
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cancer Therapy: Preclinical |
Authors' Affiliations: Departments of 1 Radiation Oncology, 2 Experimental Therapeutics, 3 Pathology, and 4 Gastrointestinal Medical Oncology, The University of Texas M.D. Anderson Cancer Center, Houston, Texas and 5 Department of Radiation Oncology, Radboud University Nijmegen Medical Center, Nijmegen, The Netherlands
Requests for reprints: K.S. Clifford Chao, Department of Radiation Oncology, University of Texas M.D. Anderson Cancer Center, Unit 97, 1515 Holcombe Boulevard, Houston, TX 77030. Phone: 713-563-2300; Fax: 713-563-2331; E-mail: cchao{at}mdanderson.org.
| Abstract |
|---|
|
|
|---|
Experimental Design: The expression and temporal kinetics of Hh signaling and proliferation biomarkers after chemoradiotherapy were examined in esophageal tumor xenografts. Additionally, immunohistochemical analysis of Sonic Hh (Shh) and Gli-1 expression were done on residual tumors from patients who received neoadjuvant chemoradiotherapy followed by surgery. The ability of Shh signaling to induce proliferation in esophageal cell lines was determined. Expression of cell cycle checkpoint proteins was analyzed in cells in which Hh signaling was activated or inhibited. We further determined the effect of inhibiting Hh signaling in sensitizing esophageal tumors to radiation.
Results: We showed that the Shh signaling pathway was extensively activated in esophageal cancer xenografts and residual tumors after chemoradiotherapy and the temporal kinetics of Hh signaling preceded increases in proliferation biomarker expression and tumor size during tumor regrowth. We further showed that Hh pathway activity influences proliferation rates of esophageal cancer cell lines through up-regulation of the G1-cyclin-Rb axis. Additionally, we found that blocking Hh signaling enhanced radiation cytotoxicity of esophageal cancer cells.
Conclusions: These results suggest that activation of the Hh pathway may promote tumor repopulation after chemoradiotherapy and contribute to chemoradiation resistance in esophageal cancers.
An increase in tumor cell proliferation rates after exposure to chemotherapy (6) and radiation (68) contributes to tumor resistance and regrowth (6, 7). As the rate of regeneration of tumor cells increases, the effectiveness of each treatment is reduced, implying repopulation by a chemoradiotherapy-resistant clonogenic population in between treatment fractions (6). Previous studies have suggested that unregulated progenitor cell proliferation induced by abnormal activation of the Hh signaling pathway contributes to carcinogenesis of the digestive tract tissues (9, 10). Activation of Hh signaling by binding of secreted Hh ligands (Sonic, Indian, and Desert) to the membrane receptor Patched results in the nuclear translocation and activation of transcription factors of the Gli family (11, 12), whose targets include genes controlling the cell cycle, cell adhesion, signal transduction, angiogenesis, and apoptosis (13). Additionally, Gli-1 is a transcriptional target of the Hh pathway (14), providing positive feedback for Hh signaling. Treatment of cancer cell lines with the Hh-inhibitory compound cyclopamine results in down-regulation of the proliferation marker Ki67 and reduced proliferation rates (9, 15, 16), indicating that Hh pathway activation may be essential for tumor growth and maintenance. However, the significance of Hh signaling in chemoradiotherapy-resistant tumors is not clear. Here, we provide evidence that release of Shh ligand and subsequent activation of the Hh signaling pathway may support tumor repopulation after chemoradiotherapy. Therefore, the Hh pathway is a potential target for improving responses to chemoradiotherapy.
| Materials and Methods |
|---|
|
|
|---|
Patient selection and tissue specimens. Cancer specimens were obtained from 43 patients that participated in clinical trials approved by the University of Texas M.D. Anderson Institutional Review Board. Patients with localized (T1N1, T2-T3 with any N or with M1a) and histologically confirmed adenocarcinoma or squamous cell carcinoma of the thoracic esophagus received preoperative chemoradiation followed by transthoracic or transhiatal esophagectomy that included mediastinal and celiac lymphadenectomy. Tissue specimens in this report were residual esophageal cancerresected specimens. Each esophageal-resected specimen was examined in a very elaborated manner (17) and was reverified by one experienced gastrointestinal pathologist (T.T.W.) who had no knowledge of patient outcome. The pathologic response was determined in the resected esophagus and was assigned two categories: no residual carcinoma in the esophagus (pathCR), or any residual carcinoma in the resected specimen (<pathCR). Tissue specimens were acquired through an approved protocol by the University of Texas M.D. Anderson Institutional Review Board and after informed consent from patients. All cancer tissues sections were matched with routine H&E-stained slides used to evaluate for the presence of cancer cells by one gastrointestinal specialized pathologist (T.T.W.).
Mouse tumor model. Five-month-old Swiss nu/nu mice were obtained from the specific pathogen-free mouse colony of the Department of Experimental Radiation Oncology, M.D. Anderson Cancer Center, Houston, TX. Single SEG-1 tumor xenografts were generated in the right hind limbs of the mice by i.m. injection of 10 µL of a single-cell suspension of 1 x 106 tumor cells. Once the tumors achieved a mean diameter of 8 mm, measured by three orthogonal diameters with Vernier calipers, the mice were randomly partitioned to different treatment groups (described below).
Chemoradiotherapy treatment of xenografts. Sequential chemoradiotherapy was given to the mice as previously described (18). The docetaxel (Sigma Chemical Co., St. Louis, MO) treatment solution was prepared by mixing 1 volume of ethanolic stock solution (50 mg/mL) of docetaxel, 1 volume of polysorbate 80 (Sigma, St. Louis, MO), and 19 volumes of 5% glucose in water. The i.v. injection volume per mouse was 33 mg/kg, or 0.4 mL for a 30-g mouse. This dose of docetaxel is roughly equivalent to the clinically used human dose of 100 mg/m2. Tumors were locally irradiated 24 hours after docetaxel treatment with a single 15-Gy dose using a small-animal 137Cs irradiator (Nasatron, U.S. Nuclear, Burbank, CA). Radiation was given under ambient-air breathing conditions at a dose rate of 5.4 Gy/min. During irradiation, the unanesthetized mice were mechanically immobilized on a jig, and the tumor was centered in a circular field 3 cm in diameter. Tumor diameters were determined every other day to monitor growth.
Immunofluorescence staining. Pimonidazole [1-((2-hydroxy-3-piperidinyl)propyl)-2-nitroimidazolehydrochloride; Sigma] was used as a marker of hypoxia. Pimonidazole (20 mg/mL) was combined with the perfusion marker Hoechst 33342 (Serva, Heidelberg, Germany; 3.75 mg/mL), and 0.1 mL of this solution was injected i.v. in the tail vein of each mouse. The S-phase marker bromodeoxyuridine (Sigma; 2.5 mg/mL) was injected i.p. at a dose of 0.5 mL. Pimonidazole/Hoechst and bromodeoxyuridine were injected 25 minutes before the animals were killed by cervical dislocation. Tumors were removed immediately, and frozen sections were made and stained as previously described (19).
Immunohistochemistry and protein expression. Immunohistochemical staining for Shh and Gli-1 was done on 4-µm formalin-fixed, paraffin-embedded adjacent sections of SEG-1 tumor xenografts and human residual cancer obtained after esophagectomy. Rabbit polyclonal antibodies Shh (H-160; concentration, 2 µg/mL) and Gli-1 (H-330; concentration, 4 µg/mL) were obtained from Santa Cruz Biotechnology. The immunohistochemical procedure was carried out as previously described (20), with some modifications. After deparaffination and rehydration, antigen retrieval was done in a steamer for 30 minutes at 90°C using an acidic solution (Vector Laboratories, Inc., Burlingame, CA). Primary antibodies were incubated overnight at 4°C. As negative controls for determining the specificity of the immunostaining results, we pretreated with blocking peptide (Shh), omitted the primary antibody (Gli-1), and stained a paraffin-embedded pellet of SEG-1 human esophageal adenocarcinoma, known to express an activated Hh pathway (ref. 9; Fig. 1A and B ). As a positive control, we used paraffin-embedded cell pellets of SEG-1 that were placed on the same slide that the human or xenografts tissues (Fig. 1C and D).
|
30% to <60% tumor cell stained), and strong expression (
60% tumor cell stained). These groups were defined based on the quartile distribution of the Gli-1 labeling indices, the median (range) being 0.4 (0.03-0.9). Immunoreactions were independently analyzed by three investigators (J.G.I., T.T.W., and U.M.) unaware of the clinical data. In the discrepant cases, a final opinion was made on consensus by all three investigators. Proliferation assays. Cell proliferation was measured using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Briefly, 5,000 cells were seeded in 96-well plates and incubated in culture medium overnight. Cells were then treated with 200 ng/mL Shh NH2-terminal peptide (R&D Systems, Minneapolis, MN), 10 µmol/L cyclopamine (LC Labs, Woburn, MA) or transfected with Control or Gli-1 small interfering RNA (siRNA) for 48 hours. At the end of the treatment exposure time, 10 µL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma) at a concentration of 10 mg/mL in PBS was added, and the cells were incubated for a further 4 hours at 37°C. Subsequently, 100 µL of DMSO (Sigma) was added, and the plate was incubated for 5 minutes at 37°C to dissolve the formazan crystals. The absorbance was measured at a wavelength of 570 nm on a microplate reader (BioTek, Winooski, VT). Each experiment was repeated at least thrice in triplicate. Results represented the absorbance ratio between the treated and untreated cells at indicated time points. For DNA synthesis studies, cells were treated with 200 ng/mL Shh NH2-terminal peptide (R&D Systems) for 48 hours or transiently transfected with pCDNA3.1-Gli-1 (21), using Fugene transfection reagent (Roche Applied Biosciences, Indianapolis, IN), according to the manufacturer's instructions 48 hours before the addition of media containing 1 µCi of 3H-thymidine (Sigma-Aldrich, St. Louis, MO). Cells were incubated for an additional 24 hours and then lysed with 10 mol/L NaOH. Radioactivity of cell lysates was measured using a liquid scintillation counter (Tri-Carb 2100TR, Packard, Meridian, CT). Cells treated with PBS or cells transfected with pCNA3.1 vector served as controls. Experiments were done thrice in triplicate.
Immunoblot analysis. SEG-1 cells were plated at 50% confluency in 100-cm plates and grown overnight. Cells were treated with 100 ng/mL recombinant Shh NH2-terminal peptide for 24 hours before lysis or with 10 µmol/L forskolin, 10 µmol/L cyclopamine, or 100 nmol/L siRNA for 48 hours before lysis. Cells were lysed with radioimmunoprecipitation assay buffer, and protein concentrations were determined using the Bradford assay (Bio-Rad, Hercules, CA). Western blot analysis, using 75 µg of protein, was done as previously described (22).
RNA interference. Double-stranded, purified siRNAs were purchased from Ambion (Austin, TX). The sequences for the Gli-1 and control siRNAs were AACUCCACAGGCAUACAGGAU and AACGUACGCGGAAUACAACGA, respectively. The siRNAs were transfected into cells at 100 nmol/L using Lipofectin (Invitrogen, San Diego, CA) according to the manufacturer's instructions.
Cell cycle analysis. Cells were collected by trypsinization 48 hours after exposure to 10 µmol/L forskolin, 10 µmol/L cyclopamine, or 100 nmol/L siRNA or 24 hours after exposure to radiation (4 Gy). The cells were fixed with 100% ethanol, stained with 10 µg/mL propidium iodide and 5 µg/mL RNase A, and analyzed for fluorescence using a FACScan flow cytometer (Becton Dickinson, San Diego, CA). The proportion of cells in sub-G0, G1, S, and G2-M phases were determined by ModFit software (Verity Software House, Topsham, ME).
Clonogenic survival. Survival after radiation exposure was defined as the ability of cells to maintain clonogenic capacity and form colonies. Briefly, 1 x 106 cells were plated and grown overnight. Cells were treated with 10 µmol/L cyclopamine or 10 µmol/L forskolin and allowed to grow for 24 hours. The cells were then exposed to increasing doses of ionizing radiation plated in 100-mm dishes at varying densities in the presence of the above inhibitors and allowed to grow for 10 days and then stained with crystal violet. Individual colonies were counted, and survival curves were obtained.
Cell viability and caspase-3 activity. Cells were transfected with Gli-1 or Random control siRNA and cultured for 24 hours. Cells were then exposed to 6 Gy ionizing radiation and seeded into 96-well plates. Cell viability was determined 48 hours later by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, as described above. Caspase-3 activity was determined using a caspase-3 colorimetric assay kit (R&D Systems) according to the manufacturer's protocol. Briefly, 1 x 106 cells were treated with 10 µmol/L cyclopamine, 10 µmol/L forskolin, or 100 nmol/L siRNA and allowed to grow for 24 hours. The cells were then exposed to ionizing radiation (6 Gy), incubated for an additional 24 hours, trypsinized, and collected by centrifugation, and cell lysates were obtained. Lysates (150-250 µg of protein) were assayed for caspase activity. The specific peptide substrate used was DEAD-pNA. Release of the pNA cleavage product was quantified in a microplate reader (BioTek) at a wavelength of 405 nm. Each assay was done in triplicate and repeated thrice.
Statistical analysis. For in vitro studies, significance was determined by unpaired Student's t test. P < 0.05 using a two-tailed test was taken as significant for all statistical tests. Computations were carried out using a SAS software package (version 6.12; SAS Institute, Inc., Cary, NC).
| Results |
|---|
|
|
|---|
|
|
To determine the causative relationship between Hh signaling and proliferation of esophageal tumor cells, three esophageal adenocarcinoma cell lines (SKGT4, SEG-1, and Bic1) were treated with exogenous Shh ligand, the Hh pathway antagonist cyclopamine, which blocks SMO receptor activation, or a Gli-1-specific siRNA. Activation or inhibition of Hh signaling was confirmed by detecting Gli-1 nuclear translocation using immunofluorescence-based confocal microscopy (Fig. 3A ). Additionally, because Gli-1 is a transcriptional target of the Hh pathway (14), inhibition of Hh signaling was confirmed by a decrease in Gli-1 expression in cells treated with Hh inhibitors or Gli-1-specific siRNA compared with controls (Fig. 3B). After 48 hours of treatment with cyclopamine or Gli-1 siRNA, a significant decrease in proliferation was observed (Fig. 3C), whereas a significant increase in proliferation rates was observed in cells treated with exogenous Shh ligand. The degree of response correlated with level of endogenous Gli-1 expression (Fig. 3D), indicating that this effect is specific to Hh signaling. To further explore the relationship between Hh activation and proliferation of esophageal cancer, DNA synthesis levels of cells stimulated with Shh ligand were measured by 3H-thymidine incorporation and compared with baseline levels obtained with vehicle-treated control cells. A significant increase in 3H-thymidine incorporation was observed in Shh treated cells compared with untreated controls.
|
Dysregulation of cell cycle regulatory proteins contributes to the proliferation of tumor cells and subsequent repopulation of tumors after chemoradiotherapy (23). To determine the mechanism of Shhinduced proliferation, we analyzed the expression levels of cyclin D1 in SEG-1 cells upon exogenous stimulation of Hh signaling. As shown in Fig. 4A , there is an increase in cyclin D1 protein expression in Shh stimulated cells compared with controls. We also examined the levels of Rb expression and activation in Shh-treated cells. Although there was no significant change in Rb protein levels, a significant increase in Rb phosphorylation at the cyclin D phosphorylation site (Ser780) was observed. These results indicate that Shh stimulation in esophageal tumor cells can promote G1-S cell cycle phase transition by increasing activity of the cyclin-Rb axis.
|
It is well established that the sensitivity of cells to the cytotoxic effects of radiation is cell cycle dependent, with the S phase being more resistant and the G1-S boundary and G2-M phase being more sensitive (26). Treatment of SEG-1 cells with ionizing radiation alone led to a slight but not significant reduction in the radiation-resistant S-phase fraction (Fig. 4D). Treatment with Hh inhibitors alone led to a significant (P < 0.01) reduction in the S-phase fraction, and the combination of radiation and Hh inhibitors caused a greater reduction (P < 0.005) in the S-phase fraction compared with untreated cells. To determine whether inhibition of Hh signaling can sensitize cells to the cytotoxic effects of radiation, SEG-1 or BE-3 cells were treated with Hh pathway inhibitors in combination with increasing doses of ionizing radiation, and clonogenic survival curves were generated. Inhibition of Hh signaling synergistically decreased the clonogenic survival of tumor cells when combined with radiation (Fig. 5A ). Blocking Hh signaling also significantly reduced the shoulder region of the ionizing radiation survival curve, indicating that repair of the sublethal damage induced by ionizing radiation was inhibited. We further evaluated whether the synergistic effect of combining Hh inhibition and radiation involves apoptosis. Although treatment with ionizing radiation alone had little effect on cell viability 48 hours after treatment of esophageal adenocarcinoma cell lines (SEG-1, Bic-1, BE-3, and SK5), a significant decrease in cell viability was observed in cells in which Hh signaling was inhibited (Fig. 5B). Cell viability was further reduced by combination of ionizing radiation and Hh inhibition. Minimal apoptosis, as determined by caspase-3 activity, was observed in esophageal adenocarcinoma cell lines treated with ionizing radiation alone (Fig. 5C and D). Treatment with Hh inhibitors alone induced significant apoptosis, and combined treatment with ionizing radiation and Hh inhibitors resulted in a significantly greater amount of apoptosis.
|
| Discussion |
|---|
|
|
|---|
Our data show that stimulation of esophageal cancer cells with Shh ligand or Gli-1 overexpression results in up-regulation of G1-cyclin activity and increased proliferation. These data suggest that unregulated Hh signaling within tumors may promote a continuous state of tissue repair and clonogenic proliferation once the tumor volume is reduced after chemoradiotherapy, contributing to tumor repopulation. Although a role for Hh signaling has been established in the formation and maintenance of a number of tumors, including basal cell, prostate, breast, and pancreatic carcinomas among others (9, 10, 29, 3133), our study is the first to examine Hh activation in the context of tumor repopulation after chemoradiotherapy and suggests that in addition to its reported roles in carcinogenesis and tumor maintenance, aberrant activation of the Hh pathway may contribute to tumor repopulation and treatment failure.
Esophageal adenocarcinoma is presently the cancer with the greatest increase in incidence in the United States (34, 35). Currently available treatments of localized cancer of the esophagus are ineffective in >75% of esophageal cancers (chemoradiotherapy resistant), resulting in a 5-year survival rate under 25%. Patients with esophageal cancer and treating oncologists face serious challenge of not being able to optimize therapy. Therapies are currently chosen empirically without concern for tumor and patient heterogeneity. Highly morbid surgery could be avoided if one could identify a molecular signature that would suggest a highly chemoradiation-sensitive cancer. Similarly, understanding the mechanisms resulting in chemotherapy or radiotherapy resistance would allow identification of exploitable targets. The discovery that inhibition of Hh activity can sensitize tumor cells to the effects of radiation suggests that incorporating targeted inhibition of the Hh signaling pathway into current chemoradiotherapy regimens might improve treatment outcome.
There are presently no clinically approved systemic inhibitors of Hh signaling. Topical application of cyclopamine has been shown to inhibit the growth of human basal cell carcinoma (36); however, concerns of neurologic disturbances may limit the systemic application of this drug. Several small molecule compounds that prevent Hh signaling by binding to and inhibiting Smo are currently under development, including Cur61414 (37), which has shown promising results in inhibition of basal cell carcinoma and pancreatic cancer in preclinical models. The therapeutic effects of Hh pathway blockade in combination with current chemoradiotherapy regimens are yet to be investigated. Particularly, the differential regulation and timing of Hh activity in normal and tumor tissue after chemoradiotherapy should be further investigated to determine the most beneficial therapeutic index (i.e., effects on normal tissue repair versus tumor).
| Acknowledgments |
|---|
| Footnotes |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 1/25/06; revised 5/ 2/06; accepted 8/16/06.
| References |
|---|
|
|
|---|
causes oxygen-independent cytotoxicity and induces p53 independent apoptosis in glioblastoma cells. Int J Radiat Oncol Biol Phys 2003;55:102736.[CrossRef][Medline]This article has been cited by other articles:
![]() |
J. A. Ajani Chemotherapy and Radiation Resistance: Version 2.0 J. Clin. Oncol., June 1, 2009; 27(16): 2735 - 2736. [Full Text] [PDF] |
||||
![]() |
M. P. Melancon, W. Lu, Z. Yang, R. Zhang, Z. Cheng, A. M. Elliot, J. Stafford, T. Olson, J. Z. Zhang, and C. Li In vitro and in vivo targeting of hollow gold nanoshells directed at epidermal growth factor receptor for photothermal ablation therapy Mol. Cancer Ther., June 1, 2008; 7(6): 1730 - 1739. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. V. Hegde, C. M. Munger, K. Emanuel, A. D. Joshi, T. C. Greiner, D. D. Weisenburger, J. M. Vose, and S. S. Joshi Targeting of sonic hedgehog-GLI signaling: a potential strategy to improve therapy for mantle cell lymphoma Mol. Cancer Ther., June 1, 2008; 7(6): 1450 - 1460. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. B. van den Broek, V. B. Wreesmann, M. W.M. van den Brekel, C. R.N. Rasch, A. J.M. Balm, and P. H. Rao Genetic Abnormalities Associated with Chemoradiation Resistance of Head and Neck Squamous Cell Carcinoma Clin. Cancer Res., August 1, 2007; 13(15): 4386 - 4391. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |