Clinical Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium Tumor Immunology: New Perspectives
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Végran, F.
Right arrow Articles by Lizard-Nacol, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Végran, F.
Right arrow Articles by Lizard-Nacol, S.
Clinical Cancer Research Vol. 12, 5794-5800, October 1, 2006
© 2006 American Association for Cancer Research


Cancer Therapy: Clinical

Overexpression of Caspase-3s Splice Variant in Locally Advanced Breast Carcinoma Is Associated with Poor Response to Neoadjuvant Chemotherapy

Frédérique Végran1, Romain Boidot1, Claire Oudin1, Jean-Marc Riedinger2, Franck Bonnetain3 and Sarab Lizard-Nacol1

Authors' Affiliations: 1 Laboratory of Molecular Genetics, Institut National de la Sante et de la Recherche Medicale U-517; 2 Laboratory of Medical Biology; and 3 Department of Medical Information, Centre Georges François Leclerc, Dijon, France

Requests for reprints: Sarab Lizard-Nacol, Laboratory of Molecular Genetics, Centre Georges François Leclerc, 1, rue du professeur Marion, 21034 Dijon cedex, France. Phone: 33-3-80-73-77-58; Fax: 33-3-80-73-77-26; E-mail: SLizard{at}dijon.fnclcc.fr.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Purpose: CASP-3 gene gives rise, by alternative splicing to a caspase-3s variant, to the antagonist apoptotic property of caspase-3. Deregulation of splicing in tumor cells favoring the expression of antiapoptotic variants has been reported to contribute to both tumorigenesis and chemoresistance. Thus, we investigated the role of caspase-3 and its splice variant in breast cancer cells.

Experimental Design: Breast tumor cell lines deficient (MCF-7) and proficient (HBL100) for CASP-3 gene were transfected with each transcript and were characterized for their apoptotic response to cyclophosphamide. Expression of the two transcripts were measured by reverse transcription-PCR in 130 breast carcinomas, including 90 locally advanced tumors treated with neoadjuvant chemotherapy containing cyclophosphamide, epirubicine, and 5-fluorouracil.

Results: Overexpression of caspase-3s variant in caspase-3–transfected cell lines significantly inhibits apoptosis induced by cyclophosphamide (P < 0.0001 for both cell lines). In breast tissues, only caspase-3 levels were higher in carcinomas than in corresponding adjacent normal tissues (P = 0.0396). Locally advanced carcinomas with high levels of caspase-3 (P < 0.0001) and weak levels of caspase-3s (P = 0.0248) were more sensitive to treatment. Therefore, increase in caspase-3s/caspase3 ratio expression was significantly associated with chemoresistance (P = 0.01). Logistic univariate and multivariate analyses realized according to pathologic response confirm that increased caspase-3s expression was indicative of chemoresistance (P = 0.012 and P = 0.026, respectively).

Conclusions: The results agree with an antagonist function between the two transcripts of caspase-3 and show that their ratio of expression levels may define a subset of locally advanced breast cancer patients who are more likely to benefit from neoadjuvant cyclophosphamide-containing chemotherapy.


Apoptosis is a genetically regulated form of programmed cell death that plays an important role in eliminating infected and/or damaged cells (14). Dysfunction of apoptotic pathways can contribute to both tumorigenesis and chemoresistance (5). One of the important components of the apoptotic machinery is a proteolytic system consisting of a family of cysteine proteases called caspases. Activated caspase-3 is considered to be a central protease in the execution of apoptosis (6, 7). Resistance to apoptotic stimuli was frequently reported in MCF-7 human breast cancer cells that lack expression of caspase-3 as a result of a 47 bp deletion in exon 3 of the CASP-3 gene (810). Caspase-3 is characterized by the presence of the conserved QACRG pentapeptide active site motif, specific to this family of structurally related proteases (1113).

CASP-3 gene is located on chromosome 4q34 and possess 2,635 bp that encodes for seven exons resulting in a principal transcript with 834 bp size (14). Its alternative transcription gives rise to a shorter splice variant (caspase-3s) with 549 bp size resulting from a deletion of the exon 6 (15). This deletion results in an altered reading frame in the COOH terminus, leading to an altered amino acid sequence and a truncated polypeptide. Thus, the novel variant is 95-amino acid shorter but shares the same 161 residues with caspase-3 in the NH2 terminus containing the prodomaine and the majority of the large subunit. However, the NH2 terminus of the caspase-3s variant lacks the conserved QACRG sequence of caspase-3, suggesting that it might not be a functional protease. Indeed, it has shown that the caspase-3s variant may act as a dominant-negative regulator of the caspase-3 transcript (15).

Different experimental studies have shown in MCF-7 cells that caspase-3 is essential for breast tumor cells to undergo apoptosis in response to doxorubicin, etoposide, Taxol, cisplatin, and ionizing radiation, and that overexpression of caspase-3 restores sensitivity to these stimuli (10, 1619). Cyclophosphamide was also shown to effect tumor cell death by stimulating apoptosis. Indeed, this anticancer alkylating agent prodrug, inactive until is metabolized by cytochrome P450 in the liver, acts via its activated 4-hydroxy metabolites and induces a mitochondrial caspase-9–dependent apoptotic pathway. This effect was determined in gliosarcoma cells as evidenced by the induction of DNA fragmentation and cleavage of the caspase-7 and caspase-3 substrates in drug-treated cells (20).

Several investigators revealed that expression of caspase-3 is up-regulated in breast carcinomas in parallel to the increase in the apoptotic index and tumor progression (2124). These finding seem to conflict with the idea that apoptosis is generally reduced in tumor cells. Nevertheless, the expression of numerous genes involved in apoptosis regulation, such as CASP-3, CASP-2, Bcl-X, survivin, and death receptor families, is modulated by alternative splicing. These genes are transcribed as diverse mRNA species, which encode variants with sometimes opposite functions. This mechanism seems to play an important role in the regulation of programmed cell death, but recent evidences indicate that in several cancers the ratio of splice variants is dramatically altered and that deregulation of splicing favoring the expression of antiapoptotic variants contributes to tumorigenesis and chemoresistance (25, 26).

The present study was undertaken to determine the role of caspase-3 and its splice variant in breast cancer cells. For that, breast tumor cell lines deficient and proficient for CASP-3 were transfected with each transcript. In addition, their prognostic and predictive values were investigated in breast carcinomas.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines. Human breast cancer cell lines MCF-7, ZR-75-1, SK-BR-3, HBL-100, and MDA-MB-231 were purchased from the American Type Culture Collection (Manassas, VA) and UACC-3199 from the Arizona Cancer Centre Tissue Culture Shared Resource (Tucson, AZ). The cell lines were cultured according to the instructions from the manufacturer. Briefly, cells were routinely grown at 37°C with 5% CO2 in RPMI medium supplemented with antibiotics and 10% fetal bovine serum (Invitrogen, Carlsbad, CA).

Patients and samples. We studied retrospectively a population of 129 patients with invasive ductal breast carcinomas, including 90 diagnosed with locally advanced tumors. One patient has bilateral lesion, and the analysis was done in both carcinomas. The surgically resected carcinomas were obtained during the period going from 1991 to 1997 at the Centre Georges François Leclerc (Dijon, France). Corresponded adjacent normal tissues were also obtained for 50 patients belonging to the locally advanced group. The median clinical follow-up was 11.5 years (range 7.5-15.3 years). The patients with locally advanced breast carcinomas received neoadjuvant chemotherapy (four or six courses each 21 days) with a regimen containing cyclophosphamide (500 g/m2), epirubicine (100 g/m2), and 5-fluorouracil (500 g/m2). In all cases, neither radiotherapy nor hormone therapy were applied before chemotherapy. However, adjuvant hormone therapy was administrated in 40 of the 90 locally advanced cases. This study was done with the approval of the local boards governing research on human subjects and all the examined patients are with well-known clinical history.

All tissue samples were frozen and stored in liquid nitrogen. Total RNA from a pool of four normal mammary tissues was purchased from Clontech (Palo Alto, CA) and was used as control.

Full-length cDNA synthesis and cloning. The full-length of caspase-3 and caspase-3s coding sequences were obtained using SuperScript One-Step long templates reverse transcription-PCR (Invitrogen) with 1.25 µg total RNA from the UACC3199 cell line (containing high levels of the two transcripts). Specific primers were used at 300 nmol/L (ACGCTAGATATCATGGAGAACACTGAAAACTCAGTG and GGCGGC GGTCTAGATTAGTGATAAAAATAGAGTTC). PCR program was done by one cycle at 45°C for 30 minutes, 94°C for 2 minutes followed by 35 cycles of 15 seconds at 94°C, 30 seconds at 50°C, 1 minute at 68°C, and one final cycle for 5 minutes at 72°C (Abi Prism 9700 thermocycler; Applied Biosystems, Foster City, CA).

Addition of 3' adenines was realized for 15 minutes at 72°C by using Platinum Taq DNA polymerase. The inserts were cloned into pcDNA3.1/CT-GFP-TOPO and amplified in One Shot TOP10 Chemically Competent Escherichia coli with green fluorescent protein fusion TOPO TA expression kits (Invitrogen). The plasmids from a few randomly picked colonies were isolated. The orientations of the caspase-3 or caspase-3s fragments were tested by EcoRV and XbaI digestion. The products of digestion were separated on 2% agarose gel and revealed by SYBR green (Molecular Probes, Eugene, OR) staining on ChemiDoc XRS Analyser (Bio-Rad, Hercules, CA).

Stable transfection. For stable transfection, 5 x 105 MCF-7 and HBL100 cells were grown in a medium without antibiotics in 12-well plates. Two days later, cells were transfected with 0.5 µg plasmid containing either caspase-3 or caspase-3s insert and with empty control vector. The stable transfections were done by LipofectAMINE 2000 (Invitrogen) according to the instructions of the manufacturer. The stable colonies were selected by 1,000 µg/mL geneticin. Each stable transfected clone was transiently transfected with the other variant as described. To ensure that the variants were sufficiently expressed, the transfection efficiency was controlled by quantitative real-time reverse transcription-PCR amplification. Relative change was calculated between control and transfected cells.

Measurement of apoptosis cell death by flow cytometry. Apoptosis was induced by cyclophosphamide in the two cell lines (MCF-7 and HBL100). Twenty-four hours after transfection, cells were cultured in MEM medium without antibiotics during 24 hours in the presence of 600 ng/mL cyclophosphamide for MCF-7 and 1.2 µg/mL for HBL100 cells. Assessment of apoptosis was accomplished by measuring the translocation of the membrane phosphatidylserine using the Annexin V-PE Apoptosis Detection kit I (BD PharMingen) according to instructions of the manufacturer. Briefly, after trypsinization and washing with PBS, cells were pelted 5 minutes at 1,500 x g and incubated 15 minutes with Annexin V-PE and 7-amino-actinomycin D (BD Biosciences, San Diego, CA). Cells (30,000) were counted by flow cytometry using Becton Dickinson LSRII and the experiments were done in triplicate in two different clones.

RNA extraction and cDNA synthesis. Total RNA was extracted with Trizol reagent (Invitrogen) and its quality was checked by 28S/18S ratio on agarose gel. One microgram of total RNA was reverse transcribed as described (27).

Quantitative real-time PCR amplification. Amplification was done in a total volume of 25 µL in the presence of 600 nmol/L of each primers, 200 nmol/L of each probes, 12.5 µL Universal Master Mix (Applied Biosystems), and 12 ng cDNA (or water as negative control). PCR was done with an initial denaturation step of 10 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. Sequences of primers and probes used are the following: 5'-CTGGACTGTGGCATTGAGACA-3'; 5'-AGTCGGCCTCCACTGGTATTT-3' and 5'-TGGTGTTGATGATGACATGGCGTGTC-3' for caspase-3 primers and probes, respectively, located in exon 6 and resulting in a 76 bp fragment; 5'-AGAAGTCTAACTGGAAAACCCAAACT-3'; 5'-CAAAGCGACTGGATGAACCA-3'; and 5'-ATTATTCAGGTTATTATTCTTGGCG-3'for caspase-3s primers and probes, respectively, located in exons 5 to 7 and resulting in a 95 bp fragment. Probes were labeled with FAM in 5' and with TAMRA in 3'. All samples were amplified in duplicate and results were analyzed at the CT level. Control 18S reactions (Applied Biosystems) were used to normalize {Delta}CT values.

Sequencing of PCR products. The specificity of all the PCR amplifications was verified by sequencing of PCR products. Briefly, products were excited from 3% agarose gels and isolated by Geneclean Turbo gel extraction kit (Qiagen). The purified PCR products were sequenced using the Abi-Prism Big Dye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems) with the respective primers used in the initial PCR according to the protocol of the manufacturer. Sequence analysis was carried out using an ABI-Prism 310 as described (28).

Statistical analysis. All analyses were done with Stata software with a bilateral 5% type I error. Comparisons between cell lines were done with ANOVA test. Comparisons between transfected and vector control cells were made by Student’s t test. In breast carcinomas, analyses were realized among the 129 patients and among the 90 locally advanced patients. Qualitative variables were described with frequency and compared with Fisher's exact test. The quantitative variables were described with mean (SD) and with box plots. They were compared between subgroups with Kruskal-Wallis, Mann-Whitney, and/or two-sample Wilcoxon rank-sum tests. The longitudinal changes of caspases expression were tested by Wilcoxon matched pairs signed-rank tests. The overall survival was defined as the interval between the diagnosis and the last follow-up or death. Disease-free survival was defined as the time between the date of diagnosis and the date of distant metastases or local recurrence or death, whichever came first, or last follow-up. Univariate relative hazard ratio and 95% confidence interval were calculated by Cox proportional hazards model. Multivariate analyses were also done with Cox proportional hazards model. Univariate and multivariate logistic analyses (odds ratio and 95% confidence interval) were done to evaluate influence between caspases expression levels and pathologic response.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Coexpression of caspase-3 and caspase-3s decreased apoptotic induction in breast tumor cell lines. Breast cancer cell lines (ZR-75-1, SK-BR-3, HBL-100, UACC-3199, and MCF-7) were tested for the expression of the two caspase-3 transcripts and compared with normal mammary tissues. The results confirm that caspase-3 transcript was very weakly expressed in MCF-7 cells comparatively with normal mammary tissues (P < 0.0001, ANOVA test) and reveal that caspase-3s variant was absent. Mean expression levels of caspase-3 were variable among the remaining cell lines, whereas caspase-3s seem higher compared with normal mammary tissues, except for ZR-75-1 cells (Fig. 1A ). Therefore, the ratio between caspase-3s and caspase-3 was significantly higher in these cell lines than in normal mammary tissues (P = 0.0370 for SK-BR-3, P = 0.0101 for HBL-100, and P = 0.0040 for UACC-3199; Fig. 1B).


Figure 1
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1. Analysis of caspase-3 and its splice variant caspase-3s expression in breast tumor cell lines. Mean expression levels of caspase-3 and caspase-3s in the five cell lines (A). NMT, a pool of four normal mammary tissues obtained from Clontech and used as positive control. Ratio expression levels between caspase-3s and caspase-3 (B). The effect of caspase-3 and/or caspase-3s transfection in MCF-7 (C) and HBL-100 (D) cells on cyclophosphamide (CPA)–induced apoptosis. Cells were transfected with vector alone (pcDNA3.1) as control (Crt), with full-length caspase-3 (casp-3) or caspase-3s (casp-3s) cDNA. Transient transfection with caspase-3s was also done in stable caspase-3–transfected cells (C-3/C-3s). WT, nontransfected cells. Results were obtained from three independent experiments.

 
To determine the effect of caspase-3 transcripts on induced apoptosis, we compared cyclophosphamide effects on caspase-3–deficient MCF-7 and caspase-3–proficient HBL100 cell lines transfected with full-length cDNA of each transcript. In a first set of experiments, we checked the expression of the two transcripts by quantitative reverse transcription-PCR. The results show that transfection restores the expression of both transcripts in MCF-7 cells, and provokes 3- to 7-fold increase of caspase-3 and 40- to 43-fold increase of caspase-3s expressions in HBL100 cells. Treatment of caspase-3–transfected cells with cyclophosphamide induces apoptosis 1.8-fold in MCF-7 (P = 0.0005, Student's t test) and 2.3-fold in HBL100 (P < 0.0001) compared with the control vector cells (Fig. 1C and D, respectively). Caspase-3s–transfected cells also has this ability, but compared with caspase-3 presence, its increased apoptosis after treatment remains less efficient, namely in HBL100 cells (P < 0.0001) that contain a normal CASP-3 gene. Interestingly, overexpression of caspase-3s in caspase-3–transfected MCF-7 and HBL100 cells reveals a strong decrease (P < 0.0001 for both cell lines) in induced apoptosis levels compared with matched caspase-3–transfected cells (Fig. 1C and D).

Expression of caspase-3 transcripts in breast carcinomas and adjacent normal tissues. Coexpression of caspase-3 and caspase-3s was detected in the 130 examined breast carcinomas and adjacent normal tissues. However, mean expression levels of caspase-3 was significantly (P = 0.0396, two-sample Wilcoxon rank-sum test) more important in carcinomas than in adjacent normal tissues (Fig. 2A ), whereas no differences (P = 0.5287) was detected between the two tissues for caspase-3s (Fig. 2B).


Figure 2
View larger version (9K):
[in this window]
[in a new window]
 
Fig. 2. Distribution and comparison of caspase-3 (A) and caspase-3s (B) expression before treatment in locally advanced breast carcinomas and corresponding adjacent normal tissues.

 
Relationship with standard prognostic factors and patient survival outcome. The mean expression levels of the caspase-3 and its splice variant, caspase-3s, did not differ according to the patient characteristics. No relation was also found for the ratio caspase-3s/caspase-3 expression levels (Table 1 ).


View this table:
[in this window]
[in a new window]
 
Table 1. Mean expression levels of caspase-3 and caspase-3s according to patient's breast cancer clinical subgroups

 
Cox univariate analysis realized according to overall and disease-free survivals of the 130 patients showed no significant relation between either the two transcripts or their ratio expression levels and survival outcome. In multivariate analysis, only ages >50 years and positive nodal metastases are significantly associated with both poorest overall and disease-free survivals. Estrogen receptor status was also associated with poorest overall survival (Table 2 ). No relationship was also found among the 90 locally advanced patients (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 2. Cox univariate and multivariate overall and disease-free survival analyses among the 130 breast cancer patients

 
Relationship with response to chemotherapy. The pathologic response to neoadjuvant chemotherapy was classified for the 90 locally advanced breast carcinomas as described previously (29). No responders corresponded to patients with residual tumor evidently modified by treatment as well as to patients with histologically unmodified tumor. Responders included patients with no evidence of residual tumor in the breast or axillary lymph nodes and patients with only residual in situ carcinoma. Thus, no pathologic response was observed for 60 carcinomas and complete pathologic response for 30 cases. Caspase-3 mean expression increased from nonresponder (3.69 ± 0.86) to responder (5.30 ± 0.23) cases (P < 0.0001, Mann-Whitney test). In contrast, caspase-3s mean expression decreased from nonresponder (0.11 ± 0.09) to responder (0.02 ± 0.01) cases (P = 0.0248). These results suggested that carcinomas with high levels of caspase-3 and weak levels of caspase-3s could be more sensitive to treatment. As illustrated in Fig. 3 , caspase-3s/caspase-3 ratio expression showed a significant chemoresistance-dependent increase (P = 0.01). Logistic univariate analysis realized according to pathologic response revealed that only caspase-3s (odds ratio, 0.16; 95% confidence interval, 0.03-0.66; P = 0.012) is associated with pathologic response, whereas no association was found for caspase-3 (odds ratio, 1.83; 95% confidence interval, 0.66-5.10; P = 0.245). According to logistic multivariate analysis, increased caspase-3s expression is significantly (P = 0.026) indicative of no response to chemotherapy (Table 3 ).


Figure 3
View larger version (5K):
[in this window]
[in a new window]
 
Fig. 3. Caspase-3s/caspase-3 ratio expression levels according to regrouped pathologic response to neoadjuvant chemotherapy in the 90 locally advanced breast carcinomas. Horizontal bars, median value expressions.

 

View this table:
[in this window]
[in a new window]
 
Table 3. Logistic multivariate pathologic response analyses among the 90 locally advanced breast carcinomas

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The coexpression of caspase-3 and its splice variant, caspase-3s, was reported in diverse tumor cell lines (kidney, HeLa, and colon) and normal human tissues (heart, brain placenta, and lung; ref. 15). Our results show, for the first time, the coexpression of the two transcripts in breast tumor cell lines as well as in both breast carcinomas and corresponding normal tissues.

In the first step of our analysis, we determined the role of each transcript expression as well as of their coexpression on induced apoptosis in tumor cell lines. The results indicate that the presence of caspase-3 significantly increase apoptosis in response to cyclophosphamide, one of the drugs used in breast carcinoma treatment, and that overexpression of caspase-3s variant in caspase-3–transfected cells strongly inhibits induced apoptosis.

In pretreatment of locally advanced carcinomas, basal expression levels of caspase-3 was significantly higher in carcinomas compared with normal tissues, whereas caspase-3s levels did not differ between the two tissues. Increased expression of caspase-3 transcript may indicate a potential for apoptosis in breast carcinomas. This result is consistent with the fact that up-regulation of caspase-3 and increase in apoptosis rates were detected simultaneously at high levels in breast carcinomas compared with adjacent normal tissues (2124). Because the short splice variant acts as a dominant-negative regulator of the caspase-3 transcript (15), its expression in breast carcinomas permit the generation of antiapoptotic activities, thus explaining their ability to tolerate high levels of caspase-3. These results agree with the antagonistic actions between the two transcripts and suggest that their expression might be monitored by an inverse regulation.

Next, we investigated the prognostic effect of the two transcript expression levels and found no significant relationship with either patient's clinical variables or patient's overall and disease-free survival. This result is in contradiction with only one study showing that immunohistochemical expression of caspase-3 has a negative influence on breast cancer patient's overall survival (30). However, others have found no significant association with patient's clinical variables and survival outcome by immunohistochemistry, Western blot, or mRNA analysis (21, 23).

The second aim of our study was to investigate whether caspases-3 expression has predictive effect. At present, there was no study on the role of caspase-3 and its splice variant in the response to chemotherapy in breast carcinomas. Using immunohistochemistry, no relationship was found between caspase-3 active form expression and clinical response to chemotherapy (31). However, lack of or down-regulation of caspase-3 expression, both at transcriptional and protein levels, was reported to constitute a possible mechanism to chemoresistance in breast carcinomas (16). Thus, we hypothesize that overexpression of the caspase-3s antiapoptotic variant could promote cell survival and chemoresistance in breast tumor cells. Consistently, our results show that the achievement of a complete response seems to be dependent on the presence of caspase-3, but require a decrease in caspase-3s expression. In addition, logistic univariate and multivariate analysis show that no response to treatment is related to caspase-3s increased expression and not to decrease of caspase-3 one. Therefore, locally advanced breast cancer patients with high levels of caspase-3 expression and weak levels of caspase-3s expression could benefit from neoadjuvant cyclophosphamide-containing chemotherapy.

Although caspase-3s is expressed at low levels that are not sufficient to completely suppress apoptosis, imbalance of the two transcript ratios may render the cells resistant to apoptosis (15, 16). Consistent with that, increased caspase-3s/caspase-3 ratio expression was significantly associated with no response to chemotherapy in the examined population. Taken together, our results show that although caspase-3 expression has no prognostic effects in breast carcinomas, it might be of interest for chemotherapy response determination. Thus, expression of caspase-3s/caspase-3 ratio might be used as a predictive marker because their expression levels may define a subset of locally advanced breast cancer patients who are more likely to benefit from neoadjuvant cyclophosphamide-containing chemotherapy.


    Footnotes
 
Grant support: Ligues Départementales de Sâone Loire et de la Côte d'Or.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 3/24/06; revised 6/19/06; accepted 6/27/06.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Faraglia B, Bonsignore A, Scaldaferri F, et al. Caspase-3 inhibits the growth of breast cancer cells independent of protease activity. J Cell Physiol 2004;202:478–82.[CrossRef]
  2. Hortobagyi GN. The status of breast cancer management: challenges and opportunities. Breast Cancer Res Treat 2002;75:61–5.[CrossRef]
  3. Launay S, Hermine O, Fontenay M, et al. Vital functions for lethal caspases. Oncogene 2005;24:5137–48.[CrossRef][Medline]
  4. Johnstone RW, Ruefli AA, Lowe SW. Apoptosis: a link between cancer genetics and chemotherapy. Cell 2002;108:153–64.[CrossRef][Medline]
  5. Nicholson DW. From bench to clinic with apoptosis-based therapeutic agents. Nature 2000;407:810–6.[CrossRef][Medline]
  6. Fernandes-Alnemri T, Litwack G, Alnemri ES. CPP32, a novel human apoptotic protein with homology to Caenorhabditis elegans cell death protein Ced-3 and mammalian interleukin-1 ß-converting enzyme. J Biol Chem 1994;269:30761–4.[Abstract/Free Full Text]
  7. Janicke RU, Ng P, Sprengart ML, et al. Caspase-3 is required for {alpha}-fodrin cleavage but dispensable for cleavage of other death substrates in apoptosis. J Biol Chem 1998;273:15540–55.[Abstract/Free Full Text]
  8. Janicke RU, Sprengart ML, Wati MR, et al. Caspase-3 is required for DNA fragmentation and morphological changes associated with apoptosis. J Biol Chem 1998;273:9357–60.[Abstract/Free Full Text]
  9. Kurokawa H, Nishio K, Fukumoto H, et al. Alteration of caspase-3 (CPP32/Yama/apopain) in wild-type MCF-7, breast cancer cells. Oncol Rep 1999;6:33–7.[Medline]
  10. Yang XH, Sladek TL, Liu X, et al. Reconstitution of caspase-3 sensitizes MCF-7 breast cancer cells to doxorubicin- and etoposide- induced apoptosis. Cancer Res 2001;61:348–54.[Abstract/Free Full Text]
  11. Stennicke HR, Salvesen GS. Properties of the caspases. Biochim Biophys Acta 1998;1387:17–31.[CrossRef][Medline]
  12. Wang X. The expanding role of mitochondria in apoptosis. Genes Dev 2001;15:2922–33.[Free Full Text]
  13. Faleiro L, Lazebnik Y. Caspases disrupt the nuclear-cytoplasmic barrier. J Cell Biol 2000;151:951–9.[Abstract/Free Full Text]
  14. Tiso N, Pallavicini A, Muraro T, et al. Chromosomal localization of the human genes, CPP32, Mch2, Mch3, and Ich-1, involved in cellular apoptosis. Biochem Biophys Res Commun 1996;225:983–9.[CrossRef][Medline]
  15. Huang Y, Shin NH, Sun Y, et al. Molecular cloning and characterization of a novel caspase-3 variant that attenuates apoptosis induced by proteasome inhibition. Biochem Biophys Res Commun 2001;283:762–9.[CrossRef][Medline]
  16. Devarajan E, Sahin AA, Chen JS, et al. Down-regulation of caspase 3 in breast cancer: a possible mechanism for chemoresistance. Oncogene 2002;21:8843–51.[CrossRef][Medline]
  17. Essmann F, Engels IH, Totzke G, et al. Apoptosis resistance of MCF-7 breast carcinomas cells to ionizing radiation is independent of p53 and cell cycle control but caused by the lack of caspase-3 and a caffeine-inhibitable event. Cancer Res 2004;64:7065–72.[Abstract/Free Full Text]
  18. Friedrich K, Wieder T, Von Haefen C, et al. Overexpression of caspase-3 restores sensitivity for drug-induced apoptosis in breast cancer cell lines with acquired drug resistance. Oncogene 2001;20:2749–60.[CrossRef][Medline]
  19. Blanc C, Deveraux QL, Krajewski S, et al. Caspase-3 is essential for procaspase-9 processing and cisplatin-induced apoptosis of MCF-7 breast cancer cells. Cancer Res 2000;60:4386–90.[Abstract/Free Full Text]
  20. Schwartz PS, Waxman DJ. Cyclophosphamide induces caspase 9-dependent apoptosis in 9L tumor cells. Mol Pharmacol 2001;60:1268–79.[Abstract/Free Full Text]
  21. O'Donovan N, Crown J, Stunell H, et al. Caspase 3 in breast cancer. Clin Cancer Res 2003;9:38–42.[Medline]
  22. Krajewski S, Krajewska M, Turner BC, et al. Prognostic significance of apoptosis regulators in breast cancer. Endocr Relat Cancer 1999;6:29–40.[Abstract]
  23. Vakkala M, Paakko P, Soini Y. Expression of caspases 3, 6 and 8 is increased in parallel with apoptosis and histological aggressiveness of the breast lesion. Br J Cancer 1999;81:592–9.[CrossRef][Medline]
  24. Hadjiloucas I, Gilmore AP, Bundred NJ, et al. Assessment of apoptosis in human breast tissue using an antibody against the active form of caspase-3: relation to tumor histopathological characteristics. Br J Cancer 2001;85:1522–6.[CrossRef][Medline]
  25. Mercatante D, Kole R. Modification of alternative splicing pathways as a potential approach to chemotherapy. Pharmacol Ther 2000;85:237–43.[CrossRef][Medline]
  26. Sazani P, Kole RJ. Therapeutic potential of antisense oligonucleotides as modulators of alternative splicing. Clin Invest 2003;112:481–6.
  27. Arnal M, Franco N, Fargeot P, et al. Enhancement of mdr1 gene expression in normal tissue adjacent to advanced breast cancer. Breast Cancer Res Treat 2000;61:13–20.[CrossRef][Medline]
  28. Lizard-Nacol S, Genne P, Coudert B, et al. MDR1 and thymidylate synthase (TS) gene expressions in advanced breast cancer: relationships to drug exposure, p53 mutations, and clinical outcome of the patients. Anticancer Res 1999;19:3575–81.[Medline]
  29. Chollet P, Amat S, Cure H, et al. Prognostic significance of a complete pathological response after induction chemotherapy in operable breast cancer. Bri J Cancer 2002;86:1041–6.[CrossRef][Medline]
  30. Nakopoulo L, Alexandrou P, Stefanaki K, et al. Immunohistochemical expression of caspase-3 as an adverse indicator of the clinical outcome in human breast cancer. Pathobiology 2001;69:266–73.[CrossRef][Medline]
  31. Parton M, Krajewski S, Smith I, et al. Coordinate expression of apoptosis-associated proteins in human breast cancer before and during chemotherapy. Clin Cancer Res 2002;8:2100–8.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Végran, F.
Right arrow Articles by Lizard-Nacol, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Végran, F.
Right arrow Articles by Lizard-Nacol, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online