Clinical Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dziadziuszko, R.
Right arrow Articles by Hirsch, F. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dziadziuszko, R.
Right arrow Articles by Hirsch, F. R.
Clinical Cancer Research Vol. 12, 3078-3084, May 15, 2006
© 2006 American Association for Cancer Research


Cancer Therapy: Clinical

Epidermal Growth Factor Receptor Messenger RNA Expression, Gene Dosage, and Gefitinib Sensitivity in Non–Small Cell Lung Cancer

Rafal Dziadziuszko1,2, Samir E. Witta1, Federico Cappuzzo1,3, Seongjin Park4, Koji Tanaka5, Peter V. Danenberg6, Anna E. Barón1, Lucio Crino3, Wilbur A. Franklin1, Paul A. Bunn, Jr.1, Marileila Varella-Garcia1, Kathleen D. Danenberg7 and Fred R. Hirsch1

Authors' Affiliations: 1 University of Colorado Health Sciences Center and University of Colorado Cancer Center, Aurora, Colorado; 2 Medical University of Gdansk, Gdansk, Poland; 3 Bellaria Hospital, Bologna, Italy; 4 Tokyo Medical and Dental University, Tokyo; 5 Mie University School of Medicine, Mie, Japan; 6 University of Southern California; and 7 Response Genetics, Inc., Los Angeles, California

Requests for reprints: Fred R. Hirsch, University of Colorado Cancer Center, P.O. Box 6511, Mail Stop 8111, Aurora, CO 80045. E-mail: Fred.Hirsch{at}UCHSC.edu.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Purpose: Epidermal growth factor receptor (EGFR) mRNA expression and EGFR gene dosage by quantitative PCR in tumor samples obtained from patients with gefitinib-treated non–small cell lung cancer were analyzed in order to determine the association with treatment outcome, clinical, and biological features [EGFR copy number by fluorescent in situ hybridization (FISH), EGFR tyrosine kinase mutations, and EGFR protein expression].

Experimental Design: EGFR mRNA expression was measured by real-time quantitative reverse transcription-PCR in 64 patients, and EGFR gene dosage was analyzed by real-time quantitative PCR in 82 patients from paraffin-embedded specimens.

Results: EGFR mRNA expression was higher in responders to gefitinib as compared with nonresponders (P = 0.012). Patients with high EGFR mRNA expression (>5.01) had 43% response probability, whereas patients with low EGFR mRNA expression had 8% response probability (P = 0.006). Patients with high EGFR mRNA expression had longer median progression-free (5.3 versus 2.8 months, P = 0.028) but not overall survival (13.8 versus 10.9 months, P = 0.87). EGFR mRNA expression was higher in FISH-positive patients (P = 0.001) and in patients with positive EGFR immunostaining (P < 0.001) but not in patients with EGFR mutations (P = 0.19). EGFR gene dosage did not predict response (P = 0.54), progression-free (P = 0.73), or overall survival (P = 0.89). EGFR gene dosage was not associated with FISH positivity (P = 0.15), relative mRNA expression (P = 0.27), EGFR mutation status (P = 0.39), and EGFR protein expression (P = 0.35).

Conclusion: EGFR mRNA expression is a predictive biomarker for response to gefitinib and to progression-free survival after gefitinib treatment. EGFR gene dosage is neither predictive for response nor progression-free nor overall survival.


Novel therapeutic options in non–small cell lung cancer (NSCLC) include epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKI), such as gefitinib and erlotinib (1, 2). Erlotinib produced a significant survival advantage compared with placebo in a randomized phase III trial, but 30% of patients in each arm died in the first 3 months with no evidence for benefit in at least this fraction of patients (3). Thus, the search for an optimal selection of patients who will benefit from these treatments remains important. Patient selection based on clinical favorable variables is not sufficient, as some survival benefit was observed in groups with low response rates such as males and squamous cell histologies (3, 4). Thus, selection based on molecular markers may be more promising.

EGFR gene copy number, EGFR mutation status, and protein expression have been evaluated for their prediction of response to EGFR TKIs. In previous studies from our group, high EGFR copy number evaluated by fluorescent in situ hybridization (FISH) correlated with improved response and survival of NSCLC patients treated with gefitinib (5, 6). These findings were confirmed in subgroup analyses of two phase III clinical studies, comparing erlotinib (BR.21 trial; ref. 7) or gefitinib (ISEL trial; ref. 8) with placebo in second- or third-line treatment of advanced NSCLC. In the NCIC BR.21 trial, the positive treatment effect of erlotinib was confined to the EGFR FISH-positive as compared with the FISH-negative group of patients, both in terms of response rate (20% versus 2%, respectively) and survival (hazard ratios of 0.44 versus 0.85, respectively; ref. 7). Biomarker analyses from the ISEL trial confirmed these results (response rates of 17.5% versus 3.4% and hazard ratios of 0.61 versus 1.14 in EGFR FISH-positive versus FISH-negative patients, respectively; ref. 8).

Mutations of EGFR TK domain are associated with increased responsiveness to EGFR TKIs (5, 915). There are conflicting data reported on the association of EGFR TK activating mutations and survival advantage from gefitinib or erlotinib, especially in Western NSCLC populations. In the BR.21 study, the hazard ratio of death was almost identical for patients with mutated and wild-type EGFR (0.73 and 0.77, respectively; ref. 7). In contrast to this prospective trial, several retrospective studies showed prolonged survival in gefitinib-treated patients, mostly in Asian populations (1215).

There are also conflicting data on whether EGFR gene dosage evaluated by quantitative PCR (qPCR) is associated with outcome following gefitinib or erlotinib therapy, and there are no data reported on a direct comparison of predictive value of FISH versus qPCR for clinical outcome in lung cancer. Bell and colleagues recently published data on a large number of gefitinib-treated patients participating in IDEAL and INTACT studies (16). They did EGFR gene dosage analysis by qPCR and compared the results with mutation status, protein expression, and patient outcome. No predictive significance of EGFR gene dosage for treatment benefit was found. Another study noted increased response rate and prolonged progression-free but not overall survival in patients with high EGFR gene dosage who were treated with gefitinib (14).

Apart from the present cohort of patients, we are aware of only one study published on EGFR mRNA expression in relation to other biomarkers and outcome of gefitinib-treated patients (15). In this study, EGFR mRNA expression analysis was limited to 28 patients. EGFR-mutant patients had a tendency towards higher mRNA expression, but response and survival data according to EGFR mRNA expression were not evaluated.

In the present report, we evaluated EGFR mRNA expression and gene dosage by qPCR technique and compared these results with our previously published data on EGFR mutations, EGFR copy number by FISH, and EGFR protein expression by immunohistochemistry (5). We also analyzed these data with regard to patients' clinical characteristics, objective response rate, disease control rate, and progression-free and overall survival.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Patient selection, tissue sample collection, and previously analyzed molecular markers. The cohort included 102 patients with advanced NSCLC previously evaluated for EGFR status (5). Eligibility included histologically confirmed NSCLC with measurable, locally advanced or metastatic disease, progressing or relapsing after chemotherapy, or medical contraindications for chemotherapy. Gefitinib was given at a dose of 250 mg daily and patients were evaluated by computer tomography for tumor response after 2 months according to the Response Evaluation Criteria in Solid Tumors guidelines (17). The methodology of FISH, EGFR mutation analysis, and protein expression assessment has been previously described in detail (5). Briefly, FISH-negative samples were defined as those with no or low gene copy number (≥four copies of the gene per cell in <40% of cells) and FISH-positive samples were defined as those with high gene copy number (≥four copies of the gene per cell in ≥40% of cells) or amplification (tight gene clusters and a ratio of gene/chromosome per cell ≥2 or ≥15 gene copies per cell in ≥10% of the cells). For EGFR mutation analysis, genomic DNA was amplified by touchdown heminested PCR for exons 18, 19, and 21 and sequenced in both sense and antisense directions (~90% of EGFR mutations are located in these exons; ref. 18). Protein expression was defined by multiplying the percentage of positive cells by staining intensity. The total protein expression was scored by two independent pathologists and ranged from 0 to 400. For statistical analysis, scores of 0 to 199 were regarded as immunohistochemistry negative, whereas scores of 200 to 400 were regarded as immunohistochemistry positive.

Tissue preparation, laser capture microdissection, EGFR RNA and DNA extraction, qPCR, and quantitative reverse transcription-PCR. Paraffin-embedded tumor blocks were reviewed for quality and tumor content and 5-µm-thick sections were obtained. Sections were mounted on uncoated glass slides deparaffinized in xylene, hydrated and stained with nuclear fast red (American MasterTech Scientific Inc., Lodi, CA) for tumor cell visualization. Microdissection was not done in 22 cases in which the proportion of tumor cells was abundant. The remaining samples were isolated by laser capture microdissection (PALM Microsystem; Leica, Wetzlar, Germany) according to the standard procedure (19). RNA isolation after dissection was done according to a proprietary procedure of Response Genetics, Inc., (U.S. patent no. 6248535). Complementary DNA was prepared as described previously (20). Quantification of the genes of interest and an internal reference gene (ß-actin) was conducted using a fluorescence-based real-time detection method [ABI PRISM 7700 Sequence Detection System (TaqMan); Perkin-Elmer Applied Biosystems], as previously described (21). Cycling conditions were 50°C for 10 seconds and 95°C for 10 minutes, followed by 46 cycles at 95°C for 15 seconds and 60°C for 1 minute. EGFR expression was analyzed using forward primer EGFR-1753F, 5'-TGCGTCTCTTGCCGGAAT-3; reverse primer EGFR-1823R, 5'-GGCTCACCCTCCAGAAGGTT-3'; and TaqMan probe EGFR-1773Tc, 5'-ACGCATTCCCTGCCTCGGCTG-3'. EGFR RNA expression values (also referred to as relative mRNA expression) were calculated as ratios (differences between the Ct values) between EGFR and ß-actin, that provides a normalization factor for the amount of RNA isolated from a specimen. ß-Actin primers were: forward primer, 5'-GAGCGCGGCTACAGCTT-3; reverse primer, 5'-TCCTTAATGTCACGCACGATTT-3'; and TaqMan probe, 5'-ACCACCACGGCCGAGCGG-3'. For EGFR gene dosage evaluation, DNA was extracted using the QIAamp kit (Qiagen, Valencia, CA). Selected EGFR regions were evaluated by real-time PCR using the following primers: forward primer dEGFR-144394F, 5'-CGTCTCTTGCCGGAATGT-3'; reverse primer dEGFR-144479R, 5'-GGATTAAAGAAATAACCTCCTACCC-3'; and TaqMan probe, dEGFR-144412Tc, ACGCATTCCCTGCCTCGGCTG (GenBank accession no. AY588246).

Statistical analyses. All continuous variables were not normally distributed, as assessed by Kolmogorov-Smirnov test. Qualitative variables were compared by Pearson's {chi}2 test or Fisher's exact test, where appropriate. Groups of continuous variables were compared using Mann-Whitney U test or Kruskal-Wallis test, where appropriate. Median values of mRNA expression and EGFR gene dosage by qPCR were used to compare these biomarkers with clinical patient characteristics. Because we found a difference between mRNA expression in responding and nonresponding patients, we subsequently used the response data to select the best cutoff value and dichotomize patients into groups with low and high EGFR mRNA expression using a receiver-operating characteristic curve and the Youden index (≤5.01, low EGFR expression; >5.01, high EGFR expression; ref. 22). Because there was no relation between EGFR gene dosage and response, we used the median value of 0.36 (≤0.36, low EGFR gene dosage; >0.36, high EGFR gene dosage) in all comparisons. To assess the association between quantitative variables, nonparametric Spearman's correlation was used. The Kaplan-Meier method was used for survival analysis and the log-rank test for univariate comparisons. Additionally, univariate Cox proportional model was fit to assess the influence of relative EGFR expression and gene dosage as continuous variables on progression-free and overall survival. Multivariate analysis was done with backward manual elimination based on likelihood-ratio statistics. All variables met the assumption of proportional hazards using the supremum test (23). The SPSS 13.0 statistical package (Chicago, IL) was used for calculations. SAS V9.3 was used to assess the proportional hazard assumption. A significance level of 0.05 was used for hypothesis testing. All reported P values are two-sided.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Patient population. From the original cohort of 102 patients, 10 pretreatment paraffin-embedded biopsies were not available, 23 samples did not contain enough tumor tissue for accurate measurement, and 5 samples had sufficient area of tumor, but failed to provide enough mRNA after extraction for EGFR mRNA expression analysis. Thus, paraffin-embedded samples yielded sufficient mRNA quantity in 64 patients who were included in the analysis of EGFR mRNA expression (70% of available samples and 93% of samples of acceptable quality for mRNA testing).

For EGFR gene dosage assessment by qPCR, two biopsies were not available and 18 had an insufficient amount of tumor cells from the original cohort of 102 samples, leaving 82 specimens. This group included 56 males (68%) and 26 females (32%), 70 patients with stage IV (85%) and 12 patients with stage III NSCLC (15%), 37 patients with performance status 0 according to WHO (45%), 32 patients with WHO performance status 1 (39%) and 13 patients with WHO performance status 2 (16%). There were 69 current or former smokers ("ever-smokers", 84%) and 13 never-smokers (16%), the median age was 62 years (range, 25-83 years). Adenocarcinoma was the most prevalent histologic diagnosis (53 patients, 65%; including 7 patients with bronchioalveolar features), followed by squamous cell carcinoma (20 patients, 24%), undifferentiated NSCLC (8 patients, 10%), and large cell carcinoma (1 patient, 1%). Eighty patients (98%) were evaluable for response and 9 (11%) were classified with response.

Clinical characteristics and survival of subgroups analyzed for relative mRNA expression and for EGFR gene dosage were similar to the initial population (data not shown).

EGFR mRNA expression assessed by quantitative reverse transcription-PCR. Relative EGFR mRNA expression was detectable by qRT-PCR (quantitative reverse transcription-PCR) in all 64 samples that were available for the analysis. The median EGFR mRNA expression was 1.98 (range, 0.17-28.27). Patient characteristics according to median relative EGFR mRNA expression are shown in Table 1 . There was no association between EGFR mRNA expression and gender, histology, performance status, smoking history, stage or age.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical patient characteristics according to median relative EGFR mRNA expression and median EGFR gene dosage

 
Evaluable patients who responded to gefitinib (n = 10) had significantly higher median relative EGFR mRNA expression as compared with nonresponders (n = 52; 5.14 versus 1.68, P = 0.012). Patients with EGFR mRNA expression >5.01 (the threshold value identified by receiver-operating characteristic analysis) had a 43% probability of response (6 of 14 patients), whereas patients with EGFR mRNA expression ≤5.01 had an 8% response probability (4 of 48 patients, P = 0.006). Disease control probabilities in these subsets were 57% and 38%, respectively (P = 0.19). In the analyzed population, response probabilities for EGFR FISH-positive and FISH-negative patients were 41% and 2%, and for mutant and wild-type EGFR patients were 50% and 6%, respectively.

In the univariate analysis, high EGFR mRNA expression (>5.01) was associated with longer median progression-free survival as compared with low EGFR mRNA expression (5.3 versus 2.8 months, respectively; log-rank, P = 0.028; Fig. 1A ). This difference was not significant when mRNA expression was analyzed as a continuous variable in the univariate Cox regression model (P = 0.25). There was no difference in overall survival with regard to EGFR mRNA expression analyzed as dichotomized (median, 13.8 versus 10.9 months for patients with high and low expression, respectively; log-rank, P = 0.87) or as a continuous variable (P = 0.66). Objective response probability, progression-free survival, and overall survival data according to EGFR mRNA expression are summarized in Fig. 1A and B. In the multivariate progression-free survival model which included EGFR mRNA expression, clinical variables (age, gender, histology, performance status, and stage), and other biomarkers (EGFR copy number by FISH, EGFR mutations, and EGFR protein expression), high relative mRNA expression was not significant after adjusting for other covariates. This model is, however, difficult to interpret due to the relatively small number of patients with correlated biomarker data.


Figure 1
View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. Progression-free survival (A) and overall survival (B) according to relative EGFR mRNA expression.

 
Median relative mRNA expression was significantly different between FISH-positive (n = 22) and FISH-negative patients (n = 42; 5.02; range, 0.2-28.3, and 1.44; range, 0.2-28.3, respectively, P = 0.001).

In the group of 64 patients with known EGFR mRNA expression, there were 50 patients with wild-type EGFR, and 14 patients with tumors having EGFR mutations; 7 patients with exon 19 deletion, and 7 patients with exon 21 point mutations. Median relative EGFR mRNA expression tended to be higher in patients with exon 19 deletions (4.0; range, 0.6-21.6) as compared with wild-type EGFR (1.9; range, 0.2-28.3) or exon 21 mutations (0.8; 0.3-8.5; P = 0.19; Table 2 ). We subsequently analyzed the outcome of 14 EGFR-mutant patients according to relative EGFR mRNA expression and the response to gefitinib. In seven nonresponding patients, median relative EGFR mRNA expression was 0.8 (range, 0.3-5.2) as compared with 5.3 (range, 0.7-21.6) in seven patients who responded to gefitinib (P = 0.025). Patients with EGFR mutations (n = 5) and high mRNA expression had a median progression-free survival of 19.7 months (95% confidence interval, 0-44.1 months), whereas patients with EGFR mutations and low mRNA expression (n = 9) had a median progression-free survival of 4.0 months (95% confidence interval, 0-9.7 months), similar to 48 patients with wild-type EGFR (2.9 months; 95% confidence interval, 2.0-3.8 months; P = 0.016 for comparison of patients with mutant EGFR/high EGFR mRNA expression versus mutant EGFR/low EGFR mRNA expression and wild-type EGFR; Fig. 2 ). There was no difference in overall survival of patients with mutant EGFR/high relative EGFR mRNA expression, mutant EGFR/low EGFR mRNA expression, and wild-type EGFR (P = 0.55; results not shown).


View this table:
[in this window]
[in a new window]
 
Table 2. Correlations among analyzed biomarkers

 

Figure 2
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Progression-free survival according to relative EGFR mRNA expression in EGFR wild-type and mutant patients. Log-rank P value indicates comparison between EGFR-mutant patients with high mRNA expression versus EGFR-mutant patients with low mRNA expression and EGFR wild-type patients.

 
Tumors with positive EGFR immunostaining (≥200, n = 42) had higher mRNA expressions compared to tumors with low or negative immunostaining (<200, n = 22; median, 3.3 and 1.4, respectively; P = 0.012; results not shown). The correlation between EGFR protein and mRNA expression was also significant when both variables were considered to be continuous (Spearman's r = 0.46; P < 0.001; Table 2).

EGFR gene dosage assessed by qPCR. EGFR gene dosage was analyzed by qPCR in 82 patients. Median EGFR gene dosage was 0.36 (range, 0-4.51). Patient characteristics according to median EGFR gene dosage are shown in Table 1. There was no association of EGFR gene dosage with the analyzed clinical variables except for age. Patients with EGFR gene dosage >0.36 were younger as compared to patients with EGFR gene dosage ≤0.36 (median age, 58 versus 66 years, respectively; P = 0.031).

In a group of 82 patients, there were 80 patients evaluable for response. EGFR gene dosage did not differ between patients who responded to gefitinib and nonresponders (median, 0.36 and 0.34, respectively; P = 0.54; results not shown). There was no difference in EGFR gene dosage between patients who achieved disease control as compared with patients with progressive disease (median, 0.36 and 0.34, respectively; P = 0.95; results not shown). We used median relative EGFR gene dosage (≤0.36 versus >0.36) for comparisons in the response and survival analysis. Response rates in evaluable patients with high (n = 41) versus low EGFR dosage (n = 39) were 12% versus 10%, respectively (P = 0.78). Progression-free survival was the same in patients with low and high EGFR dosage (median of 2.8 months in each group, P = 0.73; Fig. 3A ). There was no difference in overall survival in patients with low and high EGFR gene dosage (median, 9.4 and 11.3 months, respectively; P = 0.89; Fig. 3B). There was no association between EGFR gene dosage, progression-free survival, and overall survival when gene dosage was entered as a continuous variable in the univariate Cox model (P = 0.072 and P = 0.52, respectively).


Figure 3
View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. Progression-free survival (A) and overall survival (B) according to relative EGFR gene dosage.

 
The median EGFR gene dosage was 0.40 (range, 0-4.51) in the FISH-positive group (n = 24) as compared with 0.36 (range, 0-1.58, P = 0.15) in the FISH-negative group of patients (n = 58, Table 2).

EGFR mutations were present in 13 of 82 patients (16%), including seven deletions in exon 19 and six point mutations in exon 21. Median relative EGFR gene dosage was nonsignificantly higher in patients with exon 19 deletions (0.54; range, 0-4.51) as compared with wild-type EGFR (0.35; range, 0-3.13) or exon 21 mutations (0.29; range, 0.17-2.05; P = 0.39; Table 2). In the subset of EGFR-mutant, nonresponding patients (n = 7), median EGFR gene dosage was 0.37 (range, 0.17-0.69) as compared with 1.01 (0-4.51) in six patients who responded to gefitinib (P = 0.22). Five of six patients who responded to gefitinib were FISH-positive, whereas only two of seven nonresponders were scored as FISH-positive (P = 0.10).

There was no statistically significant correlation between EGFR gene dosage and protein expression, when the latter was analyzed as categorical (P = 0.23; results not shown) or continuous variables (Spearman's r = 0.11, P = 0.35; Table 2). There was no significant correlation between EGFR gene dosage evaluated by qPCR and relative EGFR mRNA expression (Spearman's r = 0.14, P = 0.27; Table 2).


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
In two randomized phase III trials comparing placebo to erlotinib (7) or to gefitinib (8), various biological markers were evaluated to compare clinical outcomes. In both studies, the EGFR copy number by FISH was the best predictor of survival. Several large phase II or retrospective studies came to similar conclusions (5, 6). The FISH positivity seems to be purely predictive and not prognostic because FISH-positive and FISH-negative patients receiving placebo have similar rates of survival (in the ISEL study, median survival in FISH-positive patients was 4.5 months and 6.2 months for FISH-negative patients; ref. 8) and because another study showed a tendency for shorter survival in FISH-positive patients diagnosed with stage I to III NSCLC (24).

There are fewer data on the relationship between EGFR TKI treatment outcome, EGFR mRNA expression, and gene dosage determined by qPCR assessment. In the current study, we showed that EGFR mRNA expression evaluated by qRT-PCR from paraffin-embedded tumor tissue is a predictive marker for response to gefitinib and for progression-free survival. The response rates in patients with high and low EGFR mRNA expression (43% and 10%, respectively) were comparable with the information obtained by EGFR FISH (41% and 2%, respectively) and EGFR mutation analysis (50% and 6%, respectively). Multivariate analysis shows that the predictive value of EGFR mRNA expression is lost when other biomarkers are included (EGFR immunohistochemistry, FISH, and mutations). However, this model is difficult to interpret due to the relatively small group of patients with highly correlated covariates. We have also shown that EGFR-mutant patients who respond to gefitinib have significantly higher EGFR mRNA expression than nonresponders. Moreover, progression-free survival of EGFR-mutant patients with high mRNA expression was significantly longer than EGFR-mutant patients with low EGFR mRNA expression and patients with wild-type EGFR, implicating that effective transcription is needed for effective treatment in EGFR-mutant patients, and mRNA expression may add valuable information to EGFR mutation status if the latter is considered for patient selection, as may be the case in Asian populations. To our knowledge, these associations have not been reported previously.

The predictive value of EGFR mRNA expression has been addressed, according to our best knowledge, only sporadically. In a recent report by Taron et al., the analysis of EGFR mRNA expression was done in a subset of 28 patients from a cohort of 68 patients who were analyzed for EGFR mutations (15). Similarly to our report, this study showed a tendency towards higher EGFR mRNA expression in EGFR-mutant as compared with wild-type patients, but the response and survival data according to mRNA expression were not reported.

The high level of EGFR mRNA expression in tumors is dependent on several molecular events. We have shown that high EGFR mRNA expression correlated with increased EGFR gene copy number, as evaluated by FISH. A similar correlation was reported by Bhargava et al. in breast cancer (25). Both mRNA expression analysis and FISH could be successfully applied in paraffin-embedded tissue. FISH analysis is available in many diagnostic laboratories; mRNA expression evaluation often requires tissue microdissection and validation of "positive" versus "negative" cutoff points, but is less costly and could potentially be done as a high-throughput method. Moreover, HER2 gene dosage by qPCR and HER2 mRNA expression by qRT-PCR have been proposed as alternative methods of HER2 testing with potential clinical applications in breast cancer (26, 27). At present, routine use of gene dosage analysis by qPCR is limited by the lack of standardization regarding the choice, measurement of the reference genes, and the potential to amplify nontumor DNA.

Evaluation of EGFR gene dosage as a predictive marker for response to EGFR TKIs was addressed by Takano et al. (14) in a group of 66 NSCLC patients treated with gefitinib for relapse after surgery. EGFR dosage was evaluated after tumor microdissection by real-time duplex PCR using RNaseP as the endogenous reference gene. In the latter study, increased EGFR gene dosage was associated with higher response rate to gefitinib and longer time-to-progression in univariate and multivariate analysis. Bell and colleagues successfully analyzed EGFR dosage by qPCR in 90 patients who participated in two IDEAL phase II studies and in 453 patients who participated in two INTACT phase III studies that compared chemotherapy and gefitinib to chemotherapy and placebo (16). The frequency of gene amplification by qPCR was 8% in IDEAL and 7% in INTACT studies, a result markedly different from ~30% of FISH-positive patients observed in the University of Colorado Cancer Center studies (5, 6, 8). Differences in the definition of gene amplification in the study of Bell and colleagues does not allow for a direct comparison of their results with our findings. In the INTACT studies, EGFR amplification was not predictive of treatment benefit, i.e., was not associated with better progression-free or overall survival in patients receiving chemotherapy and gefitinib as compared with chemotherapy and placebo. Patients with EGFR-amplified tumors had longer overall and progression-free survival irrespective of gefitinib treatment, suggesting that gene amplification analyzed by qPCR may be a positive prognostic factor in NSCLC.

Contrary to the findings of Takano et al. (14), we could not establish any association between EGFR gene dosage evaluated by qPCR and gefitinib treatment outcome in our series of patients. The reason of this discrepancy is unclear. However, it is likely that the proportion of patients with high EGFR gene dosage is larger in Japanese versus Western NSCLC patients (14, 16), and thus progression-free advantage could more easily be detected in patients with high EGFR gene dosage from Far East. In the study of Bell and colleagues (16), high EGFR gene dosage was not predictive of gefitinib treatment benefit, but indicated better prognosis of patients regardless of treatment received. Much larger sample size would be needed in our study to detect a survival difference of this magnitude.

We did not find a significant correlation between FISH positivity according to University of Colorado Cancer Center scoring criteria and EGFR gene dosage by qPCR. The two measurements are related to the same process—EGFR gene quantification, but their results yield different information and cannot be interchangeably used. Potential reasons for this discrepancy include the direct measurement of gene copy numbers in single tumor cells by FISH, which cannot be achieved by qPCR even when microdissection is done, and relative measurement of EGFR gene dosage to the reference gene, with no guarantee that the reference gene is always diploid and not amplified or deleted.

It can be concluded from the current study that high EGFR mRNA expression analyzed by qRT-PCR is associated with increased response to gefitinib and prolonged progression-free survival. Our study supports further evaluation of EGFR mRNA expression as a biomarker of sensitivity for EGFR TKIs in larger data sets. In contrast to EGFR gene copy number assessed by FISH, we could not show any predictive value of EGFR gene dosage by qPCR for response or survival.


    Footnotes
 
Grant support: National Cancer Institute grants Cancer Center Core Grant 2P30-CA46934 and Specialized Program of Research Excellence P01-CA58187. R. Dziadziuszko was supported by a National Cancer Institute-International Union Against Cancer Translational Cancer Research Fellowship, funded by National Cancer Institute. F. Cappuzzo was supported by the Department of Oncology, Bellaria Hospital, Bologna, Italy, and by the Italian Association for Cancer Research grant 2881.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 1/17/06; revised 3/12/06; accepted 3/14/06.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fukuoka M, Yano S, Giaccone G, et al. Multi-institutional randomized phase II trial of gefitinib for previously treated patients with advanced non-small-cell lung cancer (the IDEAL 1 trial). J Clin Oncol 2003;21:2237–46.[Abstract/Free Full Text]
  2. Kris MG, Natale RB, Herbst RS, et al. Efficacy of gefitinib, an inhibitor of the epidermal growth factor receptor tyrosine kinase, in symptomatic patients with non-small cell lung cancer: a randomized trial. JAMA 2003;290:2149–58.[Abstract/Free Full Text]
  3. Shepherd FA, Rodrigues PJ, Ciuleanu T, et al. Erlotinib in previously treated non-small-cell lung cancer. N Engl J Med 2005;353:123–32.[Abstract/Free Full Text]
  4. Thatcher N, Chang A, Parikh P, et al. Gefitinib plus best supportive care in previously treated patients with refractory advanced non-small-cell lung cancer: results from a randomised, placebo-controlled, multicentre study (Iressa Survival Evaluation in Lung Cancer). Lancet 2005;366:1527–37.[CrossRef][Medline]
  5. Cappuzzo F, Hirsch FR, Rossi E, et al. Epidermal growth factor receptor gene and protein and gefitinib sensitivity in non-small-cell lung cancer. J Natl Cancer Inst 2005;97:643–55.[Abstract/Free Full Text]
  6. Hirsch FR, Varella-Garcia M, McCoy J, et al. Increased epidermal growth factor receptor gene copy number detected by fluorescence in situ hybridization associates with increased sensitivity to gefitinib in patients with bronchioloalveolar carcinoma subtypes: a Southwest Oncology Group Study. J Clin Oncol 2005;23:6838–45.[Abstract/Free Full Text]
  7. Tsao MS, Sakurada A, Cutz JC, et al. Erlotinib in lung cancer—molecular and clinical predictors of outcome. N Engl J Med 2005;353:133–44.[Abstract/Free Full Text]
  8. Hirsch FR, Varella-Garcia M, Bunn PA, et al. Molecular analysis of EGFR gene copy number, EGFR expression and Akt activation status in advanced non-small cell lung cancer (aNSCLC) treated with gefitinib or placebo (ISEL trial) [abstract A268]. Clin Cancer Res 2005;11:9031s.
  9. Lynch TJ, Bell DW, Sordella R, et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004;350:2129–39.[Abstract/Free Full Text]
  10. Paez JG, Janne PA, Lee JC, et al. EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 2004;304:1497–500.[Abstract/Free Full Text]
  11. Cortes-Funes H, Gomez C, Rosell R, et al. Epidermal growth factor receptor activating mutations in Spanish gefitinib-treated non-small-cell lung cancer patients. Ann Oncol 2005;16:1081–6.[Abstract/Free Full Text]
  12. Han SW, Kim TY, Hwang PG, et al. Predictive and prognostic impact of epidermal growth factor receptor mutation in non-small-cell lung cancer patients treated with gefitinib. J Clin Oncol 2005;23:2493–501.[Abstract/Free Full Text]
  13. Mitsudomi T, Kosaka T, Endoh H, et al. Mutations of the epidermal growth factor receptor gene predict prolonged survival after gefitinib treatment in patients with non-small-cell lung cancer with postoperative recurrence. J Clin Oncol 2005;23:2513–20.[Abstract/Free Full Text]
  14. Takano T, Ohe Y, Sakamoto H, et al. Epidermal growth factor receptor gene mutations and increased copy numbers predict gefitinib sensitivity in patients with recurrent non-small-cell lung cancer. J Clin Oncol 2005;23:6829–37.[Abstract/Free Full Text]
  15. Taron M, Ichinose Y, Rosell R, et al. Activating mutations in the tyrosine kinase domain of the epidermal growth factor receptor are associated with improved survival in gefitinib-treated chemorefractory lung adenocarcinomas. Clin Cancer Res 2005;11:5878–85.[Abstract/Free Full Text]
  16. Bell DW, Lynch TJ, Haserlat SM, et al. Epidermal growth factor receptor mutations and gene amplification in non-small-cell lung cancer: molecular analysis of the IDEAL/INTACT gefitinib trials. J Clin Oncol 2005;23:8081–92.[Abstract/Free Full Text]
  17. Therasse P, Arbuck SG, Eisenhauer EA, et al. New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada. J Natl Cancer Inst 2000;92:205–16.[Abstract/Free Full Text]
  18. Shigematsu H, Lin L, Takahashi T, et al. Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers. J Natl Cancer Inst 2005;97:339–46.[Abstract/Free Full Text]
  19. Bonner RF, Emmert-Buck M, Cole K, et al. Laser capture microdissection: molecular analysis of tissue. Science 1997;278:1481–3.[Free Full Text]
  20. Lord RV, Salonga D, Danenberg KD, et al. Telomerase reverse transcriptase expression is increased early in the Barrett's metaplasia, dysplasia, adenocarcinoma sequence. J Gastrointest Surg 2000;4:135–42.[CrossRef][Medline]
  21. Gibson UE, Heid CA, Williams PM. A novel method for real time quantitative RT-PCR. Genome Res 1996;6:995–1001.[Abstract/Free Full Text]
  22. Perkins NJ, Schisterman EF. The Youden Index and the optimal cut-point corrected for measurement error. Biom J 2005;47:428–41.[Medline]
  23. Lin D, Wei L, Ying Z. Checking the Cox model with cumulative sums of Martingale-based residuals. Biometrics 1993;80:557–72.
  24. Hirsch FR, Varella-Garcia M, Bunn PA, Jr., et al. Epidermal growth factor receptor in non-small-cell lung carcinomas: correlation between gene copy number and protein expression and impact on prognosis. J Clin Oncol 2003;21:3798–807.[Abstract/Free Full Text]
  25. Bhargava R, Gerald WL, Li AR, et al. EGFR gene amplification in breast cancer: correlation with epidermal growth factor receptor mRNA and protein expression and HER-2 status and absence of EGFR-activating mutations. Mod Pathol 2005;18:1027–33.[CrossRef][Medline]
  26. Tse C, Brault D, Gligorov J, et al. Evaluation of the quantitative analytical methods real-time PCR for HER-2 gene quantification and ELISA of serum HER-2 protein and comparison with fluorescence in situ hybridization and immunohistochemistry for determining HER-2 status in breast cancer patients. Clin Chem 2005;51:1093–101.[Abstract/Free Full Text]
  27. Vinatzer U, Dampier B, Streubel B, et al. Expression of HER2 and the coamplified genes GRB7 and MLN64 in human breast cancer: quantitative real-time reverse transcription-PCR as a diagnostic alternative to immunohistochemistry and fluorescence in situ hybridization. Clin Cancer Res 2005;23:8348–57.



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
F. R. Hirsch, M. Varella-Garcia, R. Dziadziuszko, Y. Xiao, S. Gajapathy, M. Skokan, M. Lin, V. O'Neill, and P. A. Bunn Jr.
Fluorescence In situ Hybridization Subgroup Analysis of TRIBUTE, a Phase III Trial of Erlotinib Plus Carboplatin and Paclitaxel in Non-Small Cell Lung Cancer
Clin. Cancer Res., October 1, 2008; 14(19): 6317 - 6323.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M.-J. Ahn, B.-B. Park, J. S. Ahn, S. W. Kim, H.-T. Kim, J. S. Lee, J. H. Kang, J. Y. Cho, H. S. Song, S. H. Park, et al.
Are There Any Ethnic Differences in Molecular Predictors of Erlotinib Efficacy in Advanced Non-Small Cell Lung Cancer?
Clin. Cancer Res., June 15, 2008; 14(12): 3860 - 3866.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
F. Cappuzzo, G. Finocchiaro, E. Rossi, P.A. Janne, C. Carnaghi, C. Calandri, K. Bencardino, C. Ligorio, F. Ciardiello, T. Pressiani, et al.
EGFR FISH assay predicts for response to cetuximab in chemotherapy refractory colorectal cancer patients
Ann. Onc., April 1, 2008; 19(4): 717 - 723.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
E. Giovannetti, C. Lemos, C. Tekle, K. Smid, S. Nannizzi, J. A. Rodriguez, S. Ricciardi, R. Danesi, G. Giaccone, and G. J. Peters
Molecular Mechanisms Underlying the Synergistic Interaction of Erlotinib, an Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor, with the Multitargeted Antifolate Pemetrexed in Non-Small-Cell Lung Cancer Cells
Mol. Pharmacol., April 1, 2008; 73(4): 1290 - 1300.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W. Liu, X. Wu, W. Zhang, R. C. Montenegro, D. L. Fackenthal, J. A. Spitz, L. M. Huff, F. Innocenti, S. Das, E. H. Cook, Jr., et al.
Relationship of EGFR Mutations, Expression, Amplification, and Polymorphisms to Epidermal Growth Factor Receptor Inhibitors in the NCI60 Cell Lines
Clin. Cancer Res., November 15, 2007; 13(22): 6788 - 6795.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
R Dziadziuszko, B Holm, B. Skov, K Osterlind, M. Sellers, W. Franklin, P. Bunn Jr, M Varella-Garcia, and F. Hirsch
Epidermal growth factor receptor gene copy number and protein level are not associated with outcome of non-small-cell lung cancer patients treated with chemotherapy
Ann. Onc., March 1, 2007; 18(3): 447 - 452.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
E. Buck, A. Eyzaguirre, S. Barr, S. Thompson, R. Sennello, D. Young, K. K. Iwata, N. W. Gibson, P. Cagnoni, and J. D. Haley
Loss of homotypic cell adhesion by epithelial-mesenchymal transition or mutation limits sensitivity to epidermal growth factor receptor inhibition
Mol. Cancer Ther., February 1, 2007; 6(2): 532 - 541.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
L. Toschi and F. Cappuzzo
Understanding the New Genetics of Responsiveness to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors
Oncologist, February 1, 2007; 12(2): 211 - 220.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
F. R. Hirsch, M. Varella-Garcia, P. A. Bunn Jr, W. A. Franklin, R. Dziadziuszko, N. Thatcher, A. Chang, P. Parikh, J. R. Pereira, T. Ciuleanu, et al.
Molecular Predictors of Outcome With Gefitinib in a Phase III Placebo-Controlled Study in Advanced Non-Small-Cell Lung Cancer
J. Clin. Oncol., November 1, 2006; 24(31): 5034 - 5042.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. A. Bunn Jr.
Can a single pill replace doublet chemotherapy in first-line therapy of advanced non-small cell lung cancer?
Clin. Cancer Res., October 15, 2006; 12(20): 5919 - 5920.
[Full Text] [PDF]


Home page
JCOHome page
C. H. Chung, K. Ely, L. McGavran, M. Varella-Garcia, J. Parker, N. Parker, C. Jarrett, J. Carter, B. A. Murphy, J. Netterville, et al.
Increased Epidermal Growth Factor Receptor Gene Copy Number Is Associated With Poor Prognosis in Head and Neck Squamous Cell Carcinomas
J. Clin. Oncol., September 1, 2006; 24(25): 4170 - 4176.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Dziadziuszko, F. R. Hirsch, M. Varella-Garcia, and P. A. Bunn Jr.
Selecting Lung Cancer Patients for Treatment with Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors by Immunohistochemistry and Fluorescence In situ Hybridization--Why, When, and How?
Clin. Cancer Res., July 15, 2006; 12(14): 4409s - 4415s.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dziadziuszko, R.
Right arrow Articles by Hirsch, F. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dziadziuszko, R.
Right arrow Articles by Hirsch, F. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online