This Article Abstract Full Text (PDF) Supplementary Data Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Weber, A. Articles by Christiansen, H. Search for Related Content PubMed PubMed Citation Articles by Weber, A. Articles by Christiansen, H.

The Coamplification Pattern of the MYCN Amplicon Is an Invariable Attribute of Most MYCN-Amplified Human Neuroblastomas

Authors' Affiliation: Children's Hospital, Pediatric Hematology and Oncology, University of Marburg, Marburg, Germany

Requests for reprints: Holger Christiansen, Universitaetskinderklinik, Baldinger Strasse, D-35049 Marburg, Germany. Phone: 49-6421-28-62671; Fax: 49-6421-28-66824; E-mail: holger.christiansen{at}mailer.uni-marburg.de.

	Abstract

Top Abstract Patients and Methods Results Discussion References

 
Purpose: Fifteen percent to 20% of human neuroblastomas show amplification of the MYCN oncogene physiologically located at chromosome 2p24-25, indicating an aggressive subtype of human neuroblastoma with a poor clinical outcome. Recent findings revealed that the structure of the amplicon differs interindividually and that coamplification of genes in telomeric proximity to MYCN might play a relevant role in neuroblastoma development and response to treatment, respectively. We now asked if the amplicon structure is an invariable attribute of an individual tumor or if the coamplification pattern could change during progress or in case of recurrent disease.

Experimental Design: We used a previously described multiplex PCR approach to analyze the coamplification status of MYCN-amplified human neuroblastomas (n = 33) in tumor tissue at the time of initial diagnosis and in consecutive tissue specimens at later time points after initial treatment or from relapsing disease. The MYCN copy number per haploid genome (Mcn/hg) in these specimens was determined in a separate duplex PCR.

Results: In 32 of the 33 investigated tumors, the amplicon structure showed no changes after initial chemotherapy and in recurrent disease. Mcn/hg showed a decrease after initial treatment (n = 23), whereas we found a significant increase in recurrent disease (n = 10).

Conclusion: Our data indicate that the initial determined structure of the 2p24-25 amplicon is a consistent attribute in the great majority of the individual MYCN-amplified neuroblastomas and shows no plasticity during or after chemotherapy. Observed changes in the Mcn/hg over the course of disease are in line with preexisting cell culture findings.

However, not all of the long-time-surviving patients harbored DDX1 coamplification and not every patient that underwent rapid progression of disease lacked DDX1 coamplification. Other investigators found only a trend toward a better prognosis (5) or even described a trend toward a worse prognosis for patients with DDX1-coamplified tumors (6–9). Because of the relative homogeneity regarding prognosis of the patients in these studies and the small numbers of investigated patients, statistical significance was not obtained. We hypothesized that DDX1 might influence the response of neuroblastoma cells to chemotherapy under certain conditions but does not serve as a warrant for survival per se.

In cell culture studies on methotrexate-treated Chinese hamster and mouse cells, Hahn et al. (10, 11) showed that an elevation in the amplification number of the amplified dihydrofolate reductase gene occurs under increasing selective pressure. Furthermore, the authors described a trend to a reduction in the amplicon size under these strong selective conditions. In general, the size of the amplified DNA fragments in those cell models is described to be a stable attribute independent of the manner of amplification as double-minute chromosomes or homogenously staining regions (11, 12).

These findings and our previously determined data of coamplification pattern in primary neuroblastoma prompted us to ask if the structure and the copy number of the chromosome 2p24-25 amplicon, once determined at initial neuroblastoma development, are invariable attributes for each individual MYCN-amplified neuroblastoma. To answer that question, we analyzed the coamplification pattern of subsequent tissue specimens taken at initial diagnosis and at different time intervals after treatment initiation of 33 patients with MYCN-amplified neuroblastoma using the two multiplex PCRs previously described (4). Furthermore, we determined the number of amplified copies of MYCN in relation to inhibin-ß-b in a separate, semiquantitative duplex PCR (Supplementary Fig. S1).

	Patients and Methods

Top Abstract Patients and Methods Results Discussion References

 
Patients. We studied primary tumor specimens from 33 children with MYCN-amplified neuroblastomas diagnosed in Germany from 1986 to 2003. The 33 neuroblastomas were selected out of a total number of 174 tumor specimens with MYCN amplification within this period of time. The selection criterion was the availability of tumor tissue of comparable quality to different time points during therapy of each individual patient for DNA isolation.

All neuroblastoma diagnoses were confirmed by histologic assessment of a tumor specimen obtained at surgery. The tumors were classified according to the International Neuroblastoma Staging System criteria (13). All patients were treated according to previously described protocols with confirmed consent for therapy and study procedures (14, 15). Therapy included surgery, polychemotherapy, and, dependent on the randomization procedure, high-dose chemotherapy with autologous stem cell transplantation, anti-GD2 antibody, and retinoic acid treatment.

Our study group consisted of 1 stage I, 0 stage II, 10 stage III, 17 stage IV, and 5 stage IV-S tumors. The median patient age at diagnosis was 30.8 months (range 0.6-163.3 months). The median follow-up time for all 33 patients was 25.2 months (range 7.5-150.1 months). The median follow-up time of the patients that died of the disease was 18.4 months (n = 21) compared with 82.6 months for patients alive (n = 12).

The mean time interval between first and second biopsy of all investigated patients (n = 33) was 4.6 months (range 1.0-76.9 months). The mean time between first and third biopsy (n = 3) was 22.5 months. Most of the second biopsies were taken from the site of the initial tumor during operation after initial chemotherapy treatment. The mean time between first and second biopsy of these patients (n = 23) was 4.1 months (range 1.0-20.3 months). For 10 patients, recurrent disease was diagnosed based on the clinical criteria that before relapse, a full remission of the initial disease occurred during therapy. The mean time between first and second biopsy of these patients (n = 10) was 17.2 months (range 5.2-76.9 months). Clinical data and amplification pattern of all investigated patients are presented in Table 1 .

For quantification of the MYCN copy number per haploid genome (Mcn/hg), a separate duplex PCR approach was established. Because the band intensities of the investigated genes were, in addition to the amplicon number, dependent on the coamplification pattern in both multiplex PCR, it was essential to design a separate duplex PCR for determination of the MYCN copy number relative to a control gene (inhibin-ß-b) located on the same chromosome (primer used: MYCN-upper, CATCCACCAGCAGCACAACTATG; MYCN-lower, CCAGAGGCTCCCAACCGT-CAC; inhibin-ß-b-upper, CATTGCCTTGTGTTCTCCTT; inhibin-ß-b-lower, GAATGCGGTGCCTG-CTGTC; denaturation 20 s, 95°C; annealing 20 s, 63°C; elongation 60 s, 72°C). The amplified PCR fragments (10 µL of the PCR reaction) were separated on a 2% agarose gel by electrophoresis, visualized by ethidium bromide staining and UV light exposure, and finally documented and analyzed with the Image Master VDS software [GE-Healthcare(Amersham-Pharmacia), Munich, Germany]. The relative level of the PCR bands was determined by densitometry. Moreover, a ratio of the MYCN band intensity to the intensity of the inhibin-ß-b band was determined.

A standard curve was created using a dilution series of genomic DNA from a neuroblastoma with high copy number MYCN-amplified neuroblastomas, with known diploid karyotype and known Mcn/hg determined by Southern blot as described previously (4). The tumor DNA (250 Mcn/hg) was diluted stepwise with human placental DNA; thus, the Mcn/hg was halved with each dilution step. The obtained standard curve was used to deduce the Mcn/hg for each patient's tumor specimens (Supplementary Fig. S1).

The coamplification pattern of the investigated genes on chromosome 2p24-25 and the Mcn/hg for each investigated tumor are given in Table 1.

Statistics. Fisher's exact test was used to compare the amplification status for each gene determined at initial diagnosis and at later time points. The paired t test was used to compare the Mcn/hg determined at initial diagnosis and at later time points. Statistical analyses were done with the SPSS version 10.0 software (SPSS, Inc., Chicago, IL). P values of 0.05 were regarded as significant.

	Results

Top Abstract Patients and Methods Results Discussion References

 
The coamplification pattern within the MYCN amplicon is an invariable attribute of most neuroblastoma tumors. In the present cohort besides MYCN amplification, 15 (46%) of the investigated tumors showed coamplification for DDX1, 11 (33%) for NAG, 5 (15%) for NSE1, 2 (6%) for LPIN1, 31 (94%) for EST-AA581763, 2 (6%) for SMC6, and 1 (3%) for SDC1 (Fig. 1 ; Table 1) The coamplification of genes located telomeric to MYCN (DDX1, NAG, and NSE1) was less frequent compared with our previously published data that were determined on a larger cohort (n = 98 patients; ref. 4). However, the differences were not statistically significant and could be explained by the smaller patient numbers in the present study and the relatively high number of patients with recurrent disease selected for investigation within this study.

View larger version (20K): [in this window] [in a new window]   Fig. 1. Frequency of coamplification of the investigated genes on chromosome 2p24-25 in primary tumor tissue at the time of initial diagnosis (white columns, n = 33) and at the time of the second biopsy [gray columns, primary tumor site (p.t.; n = 23) and black columns, recurrent disease (rec.; n = 10)].

Patient 18 showed a loss of primarily coamplified genes (NSE1, NAG, and DDX1) within the amplicon at the second biopsy date, 76.9 months after the initial diagnosis. This patient was initially diagnosed as a stage I tumor at the age of 6.6 months. At the age of 6.4 years (83.5 months), a recurrent tumor was diagnosed that again was defined as stage I. To the date of our investigation, the patient was still alive (114 months after initial diagnosis; Fig. 2 ).

View larger version (33K): [in this window] [in a new window]   Fig. 2. A, different coamplification pattern of patient 18 as indicated by the two described multiplex PCR (bp, molecular weight marker; R, healthy human kidney DNA was used as single copy reference). B, different amplicon structures of patient 18 derived from the two multiplex PCR. Distance (kbp) of the seven investigated genes in relation to MYCN (BLAT assignment information).

The number of amplified MYCN copies decreases after initial chemotherapy and increases in recurrent disease. Unlike the coamplification pattern, a significant change in amplification number was observed in the investigated cohort (Fig. 3 ).

View larger version (19K): [in this window] [in a new window]   Fig. 3. Copy number of MYCN per haploid genome at the time of initial diagnosis (1st) and time of second biopsy (2nd; box-whisker plot). A, patients (n = 23) with second biopsy at the primary tumor site after initial chemotherapy (P = 0.017, paired t test). B, patients (n = 10) with recurrent disease (P = 0.02, paired t test).

In contrast, we found an increase of Mcn/hg in tumor samples of recurrent disease compared with their primary counterparts (n = 10; Fig. 3B). The median MYCN copy number at primary diagnosis was 27 Mcn/hg compared with 46 Mcn/hg in recurrent disease (25-75% percentile: 10-36 Mcn/hg compared with 30-64 Mcn/hg, respectively). Both alterations are statistically significant (P < 0.05, paired t test).

	Discussion

Top Abstract Patients and Methods Results Discussion References

 
Not much is known about the initiation and genesis of the MYCN amplicon in neuroblastoma development. Cheng et al. (16) revealed that, preferentially, the paternal allele undergoes the amplification process. Referring to patient age, recent data indicate that amplification of MYCN occurs to a defined point of time in neuroblastoma development as 65% of patients with MYCN-amplified neuroblastomas are between 12 and 40 months of age (17). Our data from about 247 patients are in consent with this age distribution, as, in our cohort, 55% MYCN-amplified tumors are initially diagnosed at an age between 12 and 40 months.

The amplicon size varies between 350 and >1,000 kb in length, including different coamplified genes telomeric and centromeric of MYCN (4, 18). The amplicon number varies from 2 to 256, and, in some cases, more copies per haploid genome in neuroblastoma cells at that time of diagnosis. In the great majority of MYCN-amplified neuroblastomas, the amplified genomic regions are initially present in the form of extrachromosomal double minutes rather than in homogeneously staining regions, which can be found mainly in recurrent disease (19, 20).

Extensive DNA rearrangements can be found within the amplified region, leading in part to the phenomenon that coamplified genes might be presented not equally in copy number compared with MYCN in either homogenously staining regions or double-minute chromosomes (21, 22).

Yoshimoto et al. (20) described the possibility of coexisting double-minute chromosomes and homogenously staining regions in single tumor cells besides cells with either double-minute chromosomes or homogenously staining regions in one neuroblastoma tumor. They claim a possible transition from double-minute chromosomes to homogenously staining regions during tumor development based on the finding that cells that reintegrate amplified oncogenes into the genome show a growth advantage over cells harboring the amplified gene copies in extrachromosomal double-minute chromosomes (23).

A change or evolution of the amplicon structure has not yet been reported for neuroblastoma. Our findings show that a change of the amplicon structure is uncommon during the course of disease but is possible in neuroblastoma recurrent disease. In the great majority of cases, we found the amplicon structure to be an invariable attribute of the individual tumor that does not undergo rearrangement during therapy. The observed change in the coamplification pattern in one patient could be explained by subsequent selection of more therapy-resistant neuroblastoma cell clones harboring the MYCN amplicon of smaller extent (Fig. 2B). As a prerequisite for this explanation, a heterogeneous ancestor cell population, which contains cells harboring MYCN amplicons of different sizes at determination of the individual neuroblastoma, has to be presumed. Alternatively, a successive change of the amplicon structure, caused coincidentally in highly proliferating cells or by DNA interfering agents and favoring cells with amplicons of smaller size over a given period of time, could be a possible mechanism. The latter explanation is more consistent with observations in common cell culture models (reviewed in ref. 23).

We previously showed coamplification and overexpression of DDX1 to occur preferentially in long-time-surviving patients and discussed a possible influence on the response to chemotherapeutics (4). Hypothetically, cells that lose this coamplification telomeric to MYCN should become more resistant to chemotherapeutic treatment. Our finding in the neuroblastoma of patient 18 that lost coamplification of NSE1, NAG, and DDX1 in the relapsing tumor is consistent with this hypothesis.

Interestingly, for amplified copies of the c-myc and MYCN genes occurring in double-minute chromosomes, a reduction in copy number after treatment with hydroxyurea can be observed, but not for copies in homogenously staining regions. After hydroxyurea treatment, the amplicon number can recur to the initial count (24). These findings show a possibility to influence gene amplification by medical treatment but also indicate that these exogenously induced genomic changes are not irreversible. In 1987, Brodeur et al. (25) investigated consecutive tumor samples of 12 patients with MYCN-amplified neuroblastomas and describe no change in the amplicon number for their investigated cohort. However, considering the given data of each individual patient, the findings of Brodeur et al. are strongly consistent with our findings. In their study, the Mcn/hg was found to be increased in tumor tissue of four of the seven patients with recurrent disease when compared with the primary tumor tissue. In consecutive specimens of patients during treatment, the Mcn/hg decreased in three of four reported patients.

These findings and our own observation of a reduction of the Mcn/hg after initial chemotherapeutic treatment indicate that the reported observations in cell culture regarding elimination of extrachromosomal amplified MYCN in response to treatment is also a possible mechanism of adaptation in primary MYCN-amplified neuroblastomas. In a cellular context, this regulation is reasonable as cells that eliminate extrachromosomal copies of MYCN might decelerate MYCN-induced proliferation. This is an observed mechanism to avoid massive apoptosis triggered by chemotherapy and enforced by myc oncogenes (26). As we lack the information if MYCN amplification is present in double-minute chromosomes or homogenously staining regions in neuroblastomas of our investigated patients, a correlation of the molecular phenotype of amplification to a decline of the amplification number is not possible. On the other hand, we observed a significant increase in the Mcn/hg in recurrent disease compared with the initially diagnosed primary neuroblastoma. These cells might represent highly proliferating clones that could bypass myc-enforced apoptosis and, thus, have benefit from harboring a higher Mcn/hg. We have to annotate that the observed changes of the Mcn/hg could also result from a different content of viable tumor cells within the subsequent tissue specimens, based on the used PCR method. However, the tumor cell content of the investigated specimens in this study is interindividually and intraindividually comparable (Table 1).

The observed changes in the amplicon copy number over time might reflect abided regulatory mechanisms in neuroblastoma cells comparable with cell culture models of acquired gene amplification. In contrast to an acquired gene amplification under selective pressure, a reason for an initialization of the MYCN amplification in developing neuroblastic cells, with the possibility to lead to MYCN-amplified neuroblastoma, remains unclear. Once initiated, the MYCN amplification is found to be irreversible in neuroblastoma tumors, and, once determined at time of initial amplification, the structure of the MYCN amplicon is invariable during the course of disease, including chemotherapy with DNA-damaging agents, in the majority of neuroblastoma tumors.

A fundamental question arises from our findings. Is there a cellular program superior to MYCN amplification that advises a cell, deriving from the neural crest, to amplify MYCN in a certain developmental condition, which then could lead to MYCN-amplified neuroblastoma if this genomic condition becomes an irreversible attribute?

	Acknowledgments

 
We thank Monika Faulhaber for performing many of the PCR experiments, our colleagues from about 100 German pediatric centers for providing us with neuroblastoma tumor material since 1981, Prof. Berthold and Dr. Hero (University of Cologne, Cologne, Germany) for providing clinical data, and Prof. Lampert (University of Gießen, Gießen, Germany) for support of our research group.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/).

Received 4/ 4/06; revised 8/15/06; accepted 10/ 6/06.

	References

Top Abstract Patients and Methods Results Discussion References

 

1. Schwab M, Alitalo K, Klempnauer KH, et al. Amplified DNA with limited homology to myc cellular oncogene is shared by human neuroblastoma cell lines and a neuroblastoma tumour. Nature 1983;305:245–8.[CrossRef][Medline]
2. Brodeur GM, Seeger RC, Schwab M, Varmus HE, Bishop JM. Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science 1984;224:1121–4.[Abstract/Free Full Text]
3. Brodeur GM, Maris JM, Yamashiro DJ, Hogarty MD, White PS. Biology and genetics of human neuroblastomas. J Pediatr Hematol Oncol 1997;19:93–101.[CrossRef][Medline]
4. Weber A, Imisch P, Bergmann E, Christiansen H. Coamplification of DDX1 correlates with an improved survival probability in children with MYCN-amplified human neuroblastoma. J Clin Oncol 2004;22:2681–90.[Abstract/Free Full Text]
5. De Preter K, Speleman F, Combaret V, et al. No evidence for correlation of DDX1 gene amplification with improved survival probability in patients with MYCN-amplified neuroblastomas. J Clin Oncol 2005;23:3167–8; author reply 3168–70.[Free Full Text]
6. Squire JA, Thorner PS, Weitzman S, et al. Co-amplification of MYCN and a DEAD box gene (DDX1) in primary neuroblastoma. Oncogene 1995;10:1417–22.[Medline]
7. George RE, Kenyon R, McGuckin AG, et al. Analysis of candidate gene co-amplification with MYCN in neuroblastoma. Eur J Cancer 1997;33:2037–42.[CrossRef][Medline]
8. Manohar CF, Salwen HR, Brodeur GM, Cohn SL. Co-amplification and concomitant high levels of expression of a DEAD box gene with MYCN in human neuroblastoma. Genes Chromosomes Cancer 1995;14:196–203.[Medline]
9. De Preter K, Speleman F, Combaret V, et al. Quantification of MYCN, DDX1, and NAG gene copy number in neuroblastoma using a real-time quantitative PCR assay. Mod Pathol 2002;15:159–66.[CrossRef]
10. Hahn P, Nevaldine B, Morgan WF. X-ray induction of methotrexate resistance due to dhfr gene amplification. Somat Cell Mol Genet 1990;16:413–23.[CrossRef][Medline]
11. Hahn PJ, Nevaldine B, Longo JA. Molecular structure and evolution of double-minute chromosomes in methotrexate-resistant cultured mouse cells. Mol Cell Biol 1992;12:2911–8.[Abstract/Free Full Text]
12. Pauletti G, Lai E, Attardi G. Early appearance and long-term persistence of the submicroscopic extrachromosomal elements (amplisomes) containing the amplified DHFR genes in human cell lines. Proc Natl Acad Sci U S A 1990;87:2955–9.[Abstract/Free Full Text]
13. Brodeur GM, Pritchard J, Berthold F, et al. Revisions of the international criteria for neuroblastoma diagnosis, staging, and response to treatment. J Clin Oncol 1993;11:1466–77.[Abstract/Free Full Text]
14. Berthold F, Burdach S, Kremens B, et al. The role of chemotherapy in the treatment of children with neuroblastoma stage IV: the GPO (German Pediatric Oncology Society) experience. Klin Padiatr 1990;202:262–9.[Medline]
15. Berthold F, Hero B. Neuroblastoma: current drug recommendations as part of the total treatment approach. Drugs 2000;59:1261–77.[CrossRef][Medline]
16. Cheng JM, Hiemstra JL, Schneider SS, et al. Preferential amplification of the paternal allele of the N-myc gene in human neuroblastomas. Nat Genet 1993;4:191–4.[CrossRef][Medline]
17. London WB, Castleberry RP, Matthay KK, et al. Evidence for an age cutoff greater than 365 days for neuroblastoma risk group stratification in the Children's Oncology Group. J Clin Oncol 2005;23:6459–65.[Abstract/Free Full Text]
18. Hiemstra JL, Schneider SS, Brodeur GM. High-resolution mapping of the N-myc amplicon core domain in neuroblastomas. Prog Clin Biol Res 1994;385:51–7.[Medline]
19. Brodeur GM, Green AA, Hayes FA, Williams KJ, Williams DL, Tsiatis AA. Cytogenetic features of human neuroblastomas and cell lines. Cancer Res 1981;41:4678–86.
20. Yoshimoto M, Caminada De Toledo SR, et al. MYCN gene amplification. Identification of cell populations containing double minutes and homogeneously staining regions in neuroblastoma tumors. Am J Pathol 1999;155:1439–43.[Abstract/Free Full Text]
21. Schneider SS, Hiemstra JL, Zehnbauer BA, et al. Isolation and structural analysis of a 1.2-megabase N-myc amplicon from a human neuroblastoma. Mol Cell Biol 1992;12:5563–70.[Abstract/Free Full Text]
22. Pandita A, Godbout R, Zielenska M, Thorner P, Bayani J, Squire JA. Relational mapping of MYCN and DDXI in band 2p24 and analysis of amplicon arrays in double minute chromosomes and homogeneously staining regions by use of free chromatin FISH. Genes Chromosomes Cancer 1997;20:243–52.[CrossRef][Medline]
23. Hahn Peter J. Molecular biology of double minute chromosomes. Bioessays 1993;15:477–84.[CrossRef][Medline]
24. Von Hoff DD, McGill JR, Forseth BJ, et al. Elimination of extrachromosomally amplified MYC genes from human tumor cells reduces their tumorigenicity. Proc Natl Acad Sci U S A 1992;89:8165–9.[Abstract/Free Full Text]
25. Brodeur GM, Hayes FA, Green AA, et al. Consistent N-myc copy number in simultaneous or consecutive neuroblastoma samples from sixty individual patients. Cancer Res 1987;47:4248–53.[Abstract/Free Full Text]
26. Fulda S, Lutz W, Schwab M, Debatin KM. MycN sensitizes neuroblastoma cells for drug-induced apoptosis. Oncogene 1999;18:1479–86.[CrossRef][Medline]

This Article Abstract Full Text (PDF) Supplementary Data Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Weber, A. Articles by Christiansen, H. Search for Related Content PubMed PubMed Citation Articles by Weber, A. Articles by Christiansen, H.