Clinical Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium Infection and Cancer: Biology, Therapeutics, and Prevention
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wen, Y.
Right arrow Articles by Notterman, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wen, Y.
Right arrow Articles by Notterman, D.
Clinical Cancer Research Vol. 12, 5951-5959, October 15, 2006
© 2006 American Association for Cancer Research

Human Cancer Biology

GRO{alpha} Is Highly Expressed in Adenocarcinoma of the Colon and Down-Regulates Fibulin-1

Yu Wen1, Sarah F. Giardina3, David Hamming2, Jennifer Greenman1,2, Emmanuel Zachariah1, Manny D. Bacolod3, Hao Liu1, Jinru Shia4, Peter S. Amenta1, Francis Barany3, Phillip Paty4, William Gerald4 and Daniel Notterman1,2

Authors' Affiliations: 1 Robert Wood Johnson Medical School and Cancer Institute of New Jersey, New Brunswick, New Jersey; 2 Princeton University, Princeton, New Jersey; 3 Weil Medical College of Cornell University; and 4 Memorial-Sloan Kettering Cancer Center, New York, New York

Requests for reprints: Daniel A. Notterman, Departments of Pediatrics and Molecular Genetics, Robert Wood Johnson Medical School, 125 Patterson Street, MEB 306, New Brunswick, NJ 08903. Phone: 732-235-7900; Fax: 732-235-6102; E-mail: d.notterman{at}umdnj.edu.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Purpose: The growth-related oncogene {alpha} (GRO{alpha}) is a secreted interleukin-like molecule that interacts with the CXCR2 G-protein–coupled receptor. We found that the mRNA and protein products of GRO{alpha} are more highly expressed in neoplastic than normal colon epithelium, and we studied potential mechanisms by which GRO{alpha} may contribute to tumor initiation or growth.

Experimental Design: Cell lines that constitutively overexpress GRO{alpha} were tested for growth rate, focus formation, and tumor formation in a xenograft model. GRO{alpha} expression was determined by Affymetrix GeneChip (241 microdissected colon samples), real-time PCR (n = 32), and immunohistochemistry. Primary colon cancer samples were also employed to determine copy number changes and loss of heterozygosity related to the GRO{alpha} and fibulin-1 genes.

Results: In cell cultures, GRO{alpha} transfection transformed NIH 3T3 cells, whereas inhibition of GRO{alpha} by inhibitory RNA was associated with apoptosis, decreased growth rate, and marked up-regulation of the matrix protein fibulin-1. Forced expression of GRO{alpha} was associated with decreased expression of fibulin-1. Expression of GRO{alpha} mRNA was higher in primary adenocarcinomas (n = 132), adenomas (n = 32), and metastases (n = 52) than in normal colon epithelium (P < 0.001). These results were confirmed by real-time PCR and by immunohistochemistry. Samples of primary and metastatic colon cancer showed underexpression of fibulin-1 when compared with normal samples. There were no consistent changes in gene copy number of GRO{alpha} or fibulin-1, implying a transcriptional basis for these findings.

Conclusion: Elevated expression of GRO{alpha} is frequent in adenocarcinoma of the colon and is associated with down-regulation of the matrix protein fibulin-1 in experimental models and in clinical samples. GRO{alpha} overexpression abrogates contact inhibition in cell culture models, whereas inhibition of GRO{alpha} expression is associated with apoptosis. Importantly, coexpression of fibulin-1 with GRO{alpha} abrogates key aspects of the transformed phenotype, including tumor formation in a murine xenograft model. Targeting GRO proteins may provide new opportunities for treatment of colon cancer.

There is substantial information that the secreted interleukin-like molecule, growth-related oncogene {alpha} (GRO{alpha}) functions as an oncogene in melanoma development (1, 2). Up-regulation of GRO{alpha} expression at the mRNA and protein level is observed in melanoma, and evidence indicates that GRO{alpha} plays a pivotal role in this neoplasm. We planned these experiments to examine the role of GRO{alpha} in colorectal cancer and the mechanisms by which it might participate in colon cancer initiation (3).

Apart from a potential role as an oncogene, GRO{alpha} has a variety of other putative functions, such as directing inflammatory cell migration, promoting angiogenesis, and participating in wound healing (4, 5). There is evidence that GRO{alpha} induction upon HIV-1 infection stimulates HIV-1 replication in macrophages and T lymphocytes (6). During central nervous system development, GRO{alpha} is involved in proliferation and migration of oligodendrocyte progenitors (7, 8). It may also be involved in the pathogenesis of Alzheimer's disease due to its role in inflammation (9).

GRO{alpha} is a 73-amino-acid protein structurally and functionally related to its isoforms GROß and GRO{gamma} (10) and to interleukin-8. All belong to the {alpha} chemokine superfamily (11). Alternative designations for this family are CXCL1 (GRO{alpha}), CXCL2, CXCL3, and CXCL8 (GROß, GRO{gamma}, and interleukin-8, respectively). They have a conserved CXC motif at the NH2 terminus but differ at the COOH terminus. GROß and GRO{gamma} can also promote melanoma development by overexpression in immortalized melanocyte cells (12). The three different GRO chemokines differ in the binding affinity to their receptor CXCR2 (a G-protein–coupled receptor), with GRO{alpha} bearing the highest affinity (13).

Transcription rate seems to be an important mechanism for regulating the activity of GRO{alpha}. The GRO{alpha} gene was first identified by its inducible expression in response to platelet-derived growth factor induction (14). GRO{alpha} gene expression is induced by cytokines, including interleukin-1 (15) and tumor necrosis factor-{alpha} (16), probably through the nuclear factor {kappa}B signaling pathway (17, 18). Bacterial products, such as lipopolysaccharide (19), cell surface heparin sulfate proteoglycan (20), and Shiga toxins (21), may also increase GRO{alpha} expression. Transcription factors HMGA1 and Sp1 up-regulate GRO{alpha} gene expression by binding to the cis-elements within the GRO{alpha} promoter region (22). Conversely, a human CUT homeodomain protein/CCAAT displacement protein can negatively regulate GRO{alpha} gene expression by interacting with the GRO{alpha} promoter (23).

Several downstream signaling pathways are involved following the interaction of GRO{alpha} with the CXCR2 receptor. These include the Ras-mitogen-activated protein kinase pathway, phosphatidylinositol 3-kinase pathway (9), nuclear factor {kappa}B pathway (18), and PAK signaling (24). Activation of these signaling pathways by GRO{alpha} may lead to different GRO{alpha} cellular responses and functions.

In this study, we confirmed that GRO{alpha} mRNA expression is dysregulated in early and late stages of colorectal cancer. Evidence from both overexpression and inhibitory RNA (siRNA) experiments suggest that this dysregulation promotes tumor induction or propagation. Furthermore, we provide laboratory and clinical evidence that, in colorectal cancer, increased expression of GRO{alpha} is associated with and is probably responsible for attenuated expression of the extracellular matrix proteins fibulin-1C and fibulin-1D in adjoining stroma. Abnormal expression of these fibulin-1 proteins has been associated with other kinds of cancers (25, 26), and we hypothesize that regulation of fibulin-1 proteins is an important role of GRO{alpha}.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Cell lines and medium. NIH 3T3 and HCT-15 cell lines were grown in 10-cm2 tissue culture plates in DMEM and RPMI 1640, respectively, and supplemented with 10% fetal bovine serum. Cell stocks were purchased from the American Type Tissue Collection (Manassas, VA). Culture media were purchased from the American Type Tissue Collection or Life Technologies/Invitrogen (Carlsbad, CA) as was fetal bovine serum, G-418, Trypsin-EDTA, and streptomycin. Cells were maintained using routine cell culturing and subculturing protocols and incubated at 37°C and 5% CO2.

Construction of HCT-15 permanent GRO{alpha} RNA interference cell line. Colon cancer cell line HCT-15 was stably transfected with GRO{alpha} siRNA using a protocol supplied with the GeneSuppressor System (IMGENEX, San Diego, CA). The 21-nucleotide RNA interference target sequence was from the 235th base downstream of the start codon (AAGAATGGGCGGAAAGCTTGC). Several cell lines (SIMG-1, SIMG-4, and SIMG-5) were developed. The control cell line SIMG-C was transfected with vector alone.

Detection of DNA ladders. Approximately 5 x 105 cells (HCT-15, SIMG-C, SIMG-1, SIMG-4, and SIMG-5) were seeded in 10-cm2 cell culture plates. Four days later, cells were harvested, and DNA was extracted using the procedure supplied with Suicide-Track DNA ladder isolation kit (Oncogene Research Products, Cambridge, MA). The extracted DNA was subjected to agarose gel electrophoresis to detect formation of typical DNA ladders indicative of apoptosis.

Construction of GRO{alpha}-overexpressing NIH 3T3 cell lines. GRO{alpha} cDNA was obtained through PCR from a human cDNA library derived from normal colon epithelium (supplied by the Cooperative Human Tissue Network). PCR was primed with 5'-AGCTCTTCCGCTCCTCTCACA-3'and 5'-AGGGCCTCCTTCAGGAACA-3'. The 400-bp PCR product was cloned into pCR2.1-TOPO TA vector (Invitrogen, Carlsbad, CA). Three clones were isolated and each contained the correct GRO{alpha} open reading frame. The above purified pCR2.1-TOPO containing GRO{alpha} cDNA was cloned between the BamHI and XhoI sites of the 5.4-kb expression vector pcDNA3+ (Invitrogen). NIH 3T3 cells were stably transfected with this pcDNA3-GRO{alpha} construct, and the resulting clones MB and MD were propagated under selection with G-418. A control cell line (PH) was derived from NIH 3T3 cells by transfection with pcDNA3+ with no insert.

All transfection procedures employed LipofectAMINE (Life Technologies/Invitrogen).

Construction of NIH 3T3 cell lines overexpressing both GRO{alpha} and fibulin-1D. The fibulin-1D expression plasmid pPuro-Fibulin-1D was a gift from Dr. J McCormick (25). After confirming the sequence, it was transfected into MB cells. Control cells were established by transfecting MB with the empty vector pBABE. After confirming protein expression of both GRO{alpha} and fibulin-1D expression, the resultant cell clones MBBABE, MBFBLN1(3), and MBFBLN1(6) were cultured in the presence of both puromycin and G-418.

Determination of cell number and viability. To evaluate cell number and viability, a 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium assay was done using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, Madison, WI). Cells were seeded in duplicate into 24-well plates at a density of 4 x 104/mL. Culture medium was replaced by 500 µL of fresh media after 48 hours. Each well received 100 µL of the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium reagent, and the plate was incubated for 1 hour at 37°C in a humidified, 5% CO2 atmosphere. A 100-µL aliquot of the reaction mixture was transferred to a 96-well plate, and absorbance was measured at 490 nm.

Cell culture growth curves. To measure cell culture growth rate, the various lines PH, MB, MD, MBBABE, MBFBLN1(3), and MBFBLN1(6) cells were seeded at 50,000 per well in six-well plates and grown in DMEM containing 10% fetal bovine serum. G418 and puromycin were added as appropriate. Cells were counted periodically over 15 days with an improved Neubauer hemocytometer.

Western analysis. Total protein from the cell lysate of one 10-cm2 culture plate was obtained using 0.5 to 1 mL M-PER Mammalian Protein Extraction Reagent (Pierce Biotechnology, Rockford, IL) supplemented with protease inhibitors, including 0.1 µmol/L phenylmethylsulfonyl fluoride, 10 µg/mL leupeptin, and 10 µg/mL pepstatin. The cell lysate was centrifuged for 5 minutes, and the clear supernatant was taken and stored as total protein solution. Protein concentration was obtained by using the Bicinchoninic Acid Protein Assay Reagent kit (Pierce Biotechnology). Equal amounts of protein were separated on SDS-PAGE, and membrane transfer, primary antibody reaction, washing, and signal detection were carried out according to routine methods. To detect protein expression, rat anti-human GRO{alpha} (U.S. Biological, Swampscott, MA) and mouse monoclonal anti-fibulin-1 (Santa Cruz Biotechnology, Santa Cruz, CA) were used. The fibulin-1 antibody recognizes amino acid residues 1 to 190, which is common to all isoforms of fibulin-1, including fibulin-C and fibulin-D. Therefore, Western blots employing this antibody to detect the human protein displays a series of bands, representing the various isoforms.

Tumor induction in nude mice. The ability of cell lines overexpressing GRO{alpha} to produce xenograft tumors in nude mice (BALB/BALB, nu/nu) was evaluated. MB, MD, and PH (vector control) cells were harvested by scraping them off the culture plates into ice-cold PBS. Cells were injected s.c. into the flanks of three different groups of mice. Tumor formation was monitored for 17 days, at which time, the mice were sacrificed, and the tumors were surgically removed, measured, and submitted for microscopic analysis.

Subsequently, the ability of constitutively expressed fibulin-1D to suppress GRO{alpha}-mediated tumor formation was evaluated. These experiments employed the previously described cell lines MBBABE (MB with empty pBABE expression vector), PHBABE (NIH 3T3 with two empty expression vectors, pBABE and pcDNA3), PHFBLN MBFBLN(3), and MBFBLN(6) (cell lines that constitutively express both GRO{alpha} and fibulin-1). Based on preliminary titration experiments, 2 x 105 cells from each cell line were injected to the flanks of the nude mice, and the animals were observed for 5 months for tumor induction.

RNA extraction and purification. Total RNA was extracted from cultured cells using Trizol reagent (Invitrogen). RNA was further purified by an RNeasy purification column and reagents (Qiagen, Valencia, CA). RNA concentration was determined by recording UV absorption at 260 nm.

Expression profile analysis of colon tissue samples. To discern mRNA expression of GRO{alpha}, GROß, GRO{gamma}, and the receptor CXCR2 in neoplastic colon epithelium, mRNA was extracted from 241 mucosal samples from which adjacent connective tissue and muscle was manually microdissected under microscopic visualization. The remaining mucosal tissue was processed according to standard Affymetrix protocols, and the resulting labeled cRNA was hybridized to U133A GeneChips. In addition, the total RNA from the constitutively expressing GRO{alpha} siRNA HCT-15 cell line (SIMG-1) and cells containing the empty vector (SIMG-C) was analyzed by the U133A GeneChip. MAS-3 software was used for obtaining raw data from the gene chips. Tissue samples included in this project were 24 normal colon samples, 32 adenoma tissue samples, 132 primary colon cancer tissue samples, and 52 metastasis samples (32 from the liver and 20 from the lung). Statistical testing was done with KaleidaGraph V 4.0 (Synergy Software). Significance was tested by Wilcoxon's test for paired data or ANOVA using Bonferroni all-pair comparison. Data are expressed as mean ± SE.

Real-time PCR. To quantify GRO{alpha} and fibulin-1 mRNA concentration (normalized by glyceraldehyde-3-phosphate dehydrogenase), the following primer sets and probes were synthesized (Integrated DNA Technologies, Coralville, IA). For GRO{alpha}, the forward oligo sequence was from 207 to 224 nucleotides on the open reading frame, which was TCCGTGGCCACTGAACTG. The reverse primer was GTGGCTATGACTTCGGTTTG. The fluorescent-tagged probe was 5,6-FAM-CAGACCCTGCAGGGAATTCAC-TAMRA. For fibulin-1, oligos were designed according to the common region shared by fibulin-1C and fibulin-1D. The forward and reverse primer sequences were GGAGCAGTGCTGCCACAG and AGCACCTCTTCACAAATGTG, respectively. The fluorescent-tagged probe was 5,6-FAM-AGCCTGGCCAACGAGCAGGA-36-TAMRA. For glyceraldehyde-3-phosphate dehydrogenase, the two forward and reverse sequences were ACAACTTTGGTATCGTGGAAGG and CAGTAGAGGCAGGGATGATGTTC, respectively. The fluorescent probe was 5,6-FAM-ACCCAGAAGACTGTGGATGG-3BHQ. To make the target amplification primer-probe mix, 20 µL of 100 µmol/L probe, 40 µL forward prime (100 µmol/L), 40 µL reverse prime (100 µmol/L), and 700 µL RNase-free water were mixed together to yield concentration of 2.5 µmol/L probe and 5 µmol/L of each primer in the target mix.

Reverse transcription was done using the Taqman Reverse Transcription Reagents (Applied Biosystems, Foster City, CA). The reaction was set up and carried following the provided procedures. The cDNA was stored at –20°C.

Each 25 µL PCR reaction was carried out by adding 2.5 µL target primer-probe mix, 12.5 µL Taqman 2x PCR Master Mix (Applied Biosystems), and 10 µL of sample cDNA described above. The PCR and fluorescent signal detection was done on the ABI Prism 7000. To quantify mRNA levels, a standard curve was generated for each transcript by amplifying different amounts of control cDNA known to express the gene of interest.

Immunohistochemistry for GRO{alpha}, fibulin-1, and CXCR2. Using the previously described antibodies for GRO{alpha} and fibulin-1, tissue paraffin-embedded samples containing normal colon, colon adenoma, and adenocarcinoma were examined to ascertain the magnitude and cellular pattern of expression of these proteins. Antibody to the receptor CXCR2 was employed to detect expression of that protein in colon cancer samples (rabbit polyclonal to CXCR2; Abcam, Cambridge, MA.).

Determination of gene copy number and loss of heterozygosity. Twenty-five primary colon cancer samples containing no more than 20% contamination from infiltrating stroma were employed to determine copy number changes and loss of heterozygosity (LOH) following the manufacturer's instructions (Genechip Human Mapping 50K Array Xba 240; Affymetrix, Santa Clara, CA). Using the supplied software (Copy Number Analysis tool), the regions where GRO{alpha} (4q13.3) and fibulin-1 (22q13.31) are located were analyzed for areas of LOH and copy number changes. When available, LOH and copy number were determined by probe sets within the gene of interest. When probes were unavailable within a gene, probe sets immediately either side of the gene were used, and the relevant values were averaged. Any region with a score of ≥5 was identified as an area of LOH. Copy number calls that varied >2 SDs from normal samples were considered as significantly gained or lost.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
GRO{alpha} and GRO{gamma} is highly expressed in colorectal cancer tissues. Expression profiles using the U133A GeneChip from 241 microdissected colon tissue samples were reviewed for GRO{alpha} mRNA expression. GRO{alpha} expression averaged 4.6-fold higher in primary adenocarcinomas (n = 132) than in normal colon epithelium (P < 0.001). Expression of GRO{alpha} in adenomas (n = 32) was also elevated relative to normal (P < 0.001), and in metastatic samples (32 liver and 20 lung), expression of GRO{alpha} was intermediate between normal colon mucosa and primary colon cancer (Fig. 1A ). The array data were confirmed by real-time PCR in paired normal and cancer samples from 16 patients (Fig. 1B). When normalized to glyceraldehyde-3-phosphate dehydrogenase, the expression of GRO{alpha} was 0.64 ± 0.07 in the normal tissue and 3.2 ± 0.64 in the cancer samples (P < 0.001). To confirm that overexpression is related to neoplastic epithelial cells rather than inflammatory cells or non-epithelial stroma, we did immunohistochemistry staining for GRO{alpha}, which established that GRO{alpha} was expressed by neoplastic colon epithelial cells rather than inflammatory cells (Fig. 2A ).


Figure 1
View larger version (12K):
[in this window]
[in a new window]
  		Fig. 1. A, mean gene expression level for GRO{alpha} mRNA in colon tissue samples. A total of 241 manually dissected samples were profiled using the Affymetrix U133A GeneChip. Columns, mean; bars, SE. The number of samples in each category is indicated beneath the sample type. *, P < 0.001, compared with normal mucosa. B, real-time PCR for GRO{alpha} mRNA in 16 colon cancer samples paired with normal mucosa. mRNA expression of GRO{alpha} is relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). bullet, measurements in carcinoma; {blacksquare}, measurements in normal mucosa. Solid line, mean mRNA expression for each group. P < 0.001 for the comparison.

 

Figure 2
View larger version (40K):
[in this window]
[in a new window]
  		Fig. 2. A, normal colon, adenoma, and adenocarcinoma reacted with antibody to GRO{alpha}. i, normal colonic mucosa shows no reactivity in the colonic epithelial cells or surrounding stroma of the lamina propria. ii, in contrast, GRO{alpha} is present in the cytoplasm of some epithelial cells of a colonic tubular adenoma. There is no stromal reactivity. iii, GRO{alpha} is also present in the cytoplasm of tumor cells in colonic adenocarcinoma. Again, there is no stromal reactivity. Toluidine blue counterstain. Original magnification, x20 (i), x10 (ii), and x40 (iii). B, normal colon, adenoma, and adenocarcinoma reacted with antibodies to fibulin-1. i, in normal tissue, antibody against fibulin-1 reveals a diffuse interstitial distribution in the lamina propria of the colon. The colonic glands are nonreactive with the anti-fibulin antibodies. ii, in contrast, only trace reactivity for fibulin is noted in the stroma surrounding the adenomatous glands. iii, the stroma surrounding the glandular elements of the adenocarcinoma is lacking any reactivity for fibulin. None of the glandular elements of the adenoma or carcinoma is reactive for fibulin. Hematoxylin counterstain. Original magnification, x20 (i), x10 (ii), and x40 (iii).

 
We also examined the mRNA expression of the GROß and GRO{gamma} genes because their protein products each serve as ligands for the CXCR2 receptor. Although expression of GROß did not vary between normal and neoplastic samples (P = 0.69), expression of GRO{gamma} expression averaged 8.0-fold higher in primary adenocarcinomas (n = 132) than in normal colon epithelium (P < 0.001). Expression of GRO{gamma} in adenomas (n = 32) and metastases (32 liver and 20 lung) was also elevated relative to normal (8.8-fold and 4.9-fold, respectively; P < 0.001 for all comparisons; Supplementary Fig. SA).

Expression of mRNA to the CXCR2 receptor was reduced in adenoma, primary colon cancer, and metastasis (P = 0.0017). The mean mRNA expression of this receptor was 23.1 ± 4.1 in normal epithelium, 14.6 ± 1.2 in the primary cancer, and 10.3 ± 1.4 in metastasis to lung and liver (Supplementary Fig. SB). Furthermore, immunostaining of tissue slices from cancer specimens for CXCR2 was variable and did not disclose the typical apical membrane pattern of staining that is observed for this receptor. This may imply that the target cell for GRO secretion by the neoplastic colon epithelial cell is not the colonocyte itself but a neighboring cell.

Growth of colorectal cancer cell line HCT-15 is inhibited by GRO{alpha} siRNA. To evaluate whether expression of GRO{alpha} is important to growth and viability of neoplastic colon cell lines, expression of GRO{alpha} mRNA was knocked down in HCT-15 colon cancer cells. Three stable HCT-15 GRO{alpha} siRNA expressing cell lines (SIMG-1, SIMG-4, and SIMG-5) were constructed. Reverse transcription-PCR documented that expression of GRO{alpha} mRNA relative to glyceraldehyde-3-phosphate dehydrogenase following knock down was reduced to ~50% to 60% of the level of expression in the control cell. The siRNA cell lines had a reduced rate of proliferation relative to the parental line or the control line (SIMG-C), which received a vector with no siRNA coding insert (Fig. 3A ). Expression of siRNA to GRO{alpha} was also associated with apoptosis in all three GRO{alpha} siRNA cell lines (Fig. 3B), consistent with the known role of the related chemokine (interleukin-8) in suppressing apoptosis in some types of cells (27, 28). The apoptotic index increased from ~10% in parental and control cells to 70% in cells receiving the GRO{alpha} targeting vector.


Figure 3
View larger version (22K):
[in this window]
[in a new window]
  		Fig. 3. A, top, constitutive expression of GRO{alpha} siRNA inhibits cell culture growth as measured by uptake of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (absorbance at 490 nm). Five experiments were done in duplicate. Growth of cells transfected with GRO{alpha} siRNA was reduced compared to the parental line HCT-15 or the line transfected with an empty vector (SIMG-C). Horizontal lines, average absorbance. Each mark represents a single well. A, bottom, Western analysis of cell lines expressing GRO{alpha} siRNA (SIMG-1) using mouse monoclonal anti-fibulin-1 (Santa Cruz Biotechnology). In human tissues, multiple isoforms of fibulin-1 are detected, accounting for the multiple bands. Fibulin-1 protein level was increased compared with levels in parental HCT-15 cell lines or cell lines transfected with empty vector (SIMG-C). Similar results were obtained in several other cell lines expressing GRO{alpha} siRNA. Each lane received 15 µg of protein. B, constitutive expression of GRO{alpha} siRNA is associated with apoptosis of HCT-15 colon cancer cells as shown by DNA ladders. Parental HCT-15 cells, HCT-15 cells containing empty vector (SIMG-C) and three lines expressing siRNA to GRO{alpha} (SIMG-1, SIMG-4, and SIMG-5) were grown as described. DNA was isolated from the cell lines, separated on a 1% agarose gel, and stained with ethidium bromide. Cell lines transfected with siRNA to GRO{alpha} displayed enhanced apoptosis relative to either the parental HCT-15 cell or the cells transfected with empty vector. Lane L, DNA ladder; lane 2, HCT-15; lane 3, SIMG-C (control); lane 4, SIMG-1; lane 5, SIMG-4; lane 6, SIMG-5.

 
Fibulin-1 expression is increased in HCT-15 cells transfected with siRNA to GRO{alpha}. To understand the molecular mechanism of GRO{alpha} function in oncogenesis, gene expression of cell lines SIMG-C (control cells) and SIMG-1 (containing siRNA to GRO{alpha}) was monitored using the Affymetrix U133 A GeneChip. mRNA expression of numerous genes varied by >4-fold (data on file). Prominently, expression of fibulin-1C and fibulin-1D increased 12.1- and 14.9-fold, respectively (see Supplementary Table S1). Consistent with this change in mRNA expression, Western analysis indicated that protein levels of fibulin-1 were higher in SIMG-1 and SIMG-4 than in SIMG-C and HCT-15 (Fig. 3A, bottom). Fibulin-1 is represented by several bands because the antibody recognized multiple isoforms in humans.

Fibulin-1 expression is abrogated by forced expression of GRO{alpha} in NIH 3T3 cells. These results in the HCT-15-derived colon cancer cell lines suggested that GRO{alpha} expression might suppress expression of fibulin-1. To test this hypothesis, NIH 3T3 fibroblasts were transfected with a vector containing a human cDNA for GRO{alpha}. Stable cell lines were selected by passage in G-418, and GRO{alpha} protein expression was confirmed by Western analysis (Fig. 4A ). Fibroblasts that received control vector with no insert (cell line PH) displayed normal growth characteristics. However, cell lines with forced expression of GRO{alpha} (lines MB and MD) displayed characteristics of transformed cells, including focus formation (data not shown) and loss of contact inhibition when grown in culture (Fig. 4B). Furthermore, s.c. injection of MB or MD cells into the flank of nude mice resulted in tumor growth within 17 days, whereas the control PH cells did not induce tumor growth after 60 days. These tumors had the histologic appearance of a fibrosarcoma (Fig. 4C).


Figure 4
View larger version (43K):
[in this window]
[in a new window]
  		Fig. 4. A, Western analysis with rat anti-human GRO{alpha} (U.S. Biologicals) showing that cell lines MB and MD express abundant GRO{alpha} protein. Three cell lines were employed: NIH-3T3 cells that received empty vector (PH) and two clones that were stably transfected with a cDNA coding GRO{alpha} (MB and MD). Each lane received 15 µg of protein. B, constitutive expression of GRO{alpha} in NIH 3T3 cells abrogates contact inhibition. NIH 3T3 cells containing the pcDNA3+ GRO{alpha} cDNA construct (MB and MD) initially grew at the same rate as NIH 3T3 cells containing only the pcDNA3 vector (PH). After the plates became confluent at 5 days, control cell cultures stopped growing. Conversely, MB and MD continued to grow beyond confluence. GRO{alpha}-containing lines continue to replicate for the duration of the experiment. C, a section of the xenograft tumor shows a densely cellular, spindle cell neoplasm beneath the epidermis (Ep). There is marked hyperchromasia of the tumor cells. Inset, higher magnification showing the nuclear hyperchromasia and pleomorphism, cellular atypica, and mitotic figure (arrow). H&E counterstain. Original magnification, x20 and x40 (inset). D, compared with control fibroblasts (PH), murine fibroblasts transfected with GRO{alpha} (MD and MD) expressed substantially less fibulin-1 when studied by Western analysis. E, inset, fibulin-1D was transfected into control fibroblasts (PH) and into fibroblasts already overexpressing GRO{alpha} (MB). Protein extract from four cell lines was probed by Western analysis using antibody to fibulin-1. Lane 1, PH + BABE (empty vector); lane 2, PH + fibulin-1D; lane 3, MB + BABE; lane 4, MB + fibulin-1D, clone 3. Three cell lines expressing GRO{alpha} and also transfected with empty vector, BABE formed tumors in nude mice (MBBABE 1-3). Tumor formation is completely abrogated by coexpression of fibulin-1D [MBFBLN(3) and MBFBLN (6)]. x-axis, weeks following injection of 105 cells; y-axis, tumor volume. F, mean gene expression level for fibulin-1C and fibulin-1D mRNA in colon tissue samples. A total of 241 manually dissected samples were profiled using the Affymetrix U133A GeneChip. Columns, mean; bars, SE. The number of samples in each category is indicated beneath the sample type. Fibulin-1C and fibulin-1D mRNA expression was suppressed in all neoplastic tissue relative to expression normal tissue (P < 0.0001 for each comparison, ANOVA with Bonferroni correction).

 
Next, fibulin-1 expression was examined in MB and MD cells by Western analysis. Consistent with the hypothesis that GRO{alpha} negatively regulates fibulin-1 expression, fibulin-1 expression was suppressed in MB and MD cells (Fig. 4D), complementing the results of the GRO{alpha} siRNA experiments.

To learn whether down-regulation of fibulin-1 was important to the transformation of NIH 3T3 cells by GRO{alpha}, cell lines that overexpressed both GRO{alpha} and fibulin-1D were created by transfecting MD cells with a fibulin-1D construct (Fig. 4E, inset). These resulting neomycin/puromycin–resistant stable cell lines MBFBLN(3) and MBFBLN(6) grew more slowly than the MB cells, in which only GRO{alpha} was overexpressed (data not shown). To test whether forced expression of fibulin-1D could delay or abrogate GRO{alpha} cellular transformation, 2 x 105 MBFBLN(3) and MBFBLN(6) cells were injected in the flanks of nude mice, with injection of MB cells transfected with empty BABE vector served as the control. As expected, control MB cells induced tumor growth after 4 weeks (Fig. 4E). MBFBLN(3) and MBFBLN(6) cells did not produce tumors over the 5-month observation period.

Fibulin-1C and fibulin-1D expression is reduced in human colorectal cancer. To extend these observations to human colorectal cancer, Affymetrix gene expression profiles from the same 241 colon samples were reviewed for expression of fibulin-1C and fibulin-1D mRNA. Expression of both isoforms was significantly reduced in primary colon cancer, polyps, and liver or lung metastasis relative to normal tissue (P < 0.0001 for each comparison, ANOVA with Bonferroni correction; Fig. 4F). The array data were confirmed by real-time PCR in paired normal and cancer samples from 16 patients. To extend the information about fibulin-1 to the tissue and protein level, immunohistochemistry images were obtained after probing colon cancer tissue samples with anti-GRO{alpha} and anti-Fiblin-1. These images revealed elevated GRO{alpha} expression and attenuated stromal fibulin-1 protein expression in colon cancer samples. Representative images are shown in Fig. 2.

Single nucleotide polymorphism analysis does not reveal consistent changes in GRO{alpha} or fibulin-1 at the DNA level. To evaluate the possible role of GRO{alpha} gene amplification or chromosomal duplication in producing elevated GRO{alpha} expression, single nucleotide polymorphism array analysis was done on 25 primary cancer samples. This analysis revealed frequent LOH in chromosomal regions that contain the GRO{alpha} gene (7 samples from a total of 26). Interestingly, LOH was not always accompanied by a loss in copy number: five samples were copy number neutral of the seven samples showing LOH, implying gene conversion events were also occurring. Furthermore, LOH in regions containing the fibulin-1 gene showed LOH in three samples and three different samples showed copy number changes (two decreases and one increase). These data imply that the down-regulation of fibulin-1 mRNA expression is due to a decrease in transcriptional activity and not to a decrease in copy number. Interestingly, tumor samples that showed LOH in regions containing the GRO{alpha} gene showed no difference in mRNA expression when compared with those samples that showed no LOH. This observation suggests that the regulatory mechanism that is common to most clinical samples and that leads to the marked increase in GRO{alpha} expression is not related to the infrequent and inconsistent genetic changes seen at the DNA level. Furthermore, sequencing of the GRO{alpha} cDNA in several samples with elevated expression and LOH revealed no mutations of the coding region.


   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
GRO{alpha} is regarded as a proinflammatory, chemotactic molecule that affects leukocyte migration (29) and stimulates cell proliferation (14). It also functions in wound repair and inflammation, attracts neutrophils, and promotes angiogenesis (4, 5). The current work aims to define the role of GRO{alpha} overexpression in colorectal cancer and the involvement of the subsequent down-regulation of the extracellular matrix protein fibulin-1.

GRO{alpha} protein is highly expressed by melanoma cell lines and melanomas but not in normal melanocytes (30). The involvement of GRO{alpha} in melanoma tumorigenesis has been well established and reviewed (1, 31). GRO{alpha} expression is also increased in other malignancies, such as adrenal cancer (32), squamous cell carcinoma (33), and prostate cancer (34). The current report shows that this chemokine is overexpressed and plays an important role in colorectal cancer.

In melanoma, overexpression of GRO{alpha} up-regulates M-ras expression at both the mRNA and protein levels, and it is likely that ras activation is required for MGSA/GRO{alpha}–mediated transformation in melanocytes (30), through a ras/mitogen-activated protein kinase kinase kinase 1/p38/nuclear factor {kappa}B–mediated cascade (18). The roles of activating k-ras mutations in colon cancer are well established (35, 36); however, we found no difference in GRO{alpha} or fibulin-1 mRNA expression levels in clinical samples containing these mutations compared with their wild-type counterparts (data not shown).

Using a combination of Affymetrix GeneChip experiments and real-time PCR, we found GRO{alpha} overexpression at the mRNA level in microdissected adenomas, primary cancers, and metastases. A subsequent increase in expression of GRO{alpha} at the protein level was confirmed by immunohistochemistry in tissue microarrays. Of particular significance, the immunohistochemistry results indicate that the GRO{alpha} protein is secreted by the neoplastic colon epithelial cells, rather than by nonresident inflammatory cells. A role for GRO{alpha} in the initiation of colon cancer is given further indirect support by the observation that GRO{alpha} expression is elevated in the intestinal mucosa of individuals with ulcerative colitis, a disease that is a known risk factor for colon cancer (37, 38).

Forced expression of GRO{alpha} in rodent fibroblasts was associated with transformation of the cells (focus formation, loss of contact inhibition, and tumor formation in a xenograft model). The resulting cells overexpressed GRO{alpha} and produced fibrosarcoma when injected s.c. into athymic mice. Expression profiles of these transformed fibroblasts revealed that expression of fibulin-1C and fibulin-1D was markedly reduced compared with the parent cells, consistent with our findings in clinical colorectal samples.

Fibulin-1 is a member of a family of glycoproteins found in extracellular matrix and blood (39). There are six reported members of the fibulin family, which contain a series of epidermal growth factor–like modules coupled to a COOH-terminal fibulin module. Fibulin-1 has at least four splice variants (A-D), which vary in the COOH-terminal fibulin-type molecule. It can self-associate and bind to extracellular matrix proteins, including fibronectin, laminin, and to the coagulation protein fibrinogen (40), and is found in basement membrane and in loose connective tissues associated with matrix fibers (41, 42). Fibulins probably form intramolecular bridges that stabilize supramolecular extracellular matrix structures (39). In addition to its clear structural role, studies in a tumor model and in Caenorhabditis elegans also suggest that fibulin-1 has a role in controlling directed cell migration (43).

A role for down-regulation of fibulin in tumorigenesis was initially suggested because tumors formed by s.c. injection of carcinogen-transformed MSU 1.1 cells into athymic mice display marked down-regulation of fibulin-1D mRNA (44). Furthermore, 80% of malignant cell lines derived from human fibrosarcomas show attenuated expression of this mRNA. In contrast, studies conducted in breast and ovarian cancers have shown an increase in fibulin-1 protein expression when compared with control tissue (45, 46). These differences are likely to be due to tissue-specific factors and possibly hormonal regulation. Although it has been suggested that an increase in the ratio between fibulin-1C and fibulin-1D is important, where fibulin-1C acts as an oncogene and fibulin-1D acts as a tumor suppressor (47), we found a decrease in both fibulin-1C and fibulin-1D isoforms associated with GRO{alpha} overexpression and in human clinical samples.

Forced expression of fibulin-1D resulted in extended latency in tumor formation in athymic mice and reduced the ability of these cells to form colonies in soft agar (25). These results are consistent with our xenograft model in which forced expression of GRO{alpha} suppresses expression of fibulin-1C and fibulin-1D and promotes fibrosarcoma formation. Conversely, we report that restoring expression of fibulin-1D prevents tumor formation. Furthermore, ectopic expression of fibulin-1D also inhibits cellular transformation by the papillomavirus E6 gene (26).

Other evidence to support that fibulin-1 acts as a tumor suppressor (48) has come from studies showing that forced expression of fibulin-1D inhibits the motility of breast carcinoma cells on fibronectin (47). In preliminary studies, we have observed that expression of GRO{alpha} impairs assembly of fibronectin matrix (data not shown).

Our work also extends some of these experimental results to clinical samples. Immunohistologic examination clearly shows that abnormal colon epithelial cells are the origin of the robust expression of GRO{alpha} in neoplastic samples. Furthermore, fibulin-1 protein expression along the glandular basement membrane was clearly and significantly suppressed in colon adenocarcinoma. Abnormal expression of GRO{alpha} and fibulin-1 seems to be a relatively early event in the development of colon cancer because GRO{alpha} expression was significantly elevated and fibulin-1 expression significantly reduced even in the adenomas that we sampled. Indeed, in the GeneChip experiments, expression of fibulin-1C and fibulin-1D in the polyps was even lower than in the primary carcinoma samples (P < 0.001). However, this could simply represent different proportions of non-epithelial constituents in the adenoma and the primary cancers.

Single nucleotide polymorphism arrays conducted on primary colon cancers showed no marked change in copy number to explain the up-regulation of GRO{alpha}. Likewise, there was no significant loss of gene regions encompassing fibulin-1. Furthermore, there was no significant difference in expression levels in samples that showed LOH compared with those that did not. These findings are consistent with the transcriptional regulation of GRO{alpha}.

Regulation of GRO{alpha} expression is complex and has not been completely elucidated. Exposure of HT-29 cells to tumor necrosis factor-{alpha} results in augmented expression of GRO{alpha} (49, 50). Shiga toxins (Stxs) also induce GRO{alpha} mRNA and protein in intestinal epithelial cells, perhaps by stabilizing GRO{alpha} mRNA (21), and several other proinflammatory signals have been shown to increase GRO{alpha} mRNA stability (19). On the other hand, transcriptional regulation is also important in GRO{alpha} mRNA expression, involving cis-acting elements interacting with factors, such as nuclear factor {kappa}B, Sp1, and an immediate upstream element that interacts with the CCAAT displacement protein (23). Whether mRNA stabilization or transcriptional derepression is involved in the up-regulation of GRO{alpha} in colon cancer is not known and is the subject of ongoing experiments. Although we did not investigate the role of the closely related gene GRO{gamma} in colon cancer, the observation that it is also significantly dysregulated implies either a common mechanism of regulation with GRO{alpha} or a cancer-promoting effect (or both). By elucidating the mechanism by which GRO{alpha} promotes colon cancer, therefore, it will be possible to gain a sharper understanding of the role of the other CXCR2 ligands in this process.

In summary, in both human samples and an experimental fibrosarcoma model, elevated expression of GRO{alpha} is associated with down-regulation of fibulin-1C and fibulin-1D mRNA and protein expression. Histologic examination indicates that in adenocarcinoma samples, the surrounding stoma is depleted of fibulin-1. GRO{alpha} is a secreted protein, and it seems likely that secreted GRO{alpha} from malignant colonocytes diffuses to the surrounding stroma, inhibiting expression of fibulin-1. It remains to be clarified whether this effect is mediated by the CXCR2 receptor. Fibulin-1 is known to participate in the organization of the basement membrane and other ECM structures and also to suppress the motility of breast carcinoma and fibrosarcoma cells. We hypothesize, therefore, that abrogation of fibulin-1 expression facilitates the ability of neoplastic cells to permeate the basement membrane and to spread contiguously and through metastasis. Furthermore, we showed that inhibition of GRO{alpha} expression induced apoptosis in HCT-15 cell lines (Fig. 3B), suggesting the hypothesis that an additional role of GRO{alpha} in facilitating tumor formation is to inhibit apoptosis.

Increased GRO{alpha} expression by neoplastic colon epithelial cells is a regular feature of adenocarcinoma of the colon and is associated with down-regulation of fibulin-1. The resulting inhibition of apoptosis and depletion of fibulin-1 could facilitate progression and spread of disease. Therefore, targeting these proteins may provide new opportunities for treatment of colon cancer.


   Acknowledgments
 
We thank Dr. J. Bertino for his review of the article.


   Footnotes
 
Grant support: NIH/National Cancer Institute grant P01-CA65930.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/).

Affymetrix experiments were done by the Shared Gene Expression Resource of the Cancer Institute of New Jersey and supported by NIH/National Cancer Institute grant P30-CA072720.

Received 3/24/06; revised 6/29/06; accepted 8/ 1/06.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Luan J, Shattuck-Brandt R, Haghnegahdar H, et al. Mechanism and biological significance of constitutive expression of MGSA/GRO chemokines in malignant melanoma tumor progression. J Leukoc Biol 1997;62:588–97.[Abstract]
  2. Haghnegahdar H, Du J, Wang D, et al. The tumorigenic and angiogenic effects of MGSA/GRO proteins in melanoma. J Leukoc Biol 2000;67:53–62.[Abstract]
  3. Notterman DA, Alon U, Sierk AJ, Levine AJ. Transcriptional gene expression profiles of colorectal adenoma, adenocarcinoma, and normal tissue examined by oligonucleotide arrays. Cancer Res 2001;61:3124–30.[Abstract/Free Full Text]
  4. Hogan M, Sherry B, Ritchlin C, et al. Differential expression of the small inducible cytokines GRO {alpha} and GRO ß by synovial fibroblasts in chronic arthritis: possible role in growth regulation. Cytokine 1994;6:61–9.[CrossRef][Medline]
  5. Rennekampff H, Hansbrough J, Woods V, Dore C, Kiessig V, Schroder J. Role of melanoma growth stimulatory activity (MGSA/gro) on keratinocyte function in wound healing. Arch Dermatol Res 1997;289:204–12.[CrossRef][Medline]
  6. Lane BR, Strieter RM, Coffey MJ, Markovitz DM. Human immunodeficiency virus type 1 (HIV-1)-induced GRO-{alpha} production stimulates HIV-1 replication in macrophages and T lymphocytes. J Virol 2001;75:5812–22.[Abstract/Free Full Text]
  7. Filipovic R, Jakovcevski I, Zecevic N. GRO-{alpha} and CXCR2 in the human fetal brain and multiple sclerosis lesions. Dev Neurosci 2003;25:279–90.[CrossRef][Medline]
  8. Tsai H-H, Frost E, To V, et al. The chemokine receptor cxcr2 controls positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. Cell 2002;110:373–83.[CrossRef][Medline]
  9. Xia M, Hyman B. GRO{alpha}/KC, a chemokine receptor CXCR2 ligand, can be a potent trigger for neuronal ERK1/2 and PI-3 kinase pathways and for tau hyperphosphorylation-a role in Alzheimer's disease? J Neuroimmunol 2002;122:55–64.[CrossRef][Medline]
  10. Ahuja S, Murphy P. The cxc chemokines growth-regulated oncogene (gro) {alpha}, groß, gro{gamma}, neutrophil-activating peptide-2, and epithelial cell-derived neutrophil-activating peptide-78 are potent agonists for the type b, but not the type a, human interleukin-8 receptor. J Biol Chem 1996;271:20545–50.[Abstract/Free Full Text]
  11. Devalaraja M, Richmond A. Multiple chemotactic factors: fine control or redundancy? TiPS 1999;20:151–6.
  12. Owen J, Strieter R, Burdick M, et al. Enhanced tumor-forming capacity for immortalized melanocytes expressing melanoma growth stimulatory activity/growth-regulated cytokine ß and {gamma} proteins. Int J Cancer 1997;73:94–103.[CrossRef][Medline]
  13. Rosenkilde M, Schwartz T. Potency of ligands correlates with affinity measured against agonist and inverse agonists but not against neutral ligand in constitutively active chemokine receptor. Mol Pharmacol 2000;57:602–9.[Abstract/Free Full Text]
  14. Cochran BJ, Reffel AC, Stiles CD. Molecular cloning of gene sequences regulated by platelet-derived growth factor. Cell 1983;33:939–47.[CrossRef][Medline]
  15. Golds E, Mason P, Nyirkos P. Inflammatory cytokines induce synthesis and secretion of gro protein and a neutrophil chemotactic factor but not ß 2-microglobulin in human synovial cells and fibroblasts. Biochem J 1989;259:585–8.[Medline]
  16. Anisowicz A, Messineo M, Lee SW, Sager R. An NF-{kappa} B-like transcription factor mediates IL-1/TNF-{alpha} induction of gro in human fibroblasts. J Immunol 1991;147:520–7.[Abstract]
  17. Fan G-H, Yang W, Sai J, Richmond A. Phosphorylation-independent association of CXCR2 with the protein phosphatase 2A core enzyme. J Biol Chem 2001;276:16960–8.[Abstract/Free Full Text]
  18. Wang D, Richmond A. Nuclear actor-{kappa} B activation by the CXC chemokine melanoma growth-stimulatory activity/growth-regulated protein involves the MEKK1/p38 mitogen-activated protein kinase pathway. J Biol Chem 2001;276:3650–9.[Abstract/Free Full Text]
  19. Biswas R DS, Gupta JD, Novotny M, Tebo J, Hamilton TA. Regulation of chemokine mRNA stability by lipopolysaccharide and IL-10. J Immunol 2003;170:6202–8.[Abstract/Free Full Text]
  20. Wang D, Sai J, Richmond A. Cell surface heparan sulfate participates in CXCL1-induced signaling. Biochemistry 2003;42:1071–7.[CrossRef][Medline]
  21. Thorpe C, Smith W, Hurley B, Acheson D. Shiga toxins induce, superinduce, and stabilize a variety of C-X-C chemokine mRNAs in intestinal epithelial cells, resulting in increased chemokine expression. Infection Immunity 2001;69:6140–7.[Abstract/Free Full Text]
  22. Wood L, Farmer A, Richmond A. HMGI(Y) and Sp1 in addition to NF-{kappa} B regulate transcription of the MGSA/GRO {alpha} gene. Nucleic Acids Res 1995;23:4210–9.[Abstract/Free Full Text]
  23. Nirodi C, Hart J, Dhawan P, Moon N-s, Nepveu A, Richmond A. The role of CDP in the negative regulation of CXCL1 gene expression. J Biol Chem 2001;276:26122–31.[Abstract/Free Full Text]
  24. Wang D, Sai J, Carter G, Sachpatzidis A, Lolis E, Richmond A. PAK1 kinase is required for CXCL1-induced chemotaxis. Biochemistry 2002;41:7100–7.[CrossRef][Medline]
  25. Qing J, Maher V, Tran H, Argraves W, Dunstan R, McCormick J. Suppression of anchorage-independent growth and Matrigel invasion and delayed tumor formation by elevated expression of fibulin-1D in human fibroblastoma-derived cell lines. Oncogene 1997;15:2159–68.[CrossRef][Medline]
  26. Du M, Fan X, Hong E, Chen JJ. Interaction of oncogenic papillomavirus E6 proteins with fibulin-1. Biochem Biophys Res Commun 2002;296:962–9.[CrossRef][Medline]
  27. Grutkoski P, Graeber C, Ayala A, Simms H. Paracrine suppression of apoptosis by cytokine-stimulated neutrophils involves divergent regulation of NF-{kappa}B, Bcl-X(L), and Bak. Shock 2002;17:47–54.[CrossRef][Medline]
  28. Leuenroth S, Lee C, Grutkoski P, Keeping H, Simms H. Interleukin-8-induced suppression of polymorphonuclear leukocyte apoptosis is mediated by suppressing CD95 (Fas/Apo-1) Fas-1 interactions. Surgery 1998;124:409–17.[Medline]
  29. Baggiolini M. Chemokines and leukocyte traffic. Nature 1998;392:565–8.[CrossRef][Medline]
  30. Wang D, Yang W, Du J, et al. MGSA/GRO-mediated melanocyte transformation involves induction of Ras expression. Oncogene 2000;19:4647–59.[CrossRef][Medline]
  31. Dhawan P, Richmond A. Role of CXCL1 in tumorigenesis of melanoma. J Leukoc Biol 2002;72:9–18.[Abstract/Free Full Text]
  32. Schteingart DE, Giordano TJ, Benitez RS, et al. Overexpression of CXC chemokines by an adrenocortical carcinoma: a novel clinical syndrome. J Clin Endocrinol Metab 2001;86:3968–74.[Abstract/Free Full Text]
  33. Loukinova E, Dong G, Enamorado-Ayalya I, et al. Growth regulated oncogene-a expression by murine squamous cell carcinoma promotes tumor growth, metastasis, leukocyte infiltration and angiogenesis by a host CXC Receptor-2 dependent mechanism. Oncogene 2000;19:3477–86.[CrossRef][Medline]
  34. Moore BB, Arenberg DA, Stoy K, et al. Distinct CXC chemokines mediate tumorigenicity of prostate cancer cells. Am J Pathol 1999;154:1503–12.[Abstract/Free Full Text]
  35. Jacoby R, Alexander R, Raicht R, Brasitus T. K-ras oncogene mutations in rat colon tumors induced by N-methyl-N-nitrosourea. Carcinogenesis 1992;13:45–9.[Abstract/Free Full Text]
  36. de Jong TA, Skinner SA, Malcontenti-Wilson C, et al. Inhibition of rat colon tumors by sulindac and sulindac sulfone is independent of K-ras (codon 12) mutation. Am J Physiol Gastrointest Liver Physiol 2000;278:G266–72.[Abstract/Free Full Text]
  37. Imada A, Ina K, Shimada M, et al. Coordinate upregulation of interleukin-8 and growth-related gene product-a is present in the colonic mucosa of inflammatory bowel disease. Scand J Gastroenterol 2001;36:854–64.[Medline]
  38. Munkholm P. The incidence and prevalence of colorectal cancer in inflammatory bowel disease. Aliment Pharmacol Ther 2003;18:1–5.[Medline]
  39. Argraves W, Tran H, Burgess W, Dickerson K. Fibulin is an extracellular matrix and plasma glycoprotein with repeated domain structure. J Cell Biol 1990;111:3155–64.[Abstract/Free Full Text]
  40. Hayashido Y, Lucas A, Rougeot C, Godyna S, Argraves W, Rochefort H. Estradiol and fibulin-1 inhibit motility of human ovarian- and breast-cancer cells induced by fibronectin. Int J Cancer 1998;75:654–8.[CrossRef][Medline]
  41. Roark E, Keene D, Haudenschild C, Godyna S, Little C, Argraves W. The association of human fibulin-1 with elastic fibers: an immunohistological, ultrastructural, and RNA study. J Histochem Cytochem 1995;43:401–11.[Abstract]
  42. Pupa S, Argraves W, Forti S, et al. Immunological and pathobiological roles of fibulin-1 in breast cancer. Oncogene 2004;23:2153–60.[CrossRef][Medline]
  43. Kubota Y, Kuroki R, Nishiwaki K. A fibulin-1 homolog interacts with an ADAM protease that controls cell migration in C. elegans. Curr Biol 2004;14:2011–8.[CrossRef][Medline]
  44. Qing J, Wei D, Maher VM, McCormick JJ. Cloning and characterization of a novel gene encoding a putative transmembrane protein with altered expression in some human transformed and tumor-derived cell lines. Oncogene 1999;18:335–42.[CrossRef][Medline]
  45. Greene L, Twal W, Duffy M, et al. Elevated expression and altered processing of fibulin-1 protein in human breast cancer. Br J Cancer 2003;88:871–8.[CrossRef][Medline]
  46. Moll F, Katsaros D, Lazennec G, et al. Estrogen induction and overexpression of fibulin-1C mRNA in ovarian cancer cells. Oncogene 2002;21:1097–107.[CrossRef][Medline]
  47. Twal WO, Czirok A, Hegedus B, et al. Fibulin-1 suppression of fibronectin-regulated cell adhesion and motility. J Cell Sci 2001;114:4587–98.
  48. Gallagher WM, Currid CA, Whelan LC. Fibulins and cancer: friend or foe? Trends Mol Med 2005;11:336–40.[CrossRef][Medline]
  49. Panja A, Goldberg S, Eckmann L, Krishen P, Mayer L. The regulation and functional consequence of proinflammatory cytokine binding on human intestinal epithelial cells. J Immunol 1998;161:3675–84.[Abstract/Free Full Text]
  50. Shattuck R, Wood L, Jaffe G, Richmond A. MGSA/GRO transcription is differentially regulated in normal retinal pigment epithelial and melanoma cells. Mol Cell Biol 1994;14:791–802.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Cancer Res.Home page
M. D. Bacolod, G. S. Schemmann, S. Wang, R. Shattock, S. F. Giardina, Z. Zeng, J. Shia, R. F. Stengel, N. Gerry, J. Hoh, et al.
The Signatures of Autozygosity among Patients with Colorectal Cancer
Cancer Res., April 15, 2008; 68(8): 2610 - 2621.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wen, Y.
Right arrow Articles by Notterman, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wen, Y.
Right arrow Articles by Notterman, D.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Can