Clinical Cancer Research Prevention Award Advances in Breast Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ma, Y.
Right arrow Articles by Gao, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, Y.
Right arrow Articles by Gao, Y.
Clinical Cancer Research Vol. 12, 1121-1127, February 2006
© 2006 American Association for Cancer Research


Human Cancer Biology

Expression of Targeting Protein for Xklp2 Associated with Both Malignant Transformation of Respiratory Epithelium and Progression of Squamous Cell Lung Cancer

Ying Ma1, Dongmei Lin2, Wenyue Sun1, Ting Xiao1, Jinsong Yuan1, Naijun Han1, Suping Guo1, Xiaoli Feng2, Kai Su3, Yousheng Mao3, Shujun Cheng1 and Yanning Gao1

Authors' Affiliations: Departments of 1 Etiology and Carcinogenesis, 2 Pathology, and 3 Thoracic Surgery, Cancer Institute (Hospital), Peking Union Medical College and Chinese Academy of Medical Sciences, Beijing, People's Republic of China

Requests for reprints: Yanning Gao, Department of Etiology and Carcinogenesis, Cancer Institute (Hospital), Peking Union Medical College and Chinese Academy of Medical Sciences, P.O. Box 2258, Beijing 100021, People's Republic of China. Phone: 86-10-6778-2323; E-mail: yngao{at}pubem.cicams.ac.cn.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Purpose: Expression of targeting protein for Xklp2 (TPX2), a microtubule-associated protein, is tightly cell cycle regulated. Abnormally expressed TPX2 has been reported in various malignancies, but less is known in lung cancer. The present study appraised the significance of TPX2 aberrant expression for tumorigenesis and progression of human squamous cell carcinoma (SCC) in lung.

Experimental Design and Results: The expressive status of TPX2 was firstly examined with lung cancer (L, PAa, and PG) and immortalized bronchial epithelial (C45, M-BE, Tr, and Y-BE) cell lines, and TPX2 expression was detected at both RNA and protein levels by reverse transcription-PCR and Western blotting, respectively. Immunofluorescence staining on M-BE cells showed that the subcellular localization of TPX2 protein is in nucleus at interphase and mitotic spindle at metaphase. Immunohistochemical analyses were subsequently done on the precancerous lesions derived from 114 patients and the tumor tissues of 432 patients with SCC in lung. Extremely low levels of TPX2 protein were found in the normal bronchial epithelia and alveoli, whereas gradually increased TPX2 protein levels were observed in the squamous metaplasia, dysplasia, carcinoma in situ, and invasive tumor tissues. Statistical analysis showed that the TPX2 immunohistochemistry labeling index was correlated with the differentiation grade, stage, and lymphous metastasis of SCC in lung and that TPX2 overexpression is significantly associated with decreased 5-year survival rate of the patients.

Conclusions: Aberrant expression of TPX2 may play important role(s) in both malignant transformation of respiratory epithelium and progression of squamous cell lung cancer and could serve as a prognostic predictor for the disease.


Lung cancer is the most common fatal malignancy worldwide and global case numbers are set to increase, as the smoking epidemic takes hold in Asia, particularly in China (1). As tumor stage is the most significant prognostic factor for survival, there is considerable interest in early detection of lung cancer. It is also important to detect bronchial mucosal abnormalities that could be precursors for lung cancer (2). The WHO/International Association for the Study of Lung Cancer classification system for preinvasive squamous lesions of the bronchus has proven to be reproducible (3, 4), but little is known about molecular biological significance of the precancerous changes.

Targeting protein for Xklp2 (TPX2; ref. 5) is a cell cycle–associated human protein of ~100-kDa apparent molecular mass encoded by a gene located on human chromosome band 20q11.2 (6, 7). This protein homologue in Xenopus laevis is also named formerly as restricted expressed proliferation-associated protein (repp86; ref. 8), p100 (6), differentially expressed in lung cells 2 (DIL2; ref. 9), HCTP4 (10), FLS353 (11), hepatocellular carcinoma-associated antigen 519 (HCA519; ref. 12), and chromosome 20 open reading frame 1 (C20orf1; ref. 7). Its expression is tightly cell cycle regulated, becoming detectable at the G1-S transit and vanishing at the completion of cytokinesis. TPX2, therefore, might allow a more precise evaluation of the proliferative behavior of tumor cells (6).

Aberrant expression of TPX2 has been found in various malignancies (1315), but less is known in lung cancer, especially in stepwise carcinogenesis of bronchial epithelium. Manda et al. reported that an identical cDNA, C20orf2, was retrieved by comparing cancerous and noncancerous cell lines derived from lung in a mRNA differential display (9). In previous study, we identified TPX2 sequence from a differential expression cDNA library constructed with the tumor and normal epithelium tissues derived from the patients with squamous cell carcinoma (SCC) of lung.4

To validate the findings above, in current study, we further investigated expression of TPX2 in the tumor tissues of SCC of lung and the related cell lines (including lung cancer cell lines and immortalized bronchial epithelial cell lines) on both mRNA and protein levels. The subcellular localization of TPX2 protein in human bronchial epithelial cells was also tested. In addition, the significance of TPX2 expression in stepwise tumorigenesis of human bronchial epithelium was evaluated, and the correlations between TPX2 protein levels and grade of differentiation, staging and lymphous metastasis of the tumors, and survival time of the patients were also analyzed.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Patients and tissue samples. For reverse transcription-PCR (RT-PCR) analysis, frozen tumor tissue samples and their corresponding nontumorous lung tissues were collected from 21 patients with primary SCC in lung.

For immunohistochemical analysis, formalin-fixed, paraffin-embedded tissue samples derived from a total of 432 patients with primary SCC in lung were used in a manner of tissue microarrays. The tissue microarrays contain 195 primary tumors from the patients without lymph node metastases diagnosed histopathologically, 237 primary tumors from the patients with lymph node metastases, and 163 corresponding metastatic tumors in lymph node. Normal tissues (20 samples of bronchial epithelium and 22 of normal alveoli) derived from the same group of the patients were also included.

Furthermore, precancerous lesions of bronchial epithelium were identified in the 114 patients whose tumor tissues were contained within the tissue microarrays described above. The tissue samples of these precancerous lesions, including 68 of squamous metaplasia, 66 of dysplasia, and 44 of carcinoma in situ, were selected for further immunohistochemical analysis on ordinary paraffin-embedded tissue sections.

All the patients involved in this study underwent surgical treatment at the Cancer Hospital, Chinese Academy of Medical Sciences from 1992 to 2003, and none of them accepted chemotherapy and/or radiotherapy before surgery. The histopathologic diagnosis was double confirmed by experienced pathologists for the each case.

The use of all of the human tissue samples and the experimental procedures for this study were reviewed and approved by the Ethics Committee of the Cancer Institute (Hospital), Peking Union Medical College and Chinese Academy of Medical Sciences.

Cell culture. Three human lung cancer cell lines, L (squamous cell lung cancer), PAa (lung adenocarcinoma), and PG (large cell lung cancer), and four immortalized human bronchial epithelial cell lines, C45, M-BE, Tr, and Y-BE, were used in this study. All the cancer cell lines were fed with RPMI 1640 (Life Technologies, Grand Island, NY) containing 10% FCS and maintained in a humidified incubator with 5% CO2 at 37°C. The four immortalized human bronchial epithelial cell lines that were established in this laboratory were cultivated in serum-free MCDB151 medium (Sigma, St. Louis, MO) as described previously (16).

RNA extraction and RT-PCR. Total RNA was isolated from the cell lines and the tissue samples with TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) according to the manufacturer's instruction.

RT-PCR analysis for the expression of TPX2 was conducted with the primers of TPX2-F (ACCTTGCCCTACTAAGATT) and TPX2-R (AATGTGGCACAGGTTGAGC). The PCR was done under the conditions of 32 cycles of amplification at 94°C for 30 seconds, 54°C for 30 seconds, and 72°C for 40 seconds and the 176-bp PCR products were checked on agarose gel electrophoresis. As the internal control, the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase, was also tested with the primers of GAPDH-F (GAAGGTGAAGGTCGGAGTC) and GAPDH-R (GAAGATGGTGATGGGATTTC). The primer pairs were designed to generate a DNA fragment spanning an exon-exon junction for the RT-PCR analysis (17).

Western blot. Total protein was extracted from ~2 x 106 cultured cells, separated by electrophoresis, and then transferred into nylon membrane according to the routine protocol (6). The blotted membrane was incubated with the rabbit anti-hTPX2 polyclonal antibody (a generous gift from Dr. Oliver J. Gruss, European Molecular Biology Laboratory, Heidelberg, Germany) at a dilution of 1:2,000 (18) followed by horseradish peroxidase–conjugated anti-rabbit secondary antibody (Dako, Glostrup, Denmark), and the proteins were detected with chemiluminescence reagents. The membrane was reprobed with an antibody against ß-actin (Sigma) as a control for equivalent protein loading.

Immunofluorescence staining. Immunofluorescence analysis was done on the cultured cells according to the protocol described by Wittmann et al. (5). Briefly, the cells grown on coverslips were fixed in cold methanol for 1 hour and then incubated with the rabbit anti-hTPX2 polyclonal antibody (1:2,000 diluted) for 2 hours. Following the washes with PBS, the cells were incubated for 45 minutes with FITC anti-rabbit antibody (Roche, Lewes, United Kingdom). The cells were subsequently incubated with mouse antibody against {gamma}-tubulin (Sigma) followed with rhodamine anti-mouse antibody (Roche). The nuclei were finally counterstained with diamidinophenylindole.

Immunohistochemical analysis. Immunohistochemical staining was done on 5-µm-thick sections cut from the tissue microarrays or ordinary paraffin-embedded blocks. The primary rabbit anti-TPX2 polyclonal antibody was 1:500 diluted and incubated with the sections at 4°C overnight. The labeled TPX2 protein in the tissue sections was detected with the ABC kit (Zymed Laboratories, Inc., San Francisco, CA). The nuclei were then counterstained with hematoxylin.

The TPX2 immunohistochemistry-stained slides were read independently by two pathologists. Only manifest nuclear staining was defined as a positive reaction. The TPX2 labeling index (LI) was ranked according to the percentage of positive cell nuclei observed. Samples in which ≥50% of the nuclei showed positive staining were rated 4, those with 31% to 50% of nuclei stained were rated 3, those with 11% to 30% of nuclei stained were rated 2, those with ≤10% of nuclei stained were rated 1, and those with no detectable nuclei stained were defined 0. The positive sample was defined on cutoff point for TPX2 immunoreactive score at 10% (TPX2 LI ≥ 2).

Statistical analysis. All calculations were made using the SPSS software package version 10.0 (SPSS, Inc., Chicago, IL). The variables (e.g., TPX2 LI of grade, stage, metastasis, etc.) were compared by the Kruskal-Wallis nonparametric analysis and Spearman's correlation. Relative risk analysis was computed by the logistic regression. The prognostic value of TPX2 protein level was evaluated by the product-limit estimate of the survival function (Kaplan-Meier method), and differences between the survival functions were assessed with the Mantel-Haenszel log-rank test and confirmed by the generalized Wilcoxon test. All statistical tests assumed a two-sided alternative with a 5% level of significance.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
TPX2 expression in the cell lines. With all the three lung cancer cell lines (L, PAa, and PG) and the four immortalized bronchial epithelial lines (C45, M-BE, Tr, and Y-BE) investigated, expression of TPX2 was found both at the mRNA level detected by RT-PCR and at the protein level detected by Western blot (Fig. 1A and B).


Figure 1
View larger version (62K):
[in this window]
[in a new window]
 
Fig. 1. TPX2 expression in lung cancer (L, PAa, and PG) and immortalized bronchial epithelial (C45, M-BE, Tr, and Y-BE) cell lines and lung cancers. A, mRNA expression of TPX2 and glyceraldehyde-3-phosphate dehydrogenase (as the internal control) in the cell lines, detected by RT-PCR. B, protein expression of TPX2 and ß-actin (as a control for equivalent protein loading) in the cell lines, detected by Western blotting. C, semiquantitative RT-PCR analysis for TPX2 expression in paired normal (N) and tumor (T) tissues of 21 patients with squamous cell lung cancer. In cases 6, 10, 12, 16, and 20, there was no expression difference between normal and tumor tissues, whereas overexpression of TPX2 mRNA was observed in the tumor tissues of the other 16 cases.

 
When the M-BE cells were immunofluorescently stained, it was observed that TPX2 protein localized in nucleus at the interphase and in mitotic spindle at the metaphase (see Fig. 2) along with the cell cycle.


Figure 2
View larger version (38K):
[in this window]
[in a new window]
 
Fig. 2. Protein expression and subcellular localization of TPX2 in M-BE cells identified by immunofluorescent staining. TPX2 was visualized with the antibody against TPX2 and the FITC-conjugated secondary antibody (green). Centrosomes were visualized with antibody against {gamma}-tubulin and the rhodamine-conjugated secondary antibody (red). The nucleus was labeled with 4',6-diamidino-2-phenylindole (blue). Magnification, x1,000.

 
TPX2 expression in the tissue samples derived from the lung cancer patients. Comparing with the matched nontumorous lung tissue, overexpressed TPX2 mRNA was detected by RT-PCR, in 16 of the 21 tumor samples derived the patients with primary SCC in lung (Fig. 1C).

The results of immunohistochemical staining for TPX2 protein on the tissue microarrays of lung cancer are summarized in Table 1. Overall, the expression of TPX2 was detected in 62.4% (371 of 595) of the tumor tissues, whereas there was no TPX2 positive staining observed in the normal control tissues. As shown in Fig. 3, the positively stained TPX2 protein mainly presented to the nuclei.


View this table:
[in this window]
[in a new window]
 
Table 1. Immunohistochemical staining for TPX2 on the tissue microarrays of squamous cell lung cancer

 

Figure 3
View larger version (106K):
[in this window]
[in a new window]
 
Fig. 3. TPX2 expression in the tumors and precancerous lesions of patients with squamous cell lung cancer analyzed by immunohistochemical staining. A, TPX2 immunohistochemical staining on the tissue microarray of lung cancers. A1, normal bronchial epithelia (the weak staining at the brush border of epithelial cells is false positive); A2, normal alveoli; A3, primary tumor without lymph node metastasis; A4, primary tumor with lymph node metastasis; A5, the corresponding lymph node metastases for the primary tumor in A4 (arrow, a mitotic spindle at metaphase). B, TPX2 immunohistochemical staining on the tissue section containing the stepwise precancerous lesions derived from a patient with squamous cell lung cancer. B1, normal bronchial epithelia; B2, dysplasia; B3, carcinoma in situ; B4, original image of B1 to B3 (from left to right).

 
As the further investigation on the ordinary paraffin-embedded sections, the data of TPX2 expression in the precancerous lesions collected from the same group of lung cancer patients are displayed in Table 2 and Fig. 3B. Briefly, the mean value of the TPX2 LI for the squamous metaplasia, dysplasia, and carcinoma in situ was 0.81 ± 0.47, 1.82 ± 0.52, and 2.18 ± 0.54, respectively. Notably, TPX2 positive staining was mostly observed in the basal cell layer of the squamous metaplastic epithelium.


View this table:
[in this window]
[in a new window]
 
Table 2. Immunohistochemical staining for TPX2 on the precancerous lesions derived from the patients with squamous cell lung cancer

 
TPX2 expression associated with the grade and the stage. As shown in Table 3, the Spearman's rank-order correlation statistics revealed an association between the TPX2 LI and differentiation grade of the tumors investigated; the mean TPX2 LI for the well, moderately, and poorly differentiated tumors was 1.48 ± 0.79, 1.86 ± 0.97, and 2.05 ± 1.03, respectively. Besides, a more significant correlation between the expression of TPX2 and stage of the SCC in lung was also discovered; the mean TPX2 LI of the tumors from stage I, II, III, and IV of the disease was 1.65 ± 0.80, 2.08 ± 1.05, 2.09 ± 1.07, and 2.88 ± 1.13, respectively.


View this table:
[in this window]
[in a new window]
 
Table 3. Correlations between TPX2 expression and the clinicopathologic variables of the squamous cell lung cancers

 
TPX2 expression associated with lymphous metastasis. When the primary tumors with and without lymph node metastasis were compared, the mean TPX2 LI for the former and the latter was 2.15 ± 1.07 and 1.66 ± 0.82 (P < 0.001), respectively (see Table 1). On the other hand, Table 4 further displays the expressive status of TPX2 in the group of patients with the advanced SCC, indicating a remarkable consistency between the 155 primary tumors and their matched lymph node metastases compared using the McNemar test (P = 0.846).


View this table:
[in this window]
[in a new window]
 
Table 4. TPX2 expression status in the primary tumors and the corresponding lymph node metastases of the squamous cell lung cancers

 
TPX2 expression associated with survival rate of the patients. Among the patients whose tissue samples were investigated for expression of TPX2 by immunohistochemical analysis, 82 cases had complete 5-year follow-up information. The data regarding the TPX2 expression status of the tumors and the survival time of the patients were illustrated in Fig. 4. For the group of patients in whom TPX2 expression was detected in ≤10% of the tumor cells, the mean survival time was 79.0 months (95% confidence interval, 62.7-95.3 months) with 5-year survival rate of 58.82%, whereas for the other group of patients in whom TPX2 expression was detected in >10% of the tumor cells the mean survival time was 33.8 months (95% confidence interval, 23.2-44.4 months) with 5-year survival rate of 16.67%. The two survival curves show significant difference. Of this 82 cases, 34 patients were with ≤10% TPX2 staining and 48 patients were with >10% staining, whereas 49 patients were without evidence of lymph node metastasis and 33 patients were with lymph node metastasis. Data of a cross-analysis of TPX2 expression and lymph node metastasis for the survival function are shown in Table 5 using the log-rank test.


Figure 4
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4. Correlation between TPX2 expression and survival of the patients with squamous cell lung cancer. Upper curve, group of patients with TPX2 expression <10% of the cells in the tumor tissue (95% confidence interval, 62.7-95.3 months); lower curve, group of the patients with TPX2 expression >10% of the cells in the tumor tissue (95% confidence interval, 23.2-44.4 months; P = 0.0001).

 

View this table:
[in this window]
[in a new window]
 
Table 5. Cross-analysis of TPX2 expression and lymph node metastasis for the survival function

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The microtubule-associated protein TPX2 has been reported to be crucial for mitotic spindle formation in Xenopus egg extracts and in cultured cells (1820), which can bind to tubulin and induce microtubule polymerization. During the cell cycle phases S and G2, TPX2 is diffusely distributed all over the nucleus, whereas in mitotic cells it is strictly associated with the spindle as shown with the immortalized human bronchial epithelial cells detected by immunofluorescent staining (see Fig. 2). The similar phenomenon was observed in other types of cell (6, 18, 21, 22).

As a proliferation marker, TPX2 exclusively recognized the cells within the S, G2, and M phases (6, 23), which coincides with our finding that TPX2 overexpressed in the immortalized bronchial epithelial cell lines, lung cancer cell lines, and tumor tissues, comparing with that in the normal tissues (bronchial epithelium and alveoli) derived from the patients with lung cancer. When we assessed the expression of TPX2 protein in the paraffin-embedded tissues, the cutoff point for the immunoreactive score was set at 10%. The reason was that ≤10% cell nuclei were positively stained by the antibody against TPX2 (LI ≤ 1) in the normal bronchial epithelia and alveoli tissues investigated. The same cutoff point for TPX2-expressing evaluation was also applied by Rudolph et al. (13).

Taking into consideration of the complexity of lung cancer development, we investigated the sequential precancerous lesions available from the same group of the patients with squamous cell lung cancer in addition to the results obtained from the invasive tumor tissues. The gradually increased clusters of TPX2 positively stained cell nuclei were observed along with the progression from the squamous metaplasia, to dysplasia, and carcinoma in situ. The expressive status of TPX2 in the precancerous lesions was consistent with that detected in the immortalized bronchial epithelial cell lines (e.g., M-BE and Y-BE) that were considered as in the "precancerous state" (24, 25). Previous studies indicated that TPX2-overexpressing cells exhibited DNA polyploidy, implying that excess TPX2 may inhibit nuclear division (26) and that aneuploidy could be detected at the transition from the squamous metaplasia to the dysplasia (27) and frequency of aneuploidy increased with the progressive atypia in the respiratory epithelium of lung cancer patients (28). Coincidentally, our results of immunohistochemical analysis showed that the TPX2 LI was significantly increased during the transition from the squamous metaplasia to the dysplasia. The data suggest that TPX2, as a proliferation stimulator, facilitates the stepwise tumorigenesis occurring in central airways and that TPX2 could be a candidate early biomarker for malignant transformation of bronchial epithelium. With regard to the mechanism, the abnormal expression of TPX2 may be driven by high-level copy number of the gene as reported by Tonon et al. (29).

The abnormal expression of TPX2 has been documented in some malignancies, such as breast cancer (13), endometrioid adenocarcinoma (24), and neuroblastoma (15). Two reports revealed up-regulated levels of TPX2 mRNA in lung cancer cell lines and small-sized tumor samples of lung cancer (8, 29). In this study, we have clearly shown overexpressed TPX2 protein in the tumor tissues and evaluated its clinical significance, with 432 cases of squamous cell lung cancer.

Data in Table 3 show a remarkable correlation between expression levels of TPX2 and the differentiation grade of the SCC tumors and an even more significant association between the TPX2 LI and the stage of the disease. Furthermore, TPX2 expression levels represented a notable discrepancy between lymph node–negative and lymph node–positive primary tumors (Table 1), whereas in the patients with advanced SCC the TPX2 expression status in the primary tumors and the corresponding lymph node metastases showed an extraordinary coherence (Table 4). Therefore, TPX2 may enhance the metastasis capability of the tumor cells, and the TPX2 LI could be considered a risk factor for metastasis of squamous cell lung cancer.

To explore the effect of TPX2 on the survival rate further, we compared the survival time of the SCC patients with different TPX2 expression levels that were assessed by 10% cutoff point for TPX2-positive cells. The statistically significant difference (58.82% versus 16.67%) on 5-year survival rate between the two groups combining a cross-analysis with the lymph node metastasis suggests that the TPX2 expressive status could serve as an independent prognostic indicator for human SCC in lung.

The findings above are well in line with the discoveries reported with other histologic types of malignancy [e.g., breast cancer (13), endometrioid adenocarcinoma (14), and neuroblastoma (15)]. An increased expression of TPX2 might reflect an advanced loss of cell cycle inhibitory mechanisms resulting in more aggressive tumors (23). Nevertheless, the direct function of TPX2 on cancer metastasis needs further research.

Although the investigation focused on squamous cell lung cancer, we did not find any correlation between TPX2 expression and cigarette smoking. The age, gender, and family tumor history of the patients are also regarded as the interrelated factors to TPX2 expression (data not shown).

Data derived from this study have shown that the aberrant expression of TPX2 may play important role(s) in both malignant transformation of respiratory epithelium and progression of squamous cell lung cancer. It provides new insights into tumor biology and may be beneficial to better understand the WHO/International Association for the Study of Lung Cancer classification for the precancerous lesions of SCC in lung from a molecular biological point of view.


    Acknowledgments
 
We thank Dr. Oliver J. Gruss for generously supplying the TPX2 antibody and Dr. Ge Huang for kind assistance with statistical analysis.


    Footnotes
 
Grant support: National Basic Research Program of China grant 2004CB518707, National High-Tech R&D Program of China grants 2002BA711A06 and 2002AA2Z2011, and Specialized Research Fund for the Doctoral Program of Higher Education grant 20030023005 (Y. Gao) and National Natural Science Foundation of China grant 30270582 and National High-Tech R&D Program of China grant 2002BA711A11 (S. Cheng).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Y. Ma and D. Lin contributed equally to this work.

4 Y. Ma et al., unpublished data. Back

Received 8/12/05; revised 11/22/05; accepted 12/14/05.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kerr KM. Pulmonary preinvasive neoplasia. J Clin Pathol 2001;54:257–71.[Abstract/Free Full Text]
  2. Meert AP, Verdebout JM, Martin B, Ninane V, Feoli F, Sculier JP. Epidermal growth factor receptor expression in pre-invasive and early invasive bronchial lesions. Eur Respir J 2003;21:611–5.[Abstract/Free Full Text]
  3. Travis WD, Colby TV, Shimosato Y, et al. WHO/IASLC classification of lung and pleural tumors. 3rd ed. Berlin: Springer-Verlag; 1999.
  4. Nicholson AG, Perry LJ, Cury PM, et al. Reproducibility of the WHO/IASLC grading system for pre-invasive squamous lesions of the bronchus: a study of inter-observer and intra-observer variation. Histopathology 2001;38:202–8.[CrossRef][Medline]
  5. Wittmann T, Boleti H, Antony C, Karsenti E, Vernos I. Localization of the kinesin-like protein Xklp2 to spindle poles requires a leucine zipper, a microtubule-associated protein, and dynein. J Cell Biol 1998;143:673–85.[Abstract/Free Full Text]
  6. Heidebrecht HJ, Buck F, Steinmann J, Sprenger R, Wacker HH, Parwaresch R. p100: a novel proliferation-associated nuclear protein specifically restricted to cell cycle phases S, G2, and M. Blood 1997;90:226–33.[Abstract/Free Full Text]
  7. Zhang Y, Heidebrecht H, Rott A, Schlegelberger B, Parwaresch R. Assignment of human proliferation associated p100 gene (C20orf1) to human chromosome band 20q11.2 by in situ hybridization. Cytogenet Cell Genet 1999;84:182–3.[Medline]
  8. Rudolph P, Schubert C, Tamm S, et al. Telomerase activity in melanocytic lesions: a potential marker of tumor biology. Am J Pathol 2000;156:1425–32.[Abstract/Free Full Text]
  9. Manda R, Kohno T, Matsuno Y, Takenoshita S, Kuwano H, Yokota J. Identification of genes (SPON2 and C20orf2) differentially expressed between cancerous and noncancerous lung cells by mRNA differential display. Genomics 1999;61:5–14.[CrossRef][Medline]
  10. Liu M, Cheng J, Wang L, Zhang S. Identification and characterization of gene transactivated by hepatitis C virus core protein with DNA microarray assay. Weichangbingxue He Ganbingxue Zazhi 2003;12:233–6.
  11. Hufton SE, Moerkerk PT, Brandwijk R, de Bruine AP, Arends JW, Hoogenboom HR. A profile of differentially expressed genes in primary colorectal cancer using suppression subtractive hybridization. FEBS Lett 1999;463:77–82.[CrossRef][Medline]
  12. Wang Y, Han KJ, Pang XW, et al. Large scale identification of human hepatocellular carcinoma-associated antigens by autoantibodies. J Immunol 2002;169:1102–9.[Abstract/Free Full Text]
  13. Rudolph P, Alm P, Heidebrecht HJ, et al. Immunologic proliferation marker Ki-S2 as prognostic indicator for lymph node-negative breast cancer. J Natl Cancer Inst 1999;91:271–8.[Abstract/Free Full Text]
  14. Bonatz G, Luttges J, Hedderich J, et al. Prognostic significance of a novel proliferation marker, anti-repp 86, for endometrial carcinoma: a multivariate study. Hum Pathol 1999;30:949–56.[CrossRef][Medline]
  15. Krams M, Heidebrecht HJ, Hero B, et al. Repp86 expression and outcome in patients with neuroblastoma. J Clin Oncol 2003;21:1810–8.[Abstract/Free Full Text]
  16. Lu YJ, Dong XY, Guo SP, Ke Y, Cheng SJ. Integration of SV40 at 12q23 in SV40-immortalized human bronchial epithelial cells. Carcinogenesis 1996;17:2089–91.[Abstract/Free Full Text]
  17. Sun W, Zhang K, Zhang X, et al. Identification of differentially expressed genes in human lung squamous cell carcinoma using suppression subtractive hybridization. Cancer Lett 2004;212:83–93.[Medline]
  18. Gruss OJ, Wittmann M, Yokoyama H, et al. Chromosome-induced microtubule assembly mediated by TPX2 is required for spindle formation in HeLa cells. Nat Cell Biol 2002;4:871–9.[CrossRef][Medline]
  19. Garrett S, Auer K, Compton DA, Kapoor TM. hTPX2 is required for normal spindle morphology and centrosome integrity during vertebrate cell division. Curr Biol 2002;12:2055–9.[CrossRef][Medline]
  20. Gruss OJ, Carazo-Salas RE, Schatz CA, et al. Ran induces spindle assembly by reversing the inhibitory effect of importin {alpha} on TPX2 activity. Cell 2001;104:83–93.[CrossRef][Medline]
  21. Wittmann T, Wilm M, Karsenti E, Vernos I. TPX2, A novel Xenopus MAP involved in spindle pole organization. J Cell Biol 2000;149:1405–18.[Abstract/Free Full Text]
  22. Kufer TA, Sillje HH, Korner R, Gruss OJ, Meraldi P, Nigg EA. Human TPX2 is required for targeting Aurora-A kinase to the spindle. J Cell Biol 2002;158:617–23.[Abstract/Free Full Text]
  23. Rudolph P, Knuchel R, Endl E, Heidebrecht HJ, Hofstader F, Parwaresch R. The immunohistochemical marker Ki-S2: cell cycle kinetics and tissue distribution of a novel proliferation-specific antigen. Mod Pathol 1998;11:450–6.[Medline]
  24. Cheng S, Gao Y, Dong X, et al. Molecular and cytogenetic alterations in early stage of carcinogenesis of human lung. Cancer Lett 2001;162 Suppl:S5–10.[Medline]
  25. An Q, Pacyna-Gengelbach M, Schluns K, et al. Identification of differentially expressed genes in immortalized human bronchial epithelial cell line as a model for in vitro study of lung carcinogenesis. Int J Cancer 2003;103:194–204.[Medline]
  26. Heidebrecht HJ, Adam-Klages S, Szczepanowski M, et al. repp86: a human protein associated in the progression of mitosis. Mol Cancer Res 2003;1:271–9.[Abstract/Free Full Text]
  27. Hirsch FR, Franklin WA, Gazdar AF, Bunn PA, Jr. Early detection of lung cancer: clinical perspectives of recent advances in biology and radiology. Clin Cancer Res 2001;7:5–22.[Abstract/Free Full Text]
  28. Smith AL, Hung J, Walker L, et al. Extensive areas of aneuploidy are present in the respiratory epithelium of lung cancer patients. Br J Cancer 1996;73:203–9.[Medline]
  29. Tonon G, Wong KK, Maulik G, et al. High-resolution genomic profiles of human lung cancer. Proc Natl Acad Sci U S A 2005;102:9625–30.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
G. Pascreau, F. Eckerdt, A. L. Lewellyn, C. Prigent, and J. L. Maller
Phosphorylation of p53 Is Regulated by TPX2-Aurora A in Xenopus Oocytes
J. Biol. Chem., February 27, 2009; 284(9): 5497 - 5505.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
I. Perez de Castro, G. de Carcer, and M. Malumbres
A census of mitotic cancer genes: new insights into tumor cell biology and cancer therapy
Carcinogenesis, May 1, 2007; 28(5): 899 - 912.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ma, Y.
Right arrow Articles by Gao, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, Y.
Right arrow Articles by Gao, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online