
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Human Cancer Biology |
Authors' Affiliations: Departments of 1 Etiology and Carcinogenesis, 2 Pathology, and 3 Thoracic Surgery, Cancer Institute (Hospital), Peking Union Medical College and Chinese Academy of Medical Sciences, Beijing, People's Republic of China
Requests for reprints: Yanning Gao, Department of Etiology and Carcinogenesis, Cancer Institute (Hospital), Peking Union Medical College and Chinese Academy of Medical Sciences, P.O. Box 2258, Beijing 100021, People's Republic of China. Phone: 86-10-6778-2323; E-mail: yngao{at}pubem.cicams.ac.cn.
| Abstract |
|---|
|
|
|---|
Experimental Design and Results: The expressive status of TPX2 was firstly examined with lung cancer (L, PAa, and PG) and immortalized bronchial epithelial (C45, M-BE, Tr, and Y-BE) cell lines, and TPX2 expression was detected at both RNA and protein levels by reverse transcription-PCR and Western blotting, respectively. Immunofluorescence staining on M-BE cells showed that the subcellular localization of TPX2 protein is in nucleus at interphase and mitotic spindle at metaphase. Immunohistochemical analyses were subsequently done on the precancerous lesions derived from 114 patients and the tumor tissues of 432 patients with SCC in lung. Extremely low levels of TPX2 protein were found in the normal bronchial epithelia and alveoli, whereas gradually increased TPX2 protein levels were observed in the squamous metaplasia, dysplasia, carcinoma in situ, and invasive tumor tissues. Statistical analysis showed that the TPX2 immunohistochemistry labeling index was correlated with the differentiation grade, stage, and lymphous metastasis of SCC in lung and that TPX2 overexpression is significantly associated with decreased 5-year survival rate of the patients.
Conclusions: Aberrant expression of TPX2 may play important role(s) in both malignant transformation of respiratory epithelium and progression of squamous cell lung cancer and could serve as a prognostic predictor for the disease.
Targeting protein for Xklp2 (TPX2; ref. 5) is a cell cycleassociated human protein of
100-kDa apparent molecular mass encoded by a gene located on human chromosome band 20q11.2 (6, 7). This protein homologue in Xenopus laevis is also named formerly as restricted expressed proliferation-associated protein (repp86; ref. 8), p100 (6), differentially expressed in lung cells 2 (DIL2; ref. 9), HCTP4 (10), FLS353 (11), hepatocellular carcinoma-associated antigen 519 (HCA519; ref. 12), and chromosome 20 open reading frame 1 (C20orf1; ref. 7). Its expression is tightly cell cycle regulated, becoming detectable at the G1-S transit and vanishing at the completion of cytokinesis. TPX2, therefore, might allow a more precise evaluation of the proliferative behavior of tumor cells (6).
Aberrant expression of TPX2 has been found in various malignancies (1315), but less is known in lung cancer, especially in stepwise carcinogenesis of bronchial epithelium. Manda et al. reported that an identical cDNA, C20orf2, was retrieved by comparing cancerous and noncancerous cell lines derived from lung in a mRNA differential display (9). In previous study, we identified TPX2 sequence from a differential expression cDNA library constructed with the tumor and normal epithelium tissues derived from the patients with squamous cell carcinoma (SCC) of lung.4
To validate the findings above, in current study, we further investigated expression of TPX2 in the tumor tissues of SCC of lung and the related cell lines (including lung cancer cell lines and immortalized bronchial epithelial cell lines) on both mRNA and protein levels. The subcellular localization of TPX2 protein in human bronchial epithelial cells was also tested. In addition, the significance of TPX2 expression in stepwise tumorigenesis of human bronchial epithelium was evaluated, and the correlations between TPX2 protein levels and grade of differentiation, staging and lymphous metastasis of the tumors, and survival time of the patients were also analyzed.
| Materials and Methods |
|---|
|
|
|---|
For immunohistochemical analysis, formalin-fixed, paraffin-embedded tissue samples derived from a total of 432 patients with primary SCC in lung were used in a manner of tissue microarrays. The tissue microarrays contain 195 primary tumors from the patients without lymph node metastases diagnosed histopathologically, 237 primary tumors from the patients with lymph node metastases, and 163 corresponding metastatic tumors in lymph node. Normal tissues (20 samples of bronchial epithelium and 22 of normal alveoli) derived from the same group of the patients were also included.
Furthermore, precancerous lesions of bronchial epithelium were identified in the 114 patients whose tumor tissues were contained within the tissue microarrays described above. The tissue samples of these precancerous lesions, including 68 of squamous metaplasia, 66 of dysplasia, and 44 of carcinoma in situ, were selected for further immunohistochemical analysis on ordinary paraffin-embedded tissue sections.
All the patients involved in this study underwent surgical treatment at the Cancer Hospital, Chinese Academy of Medical Sciences from 1992 to 2003, and none of them accepted chemotherapy and/or radiotherapy before surgery. The histopathologic diagnosis was double confirmed by experienced pathologists for the each case.
The use of all of the human tissue samples and the experimental procedures for this study were reviewed and approved by the Ethics Committee of the Cancer Institute (Hospital), Peking Union Medical College and Chinese Academy of Medical Sciences.
Cell culture. Three human lung cancer cell lines, L (squamous cell lung cancer), PAa (lung adenocarcinoma), and PG (large cell lung cancer), and four immortalized human bronchial epithelial cell lines, C45, M-BE, Tr, and Y-BE, were used in this study. All the cancer cell lines were fed with RPMI 1640 (Life Technologies, Grand Island, NY) containing 10% FCS and maintained in a humidified incubator with 5% CO2 at 37°C. The four immortalized human bronchial epithelial cell lines that were established in this laboratory were cultivated in serum-free MCDB151 medium (Sigma, St. Louis, MO) as described previously (16).
RNA extraction and RT-PCR. Total RNA was isolated from the cell lines and the tissue samples with TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) according to the manufacturer's instruction.
RT-PCR analysis for the expression of TPX2 was conducted with the primers of TPX2-F (ACCTTGCCCTACTAAGATT) and TPX2-R (AATGTGGCACAGGTTGAGC). The PCR was done under the conditions of 32 cycles of amplification at 94°C for 30 seconds, 54°C for 30 seconds, and 72°C for 40 seconds and the 176-bp PCR products were checked on agarose gel electrophoresis. As the internal control, the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase, was also tested with the primers of GAPDH-F (GAAGGTGAAGGTCGGAGTC) and GAPDH-R (GAAGATGGTGATGGGATTTC). The primer pairs were designed to generate a DNA fragment spanning an exon-exon junction for the RT-PCR analysis (17).
Western blot. Total protein was extracted from
2 x 106 cultured cells, separated by electrophoresis, and then transferred into nylon membrane according to the routine protocol (6). The blotted membrane was incubated with the rabbit anti-hTPX2 polyclonal antibody (a generous gift from Dr. Oliver J. Gruss, European Molecular Biology Laboratory, Heidelberg, Germany) at a dilution of 1:2,000 (18) followed by horseradish peroxidaseconjugated anti-rabbit secondary antibody (Dako, Glostrup, Denmark), and the proteins were detected with chemiluminescence reagents. The membrane was reprobed with an antibody against ß-actin (Sigma) as a control for equivalent protein loading.
Immunofluorescence staining. Immunofluorescence analysis was done on the cultured cells according to the protocol described by Wittmann et al. (5). Briefly, the cells grown on coverslips were fixed in cold methanol for 1 hour and then incubated with the rabbit anti-hTPX2 polyclonal antibody (1:2,000 diluted) for 2 hours. Following the washes with PBS, the cells were incubated for 45 minutes with FITC anti-rabbit antibody (Roche, Lewes, United Kingdom). The cells were subsequently incubated with mouse antibody against
-tubulin (Sigma) followed with rhodamine anti-mouse antibody (Roche). The nuclei were finally counterstained with diamidinophenylindole.
Immunohistochemical analysis. Immunohistochemical staining was done on 5-µm-thick sections cut from the tissue microarrays or ordinary paraffin-embedded blocks. The primary rabbit anti-TPX2 polyclonal antibody was 1:500 diluted and incubated with the sections at 4°C overnight. The labeled TPX2 protein in the tissue sections was detected with the ABC kit (Zymed Laboratories, Inc., San Francisco, CA). The nuclei were then counterstained with hematoxylin.
The TPX2 immunohistochemistry-stained slides were read independently by two pathologists. Only manifest nuclear staining was defined as a positive reaction. The TPX2 labeling index (LI) was ranked according to the percentage of positive cell nuclei observed. Samples in which
50% of the nuclei showed positive staining were rated 4, those with 31% to 50% of nuclei stained were rated 3, those with 11% to 30% of nuclei stained were rated 2, those with
10% of nuclei stained were rated 1, and those with no detectable nuclei stained were defined 0. The positive sample was defined on cutoff point for TPX2 immunoreactive score at 10% (TPX2 LI
2).
Statistical analysis. All calculations were made using the SPSS software package version 10.0 (SPSS, Inc., Chicago, IL). The variables (e.g., TPX2 LI of grade, stage, metastasis, etc.) were compared by the Kruskal-Wallis nonparametric analysis and Spearman's correlation. Relative risk analysis was computed by the logistic regression. The prognostic value of TPX2 protein level was evaluated by the product-limit estimate of the survival function (Kaplan-Meier method), and differences between the survival functions were assessed with the Mantel-Haenszel log-rank test and confirmed by the generalized Wilcoxon test. All statistical tests assumed a two-sided alternative with a 5% level of significance.
| Results |
|---|
|
|
|---|
|
|
The results of immunohistochemical staining for TPX2 protein on the tissue microarrays of lung cancer are summarized in Table 1. Overall, the expression of TPX2 was detected in 62.4% (371 of 595) of the tumor tissues, whereas there was no TPX2 positive staining observed in the normal control tissues. As shown in Fig. 3, the positively stained TPX2 protein mainly presented to the nuclei.
|
|
|
|
|
10% of the tumor cells, the mean survival time was 79.0 months (95% confidence interval, 62.7-95.3 months) with 5-year survival rate of 58.82%, whereas for the other group of patients in whom TPX2 expression was detected in >10% of the tumor cells the mean survival time was 33.8 months (95% confidence interval, 23.2-44.4 months) with 5-year survival rate of 16.67%. The two survival curves show significant difference. Of this 82 cases, 34 patients were with
10% TPX2 staining and 48 patients were with >10% staining, whereas 49 patients were without evidence of lymph node metastasis and 33 patients were with lymph node metastasis. Data of a cross-analysis of TPX2 expression and lymph node metastasis for the survival function are shown in Table 5 using the log-rank test.
|
|
| Discussion |
|---|
|
|
|---|
As a proliferation marker, TPX2 exclusively recognized the cells within the S, G2, and M phases (6, 23), which coincides with our finding that TPX2 overexpressed in the immortalized bronchial epithelial cell lines, lung cancer cell lines, and tumor tissues, comparing with that in the normal tissues (bronchial epithelium and alveoli) derived from the patients with lung cancer. When we assessed the expression of TPX2 protein in the paraffin-embedded tissues, the cutoff point for the immunoreactive score was set at 10%. The reason was that
10% cell nuclei were positively stained by the antibody against TPX2 (LI
1) in the normal bronchial epithelia and alveoli tissues investigated. The same cutoff point for TPX2-expressing evaluation was also applied by Rudolph et al. (13).
Taking into consideration of the complexity of lung cancer development, we investigated the sequential precancerous lesions available from the same group of the patients with squamous cell lung cancer in addition to the results obtained from the invasive tumor tissues. The gradually increased clusters of TPX2 positively stained cell nuclei were observed along with the progression from the squamous metaplasia, to dysplasia, and carcinoma in situ. The expressive status of TPX2 in the precancerous lesions was consistent with that detected in the immortalized bronchial epithelial cell lines (e.g., M-BE and Y-BE) that were considered as in the "precancerous state" (24, 25). Previous studies indicated that TPX2-overexpressing cells exhibited DNA polyploidy, implying that excess TPX2 may inhibit nuclear division (26) and that aneuploidy could be detected at the transition from the squamous metaplasia to the dysplasia (27) and frequency of aneuploidy increased with the progressive atypia in the respiratory epithelium of lung cancer patients (28). Coincidentally, our results of immunohistochemical analysis showed that the TPX2 LI was significantly increased during the transition from the squamous metaplasia to the dysplasia. The data suggest that TPX2, as a proliferation stimulator, facilitates the stepwise tumorigenesis occurring in central airways and that TPX2 could be a candidate early biomarker for malignant transformation of bronchial epithelium. With regard to the mechanism, the abnormal expression of TPX2 may be driven by high-level copy number of the gene as reported by Tonon et al. (29).
The abnormal expression of TPX2 has been documented in some malignancies, such as breast cancer (13), endometrioid adenocarcinoma (24), and neuroblastoma (15). Two reports revealed up-regulated levels of TPX2 mRNA in lung cancer cell lines and small-sized tumor samples of lung cancer (8, 29). In this study, we have clearly shown overexpressed TPX2 protein in the tumor tissues and evaluated its clinical significance, with 432 cases of squamous cell lung cancer.
Data in Table 3 show a remarkable correlation between expression levels of TPX2 and the differentiation grade of the SCC tumors and an even more significant association between the TPX2 LI and the stage of the disease. Furthermore, TPX2 expression levels represented a notable discrepancy between lymph nodenegative and lymph nodepositive primary tumors (Table 1), whereas in the patients with advanced SCC the TPX2 expression status in the primary tumors and the corresponding lymph node metastases showed an extraordinary coherence (Table 4). Therefore, TPX2 may enhance the metastasis capability of the tumor cells, and the TPX2 LI could be considered a risk factor for metastasis of squamous cell lung cancer.
To explore the effect of TPX2 on the survival rate further, we compared the survival time of the SCC patients with different TPX2 expression levels that were assessed by 10% cutoff point for TPX2-positive cells. The statistically significant difference (58.82% versus 16.67%) on 5-year survival rate between the two groups combining a cross-analysis with the lymph node metastasis suggests that the TPX2 expressive status could serve as an independent prognostic indicator for human SCC in lung.
The findings above are well in line with the discoveries reported with other histologic types of malignancy [e.g., breast cancer (13), endometrioid adenocarcinoma (14), and neuroblastoma (15)]. An increased expression of TPX2 might reflect an advanced loss of cell cycle inhibitory mechanisms resulting in more aggressive tumors (23). Nevertheless, the direct function of TPX2 on cancer metastasis needs further research.
Although the investigation focused on squamous cell lung cancer, we did not find any correlation between TPX2 expression and cigarette smoking. The age, gender, and family tumor history of the patients are also regarded as the interrelated factors to TPX2 expression (data not shown).
Data derived from this study have shown that the aberrant expression of TPX2 may play important role(s) in both malignant transformation of respiratory epithelium and progression of squamous cell lung cancer. It provides new insights into tumor biology and may be beneficial to better understand the WHO/International Association for the Study of Lung Cancer classification for the precancerous lesions of SCC in lung from a molecular biological point of view.
| Acknowledgments |
|---|
| Footnotes |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Note: Y. Ma and D. Lin contributed equally to this work.
4 Y. Ma et al., unpublished data. ![]()
Received 8/12/05; revised 11/22/05; accepted 12/14/05.
| References |
|---|
|
|
|---|
on TPX2 activity. Cell 2001;104:8393.[CrossRef][Medline]This article has been cited by other articles:
![]() |
G. Pascreau, F. Eckerdt, A. L. Lewellyn, C. Prigent, and J. L. Maller Phosphorylation of p53 Is Regulated by TPX2-Aurora A in Xenopus Oocytes J. Biol. Chem., February 27, 2009; 284(9): 5497 - 5505. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Perez de Castro, G. de Carcer, and M. Malumbres A census of mitotic cancer genes: new insights into tumor cell biology and cancer therapy Carcinogenesis, May 1, 2007; 28(5): 899 - 912. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |