 100% of follicular thyroid cancers (39, 40, 43); 39% to 100% and 42-95% of papillary thyroid cancers (39, 40, 43); 80-100% and 50% of medullary thyroid cancer (46); 57% and 71% of pheochromocytomas (38); and 90% and 75% to 94% of adrenocortical cancers (38, 41). These results are similar to high percentages of some nonendocrine tumors that possess and/or overexpress IGF-IR (breast, lung, bladder, ovarian [88%], prostate [55%], colon [83-99%], pancreatic [57-75%], and gastric [71%]; refs. 34, 35, 37, 42) but differ from the lower percentages found in other nonendocrine tumors (head-neck cancer, salivary gland cancer, renal cell carcinoma [13-14%]; ref. 37).
Our results show that gastrinomas from different patients show a wide variation in the expression with IGF-I and IGF-IR mRNA levels. In follicular and papillary thyroid cancer, IGF-I and IGF-IR levels increases were reported of 2- to 7-fold, in adrenal cortical cancers IGF-IR was increased 3- to 5-fold (38), whereas in pancreatic cancer they were increased by 32- and 4.4-fold, respectively (34). Furthermore, our study showed a high significance (r = 0.66, P < 0.0001) between the level of expression of IGF-I and IGF-IR in a given gastrinoma. This result is similar to reports with adrenocortical cancers (41), breast cancer (48), and prostate cancer (36) but differs from results with pheochromocytomas and adrenal adenomas (41). This high correlation between IGF-I and IGF-IR levels for a given gastrinoma suggests that with some gastrinomas enhanced IGF-IR activation could be mediated by two different processes that could be complementary: overproduction of IGF-I and increased IGF-IR. The mechanism of IGF-IR mRNA overexpression was not examined in detail in this study, although it is clear that similar to other nonendocrine tumors (31), it is not generally due to IGF-IR gene amplification. The mechanisms by which IGF-IR activation might stimulate growth of gastrinomas has not been studied, but in other cells, IGF-IR activation stimulates receptor tyrosine kinase activity which activates distinct transduction cascades including Ras and mitogen-activated protein kinases and phosphoinositol-3-kinase (15, 33, 49).
IGF-I and/or IGF-IR expression are reported in some studies of nonendocrine and a few endocrine tumors (31, 35, 36, 39, 42, 44) but not in other studies (35, 37, 41, 43, 44), to correlate with tumor growth, stage, invasiveness, decreased survival, or other clinical features of the tumor. In two studies involving different pancreatic endocrine tumors (7, 18, 20) and three studies involving carcinoid tumors (7, 1820), the presence or absence of IGF-I and/or IGF-IR did not correlate with tumor aggressiveness. However, in these studies (7, 1820), no quantitative comparisons were done. In the present study, we found that increased IGF-IR mRNA expression in gastrinoma significantly correlated with increased tumor growth, aggressive disease, and increased tumor extent as did IGF-I expression, to a lesser degree. Furthermore, increased IGF-IR levels were associated with the development of liver metastases (P = 0.003) and a lower long-term disease-free rate postresection (P = 0.020). Numerous studies have shown that the development of liver metastases in patients with malignant neuroendocrine tumors, including gastrinomas, is the most important determinant of long-term survival (2, 3, 5, 50). Therefore, our results suggest that if patients with gastrinomas are followed long enough the level of IGF-IR would likely correlate with disease-related survival. An additional finding in our study supporting this conclusion was that lower tumor IGF-IR mRNA levels were associated with a significantly higher disease-free survival rate (P = 0.034).
Neither gastrinoma IGF-IR nor IGF-I mRNA levels correlated with primary tumor location or size (4, 5), fasting serum gastrin levels (51), or disease duration (21), all of which have been shown to have prognostic significance in gastrinomas and/or other neuroendocrine tumors (25). The results with gastrinomas with an association of increased IGF-IR/IGF-I expression with the presence of aggressive disease are similar to reports with some malignant endocrine tumors (papillary thyroid cancer; refs. 39, 43) and nonendocrine tumors [colorectal tumors (35), renal cancer, and breast cancer (44)]. However, these results differ from other studies showing no correlation in the IGF-I/IGF-IR expression and tumor aggressiveness in some nonendocrine tumors (prostate cancer; refs. 36, 42). Furthermore, our results (24) are consistent with animal studies which show that the presence of IGF-IR on various tumors increases invasiveness, metastatic potential, and development of liver metastases (17).
The finding that both IGF-I and IGF-IR mRNA expression levels are related to gastrinoma aggressiveness and that IGF-IR levels are predictive of disease-free survival could have clinical significance. At present, for an individual patient, there are no reliable prognostic factors that predict tumor aggressiveness or recurrence with sufficient certainty to be clinically useful. Therefore, all patients must undergo regular reassessments at frequent intervals including detailed imaging studies to assess possible progression/recurrence. The assessment of IGF-IR mRNA levels in the gastrinoma may allow stratification of patients to different risk levels that could be used to determine risk and allow identification of patients requiring more careful follow-up.
The fact that we find that IGF-I/IGF-IR mRNA expression correlates with aggressive gastrinoma growth and tumor extent and most gastrinomas possess each, raises the possibility that IGF-IR activation could be involved in an autocrine growth function in gastrinomas, similar to that shown in other endocrine (19) and nonendocrine tumors (34). Furthermore, the expression of IGF-I and/or IGF-IR may be important in the development and/or pathogenesis of pancreatic endocrine tumors. IGF-I has been implicated in islet development and differentiation (52). IGF-I increases islet growth (53). Furthermore, elevated levels of IGF-IR have been shown to convey invasiveness and metastatic potential in a mouse model of pancreatic islet tumorigenesis (17). Whether at present the presence of either IGF-I and/or IGF-IR is important in the molecular pathogenesis of human pancreatic endocrine tumors, is at present only speculation. However, with the increased development of possible therapeutic strategies directed against the IGF-IR (10) as well as the effects of such drugs as somatostatin analogues at decreasing IGF-I secretion, the possible involvement of IGF-IR in the molecular pathogenesis of these tumors as well as our findings that expression correlates with tumor aggressiveness, raises the possibility an approach directed against IGF-IR could have therapeutic value in the treatment of these tumors.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received 9/20/04; revised 1/31/05; accepted 2/ 4/05.
| References |
|---|
|
|
|---|
and its receptor in human neuroendocrine tumours. Int J Cancer 1995;60:64551.[Medline]
This article has been cited by other articles:
![]() |
V. Fendrich, R. Ramerth, J. Waldmann, K. Maschuw, P. Langer, D. K Bartsch, E. P Slater, A. Ramaswamy, and M. Rothmund Sonic hedgehog and pancreatic-duodenal homeobox 1 expression distinguish between duodenal and pancreatic gastrinomas Endocr. Relat. Cancer, June 1, 2009; 16(2): 613 - 622. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Grozinsky-Glasberg, I. Shimon, M. Korbonits, and A. B Grossman Somatostatin analogues in the control of neuroendocrine tumours: efficacy and mechanisms Endocr. Relat. Cancer, September 1, 2008; 15(3): 701 - 720. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Martins, J. L. Ordonez, A. Garcia-Sanchez, D. Herrero, V. Sevillano, D. Osuna, C. Mackintosh, G. Caballero, A. P. Otero, C. Poremba, et al. A Pivotal Role for Heat Shock Protein 90 in Ewing Sarcoma Resistance to Anti-Insulin-like Growth Factor 1 Receptor Treatment: In vitro and In vivo Study Cancer Res., August 1, 2008; 68(15): 6260 - 6270. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Long, M. J. Berna, M. Thill, A. Pace, T. K. Pradhan, K. M. Hoffmann, J. Serrano, and R. T. Jensen Secretin-Receptor and Secretin-Receptor-Variant Expression in Gastrinomas: Correlation with Clinical and Tumoral Features and Secretin and Calcium Provocative Test Results J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4394 - 4402. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Samani, S. Yakar, D. LeRoith, and P. Brodt The Role of the IGF System in Cancer Growth and Metastasis: Overview and Recent Insights Endocr. Rev., February 1, 2007; 28(1): 20 - 47. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Hoffmann, J. A. Tapia, M. J. Berna, M. Thill, T. Braunschweig, S. A. Mantey, T. W. Moody, and R. T. Jensen Gastrointestinal Hormones Cause Rapid c-Met Receptor Down-regulation by a Novel Mechanism Involving Clathrin-mediated Endocytosis and a Lysosome-dependent Mechanism J. Biol. Chem., December 8, 2006; 281(49): 37705 - 37719. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Martins, C. Mackintosh, D. H. Martin, M. Campos, T. Hernandez, J.-L. Ordonez, and E. de Alava Insulin-Like Growth Factor I Receptor Pathway Inhibition by ADW742, Alone or in Combination with Imatinib, Doxorubicin, or Vincristine, Is a Novel Therapeutic Approach in Ewing Tumor. Clin. Cancer Res., June 1, 2006; 12(11): 3532 - 3540. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |