
Clinical Cancer Research Vol. 12, 1215-1220, February 2006
© 2006 American Association for Cancer Research
Imaging, Diagnosis, Prognosis |
Significance of Skp2 Expression in Primary Breast Cancer
Hideto Sonoda,
Hiroshi Inoue,
Kazuhiko Ogawa,
Tohru Utsunomiya,
Taka-aki Masuda and
Masaki Mori
Authors' Affiliation: Department of Surgery, Kyushu University Hospital at Beppu, Beppu, Japan
Requests for reprints: Masaki Mori, Department of Surgery, Kyushu University Hospital at Beppu, Beppu 874-0838, Japan. Phone: 81-977-27-1650; Fax: 81-977-27-1651; E-mail: mmori{at}beppu.kyushu-u.ac.jp.
 |
Abstract
|
|---|
Purpose: We previously reported the p27 expression level to be an independent prognostic factor, and a high S-phase kinase-associated protein 2 (Skp2) expression level was significantly correlated with a poor prognosis in patients with gastric cancer. We herein examined the Skp2 expression in breast cancer and attempted to identify any associations between the Skp2 expression status and either the clinicopathologic variables or the patient's prognosis.
Experimental Design: We established four Skp2-transfected breast cancer cell lines and assessed the correlations between the Skp2 and p27 expressions using real-time reverse transcription-PCR and a Western blot analysis. We then analyzed the clinicopathologic significance of Skp2 mRNA expression in 169 Japanese patients with breast cancer. An immunohistochemical analysis was also done.
Results: The p27 protein expression markedly decreased after Skp2 transfection, whereas no alteration in the p27 mRNA expression was observed. The Skp2 protein expression level as determined by immunohistochemical staining thus showed a significant correlation with the Skp2 mRNA expression (P = 0.001) and a significant inverse correlation with the p27 protein expression (P = 0.042). The patients with a high Skp2 gene expression were significantly younger than those with a low expression (P = 0.002). The prognosis of patients with a high Skp2 expression was significantly (P = 0.022) poorer than for those with a low expression. Moreover, a high expression of Skp2 was an independent variable that correlated with a shorter disease-free survival (relative risk, 3.33; 95% confidence interval, 1.296-8.578; P = 0.013).
Conclusions: The present results suggest that Skp2 may play an important role particularly in young breast cancer, and it is also considered to have strong independent prognostic potential and thus may prove to be a useful target for the treatment of breast cancer.
Breast cancer incidence rates vary substantially, with the highest rates found in the United States, Canada, and Northern Europe. In Japan, breast cancer recently surpassed stomach cancer to become the most popular female cancer in 1995 (1, 2). In the past decade, breast-conserving treatment has become the standard treatment for early breast cancer, and the relapse rate has decreased thanks to advances in adjuvant therapies, such as chemotherapy, hormonal therapy, and radiation therapy. Relapses, whereas treatable, are not curable by the currently available therapy. Differences have been suggested to exist in the biological properties of each type of breast cancer.
One cyclin kinaseassociated protein, p27, has been shown to have an inhibitory activity of cyclin/cyclin-dependent kinase complex during the G0 and G1 phase (3). A number of studies, including our recent report (4), have shown the protein level of p27 to markedly decrease in a variety of cancers, such as breast, colon, prostate, lung, ovary, brain tumors, and lymphomas (516). In those reports, the protein level of p27 was down-regulated; however, the mRNA level is not always suppressed accordingly. The reason of this discordance has been ascribed to the proteolysis system of p27. The protein level of p27 has recently been reported to mainly be regulated through the degradation by ubiquitin-dependent proteolysis (1719), and S-phase kinase-associated protein 2 (Skp2) was identified as a cofactor that targets p27 for ubiquitination (2022). The role of p27 in cell cycle control has been elucidated in a Skp2 knockout mice model (23). The cells from the knockout mice showed high levels of p27, free cyclin E, polyploidy, and centrosome overduplication, and these alterations were abolished in Skp2/p27 double knockout mice (24), thus suggesting that p27 is a primary target of Skp2.
A reduction in the p27 expression level is associated with a high aggressiveness and a poor prognosis in various malignant tumors, including breast cancer (5, 25). Previously, we reported that the p27 expression status was an independent prognostic factor for patients with gastric cancer (4). On the other hand, Esteva et al. reported that p27 expression was not related to the disease-free survival (26). Furthermore, we showed that Skp2 mRNA was overexpressed in cancer tissue, and the higher Skp2 expression group showed a significantly poorer prognosis in patients with gastric cancer, whereas gastric cancer cells transfected with Skp2 showed a significantly higher growth rate, resistance to apoptosis, and invasion potential than the control cells. These findings indicate that Skp2 expression can modulate the malignant phenotype of cancer, possibly via p27 proteolysis (27). In addition, Signoretti et al. have recently showed that Skp2 is overexpressed in breast cancers that are negative for both the estrogen and HER-2 receptor and with either the primary and local recurrences or metastatic disease from breast cancers. A relationship between the Skp2 expression level and a poor prognosis was also observed (28).
In the present study, we thus analyzed the Skp2 expression status in 169 Japanese patients with breast cancers and clarified any correlations with the clinicopathologic features, including age, menopause, tumor size, the presence of lymph node metastasis and estrogen and progesterone receptors, invasion to the vessels, disease-free survival, and overall survival. A multivariate analysis using the Cox regression model was also done.
 |
Materials and Methods
|
|---|
Clinical samples. Fresh surgical specimens were obtained from 169 patients with primary breast cancer after informed consent was obtained. The patients had all undergone surgery at the Department of Molecular and Surgical Oncology, Medical Institute of Bioregulation, Kyushu University (Beppu, Japan) from October 1993 to October 1999. The patients with advanced stage were treated with postoperative hormonal therapy combined with radiotherapy. Chemotherapy combined with radiotherapy was done when they had recurrent disease. Data concerning the patient characteristics, including age, menopause, tumor size, the presence of lymph node metastasis and estrogen and progesterone receptors, invasion to the vessels, disease-free survival, overall survival, and development of metastasis, were available for all 169 patients, and the observation period ranged from 7.5 to 131 months (the median follow-up period was 34.7 months). Of the 169 patients, 38 showed recurrence, and 20 died of breast cancer.
Cell culture. Human breast cancer cell lines YMB-1, MCF 7, SKBR3, and CRL1500 were obtained from the Cell Resource Center for Biomedical Research Institute of Development, Aging and Cancer (Tohoku University, Sendai, Japan). YMB-1 was maintained in DMEM, and MCF 7, SKBR3, and CRL1500 were maintained in RPMI 1640 supplemented with 10% fetal bovine serum at 37°C in a 5% humidified CO2 atmosphere.
Antibodies. Mouse monoclonal antibodies to Skp2 and p27 were purchased from the Zymed Laboratory (San Francisco, CA) and Transduction Laboratories (Lexington, KY), respectively.
Total RNA isolation. Frozen tissue specimens or cultured cell lines in a state of subconfluency were homogenized, and the total RNA was extracted using the modified acid/guanidine/phenol/chloroform method as described previously (29).
Quantitative real-time PCR. The reverse transcriptase reaction was done as described previously (29). Real-time PCR was done using the iCycler iQ detection system (Bio-Rad, Richmond, CA) and iQ SYBR Green Supermix. The reactions were done in 96-well plates with Optical-Quality 8-tube Strips (Bio-Rad). Skp2 and glyceraldehyde-3-phosphate dehydrogenase mRNA were amplified in separate tubes using the following protocol: 95°C for 10 minutes, then 35 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. The increase in fluorescence was measured in real-time during the extension step. The following primers were used (all 5' to 3' direction): Skp2 sense primer, GCTGCTAAAGGTCTCTGGTGT and antisense primer, AGGCTTAGATTCTGCAACTTG; glyceraldehyde-3-phosphate dehydrogenase sense primer, GTCAACGGATTTGGTCTGTATT and antisense primer, AGTCTTCTGGGTGGCAGTGAT.
Immunohistochemistry. From the 169 breast cancer cases that were analyzed for their Skp2 mRNA expression level, we selected 137 specimens of which formalin-fixed, paraffin-embedded tissue was available. Immunohistochemical studies of Skp2 and p27 were done using the avidin-biotin-peroxidase method (LSAB kit, DAKO, Kyoto, Japan) as described previously (4). All sections were counterstained with hematoxylin. The primary monoclonal antibodies against Skp2 and p27 were used at dilutions of 1:500 and 1:1,000, respectively. Skp2 and p27 scores were determined by observing 1,000 cancer cells in at least five high-power fields and were classified as high (staining in >50% of cells) or low (staining in <50% of cells) as described previously (4).
Western blot analysis. Total protein was extracted from samples with radioimmunoprecipitation assay buffer. Aliquots of total protein were applied to 10% acrylamide gradient gels. After electrophoresis, samples were electroblotted onto a polyvinylidene membrane (Immobilon, Millipore, Inc., Bedford, MA) at 0.5 A for 40 minutes at 4°C. Skp2 and p27 were detected using the mouse monoclonal antibodies at a dilution of 1:2,000 and 1:2,500, respectively. The blots were developed with horseradish peroxidaselinked antimouse immunoglobulin (Promega, Inc., Madison. WI). The signals were detected using Supersignal (Pierce, Inc., Rockford, IL).
Transfection assays. Human Skp2 cDNA was generated by reverse transcription-PCR and subcloned into pcDNA3.1 expression vector (Invitrogen, Carlsbad. CA) as described previously (27) and then were transfected transiently into the cell lines by the LipofectAMINE method (Life Technologies, Inc., Tokyo, Japan) as described previously (30). A mock vectortransfected clone was used as a control.
Statistical analysis. Associations between the variables were tested by Student's t test or Fisher's exact test. Survival curves were drawn according to the Kaplan-Meier method, and a survival analysis was carried out using the Mantel-Cox test. A multivariate analysis using the Cox regression model was done only on the variables with showing P < 0.05 in the univariate analyses. All statistical differences were deemed significant at the level of P < 0.05. The staging of breast cancers were classified based on the criteria established by the Union Internationale Contre le Cancer.
 |
Results
|
|---|
Relationship between Skp2 and p27 expression in Skp2-transfected cells. We examined the Skp2 mRNA expression in four breast cancer cell lines: YMB-1, MCF 7, SKBR3, and CRL1500 with reverse transcription-PCR. All of these cell lines expressed a low level of Skp2 mRNA (data not shown). Following Skp2 transfection, the p27 protein expression decreased in all four of the cell lines (Fig. 1), whereas there was no change in the p27 mRNA expression.

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 1. RT-PCR (A) and western blot (B) of Skp2 transfectants (t) and mocks (m) of four breast cancer cell lines (SKBR3, CRL1500, YMB-1, MCF7) and the relationship between Skp2 and p27 expression in vitro.
|
|
Skp2 and p27 expression in breast cancer. An immunohistochemical analysis in 137 breast cancer tissue specimens revealed that Skp2 protein was predominantly expressed in breast cancer cells. The breast carcinoma cases were then classified into four major patterns of Skp2/p27 expression (Fig. 2). Fifty-two tumors (38%) showed a strong Skp2 protein level and a weak p27 protein level. Thirty-eight tumors (28%) expressed a weak Skp2 protein level and a strong p27 protein level. In 33 tumors (24%), both weak Skp2 and weak p27 protein levels were observed. Fourteen tumors (10%) expressed both strong Skp2 and strong p27 protein levels. The Skp2 protein level thus showed a strong correlation with the Skp2 mRNA expression (P < 0.001), and it was also significantly reverse correlated with the p27 protein expression level (P = 0.023). The p27 protein expression level showed the inverse correlation with the Skp2 mRNA expression level (P = 0.042; Table 1).

View larger version (135K):
[in this window]
[in a new window]
|
Fig. 2. Relationship between Skp2 and p27 expression in breast cancer tissues. Immunohistochemical stainings for Skp2 (A, C, E, and G) and p27 (B, D, F, and H) of four cancers representative of three expression patterns of Skp2 and p27. The cancers in the top row (A and B) show strong Skp2 immunostaining and weak p27 immunostaining. The cancer in the second row (C and D) shows weak Skp2 immunostaining and strong p27 immunostaining. The cancer in the third row (E and F) is weak for both Skp2 and p27 immunostaining. The cancer in the fourth row (G and H) is strong for both Skp2 and p27 immunostaining. x 100.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1. Relationship among the expressions of Skp2 protein, Skp2 mRNA, and p27 protein in breast cancers (n = 137)
|
|
Clinical significance of Skp2 expression in breast cancer. To perform a quantitative analysis, we evaluated the expression of Skp2 mRNA in tumor tissue specimens (T) by normalization as follows: T = Skp2 (T)/glyceraldehyde-3-phosphate dehydrogenase (T)/Skp2 of YMB-1/glyceraldehyde-3-phosphate dehydrogenase of YMB-1 as determined by a real-time PCR analysis. According to this analysis, Ts ranged from 0 to 39 (median, 1.02). We set a cutoff value (T, 1.02) for these mRNA expression levels in tumor tissue specimens, because the median level of Skp2 mRNA in the 169 cancer tissue specimens was 1.02. Using this cutoff value, we classified the tumors into two groups: high expression group (n =85) and a low expression group (n = 84).
As shown in Table 2, a significant difference in age was found between the high Skp2 mRNA expression group and the low expression group (P = 0.002). On the other hand, no significant difference was seen regarding the tumor size, vascular or lymphatic involvement, lymph node metastasis, or the state of estrogen receptor or progesterone receptor. Of the 169 patients classified from stages I to III, the high Skp2 mRNA expression group (n = 85) showed a significantly (P = 0.022) poorer disease-free survival than the low expression group (n = 84; Fig. 3). In a multivariate analysis, the high Skp2 mRNA expression group showed a significantly poorer disease-free survival, independent of the existence of the lymph node metastasis at the time of operation (relative risk, 3.33; 95% confidence interval, 1.296-8.587; P = 0.013). However, no significant correlation was observed between the overall survival and the expression Skp2 mRNA (Fig. 4).

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 3. Disease free survival of patients with breast cancer at Stage I to III according to Skp2 mRNA expression. High Skp2 mRNA expression group; T value > 1.02 (n = 85) Low Skp2 mRNA expression group; T value 1.02 (n = 84) P = 0.022; Mantol-Cox method.
|
|

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 4. Overall survival of patients with breast cancer at Stage I to III according to Skp2 mRNA expression. High Skp2 mRNA expression group; T value > 1.02 (n = 85) Low Skp2 mRNA expression group; T value 1.02 (n = 84) P = 0.130; Mantol-Cox method.
|
|
 |
Discussion
|
|---|
Consistent with Krek's and our previous transfection assays on cell lines (27, 31), the breast cancer cell lines transfected with Skp2 showed a decrease in the p27 protein levels with no remarkable change in its mRNA expression levels. The Skp2 protein levels correlated with the Skp2 mRNA expression and inversely correlated with the p27 protein levels in breast cancer tissue specimens. Furthermore, a high Skp2 mRNA expression significantly correlated with a poor disease-free survival for stage I to III primary breast cancer. It was previously reported that a high Skp2 expression correlated with a poor disease-free survival for laryngeal cancer (32), sarcomas (33), ovarian cancer (34), and lymphoma (35) while showing a poor prognosis for oral cancer (36), laryngeal cancer (32), sarcomas (33), ovarian cancer (34), lymphoma (35), lung cancer, gastric cancer (27), and breast cancer (28). Those reports analyzed at most 100 cases, whereas our present study thus outnumbered them.
We consider it likely that Skp2 is related to a degradation of p27, in vivo as well as in vitro, and it could thus be a potentially useful relapse marker for patients with breast cancer. A significant difference in age was found between the high Skp2 mRNA expression group and the low expression group. Breast cancer in young patients has been reported to be likely negative for estrogen receptor (3741), whereas it also has a higher S-phase fraction than breast cancer in elderly patients (42, 43), and it also correlated with a poor prognosis (37, 40, 43). Our present data showed the Skp2 mRNA expression to be significantly higher in patients younger than 55 years (Table 2). Although no significant difference was observed, the high Skp2 mRNA expression group more frequently showed estrogen receptornegative tumors than the estrogen receptorpositive cases (P = 0.109). This finding is consistent with previous observation, as reported by Signoretti et al., on 84 patients with advanced breast cancer (28), although they did not employ a multivariate analysis. We thus did a multivariate analysis; thus, high expression of Skp2 was found to be an independent prognostic variable that correlated with a shorter disease-free survival (relative risk, 3.33; 95% confidence interval, 1.296-8.578; P = 0.013; Table 3). In addition, the high Skp2 mRNA expression group showed a poor disease-free survival.
We previously found that Skp2 transfection modulated the malignant phenotype of cancer cells. The increase in the percentage of cells in the S phase, a high proliferation activity, resistance to apoptosis, and a high degree of invasiveness were specifically induced by Skp2 transfection in gastric cancer cells (27). The high Skp2 expression group was more frequently observed in the younger patients group. A high expression of Skp2 may thus play a more important role in breast cancers occurring in young patients.
It is important to clarify the molecular mechanisms by which a Skp2 expression is up-regulated in breast cancer. Yokoi et al. showed that Skp2, located at 5p13, often showed genomic amplification not only in cell lines but also in primary small cell lung carcinomas (44). On the other hand, Pene at al. reported that LY294002, a phosphorylation inhibitor of Akt, up-regulated the p27 protein expression, whereas the expression of both Skp2 and cyclin D1 dramatically diminished in vitro. This suggested that the biological effects of phosphatidylinositol 3-kinase activation might participate in a reduction of Skp2 protein and an increase of p27 protein (45). Rosner et al. recently indicated that TSC2 (tuberous sclerosis complex 2) deletion can shorten p27 half-life because TSC2 can bind to p27 and interfere with p27 binding to Skp2 (46). Recent studies discovered a cyclin-dependent kinase subunit 1 to be an integral part of the ubiquitination mechanism for p27 (47, 48). In addition, the relationship among Skp2, cyclin-dependent kinase subunit 1, and p27 was also found to play a very important role in gastric cancer carcinogenesis (49).
In conclusion, the prognosis of patients with a high Skp2 expression was significantly (P = 0.022) poorer than those with a low expression. Moreover, a multivariate analysis revealed that a high expression of Skp2 was an independent variable that correlated with a shorter disease-free survival. Thus, a Skp2 gene overexpression could therefore be a poor disease-free survival factor for breast cancer and also inversely correlated with the p27 expression in breast cancer. These findings strongly suggest that Skp2 could play an important role in breast cancer progression and may also be a novel molecular target for the treatment of breast cancer, especially in breast cancer occurring in young women.
 |
Acknowledgments
|
|---|
We thank T. Shimooka, K. Ogata, J. Miyake, and M. Ikeda for their valuable technical assistance.
 |
Footnotes
|
|---|
Grant support: Scientific Research (B) grants-in-aid 15390398, 15390379, and 16390381; Scientific Research (C) grants-in-aid 15591412 and 15591411; and Japan Society for Promotion of Science's grant-in-aid for exploratory research 16659337.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 8/ 5/05;
revised 12/ 2/05;
accepted 12/ 2/05.
 |
References
|
|---|
- Parkin DM, Bray F, Ferlay J, Pisani P. Estimating the world cancer burden: Globocan 2000. Int J Cancer 2001;94:1536.[CrossRef][Medline]
- Ajiki W, Kinoshita N, Tsukuma H, Oshima A. Cancer incidence and incidence rates in Japan in 1996: estimates based on data from 10 population-based cancer registries. Jpn J Clin Oncol 2001;31:4104.[Free Full Text]
- Russo AA, Jeffrey PD, Patten AK, Massague J, Pavletich NP. Crystal structure of the p27Kip1 cyclin-dependent-kinase inhibitor bound to the cyclin A-Cdk2 complex. Nature 1996;382:32531.[CrossRef][Medline]
- Mori M, Mimori K, Shiraishi T, et al. p27 expression and gastric carcinoma. Nat Med 1997;3:593.[CrossRef][Medline]
- Porter PL, Malone KE, Heagerty PJ, et al. Expression of cell-cycle regulators p27Kip1 and cyclin E, alone and in combination, correlate with survival in young breast cancer patients. Nat Med 1997;3:2225.[CrossRef][Medline]
- Fredersdorf S, Burns J, Milne AM, et al. High level expression of p27(kip1) and cyclin D1 in some human breast cancer cells: inverse correlation between the expression of p27(kip1) and degree of malignancy in human breast and colorectal cancers. Proc Natl Acad Sci U S A 1997;94:63805.[Abstract/Free Full Text]
- Guo Y, Sklar GN, Borkowski A, Kyprianou N. Loss of the cyclin-dependent kinase inhibitor p27(Kip1) protein in human prostate cancer correlates with tumor grade. Clin Cancer Res 1997;3:226974.[Abstract/Free Full Text]
- Loda M, Cukor B, Tam SW, et al. Increased proteasome-dependent degradation of the cyclin-dependent kinase inhibitor p27 in aggressive colorectal carcinomas. Nat Med 1997;3:2314.[CrossRef][Medline]
- Sgambato A, Zhang YJ, Arber N, et al. Deregulated expression of p27(Kip1) in human breast cancers. Clin Cancer Res 1997;3:187987.[Abstract]
- Tan P, Cady B, Wanner M, et al. The cell cycle inhibitor p27 is an independent prognostic marker in small (T1a,b) invasive breast carcinomas. Cancer Res 1997;57:125963.[Abstract/Free Full Text]
- Alleyne CH, Jr., He J, Yang J, et al. Analysis of cyclin dependent kinase inhibitors in malignant astrocytomas. Int J Oncol 1999;14:11116.[Medline]
- Catzavelos C, Tsao MS, DeBoer G, et al. Reduced expression of the cell cycle inhibitor p27Kip1 in non-small cell lung carcinoma: a prognostic factor independent of Ras. Cancer Res 1999;59:6848.[Abstract/Free Full Text]
- Cavalla P, Piva R, Bortolotto S, et al. p27/kip1 expression in oligodendrogliomas and its possible prognostic role. Acta Neuropathol (Berl) 1999;98:62934.[CrossRef][Medline]
- Nakasu S, Nakajima M, Handa J. Anomalous p27kip1 expression in a subset of malignant gliomas. Brain Tumor Pathol 1999;16:1721.[CrossRef][Medline]
- Slingerland J, Pagano M. Regulation of the cdk inhibitor p27 and its deregulation in cancer. J Cell Physiol 2000;183:107.[CrossRef][Medline]
- Philipp-Staheli J, Payne SR, Kemp CJ. p27(Kip1): regulation and function of a haploinsufficient tumor suppressor and its misregulation in cancer. Exp Cell Res 2001;264:14868.[CrossRef][Medline]
- Hengst L, Reed SI. Translational control of p27Kip1 accumulation during the cell cycle. Science 1996;271:18614.[Abstract]
- Pagano M, Tam SW, Theodoras AM, et al. Role of the ubiquitin-proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27. Science 1995;269:6825.[Abstract/Free Full Text]
- Dahia PL, Aguiar RC, Honegger J, et al. Mutation and expression analysis of the p27/kip1 gene in corticotrophin-secreting tumours. Oncogene 1998;16:6976.[CrossRef][Medline]
- Tsvetkov LM, Yeh KH, Lee SJ, Sun H, Zhang H. p27(Kip1) ubiquitination and degradation is regulated by the SCF(Skp2) complex through phosphorylated Thr187 in p27. Curr Biol 1999;9:6614.[CrossRef][Medline]
- Sutterluty H, Chatelain E, Marti A, et al. p45SKP2 promotes p27Kip1 degradation and induces S phase in quiescent cells. Nat Cell Biol 1999;1:20714.[CrossRef][Medline]
- Carrano AC, Eytan E, Hershko A, Pagano M. SKP2 is required for ubiquitin-mediated degradation of the CDK inhibitor p27. Nat Cell Biol 1999;1:1939.[CrossRef][Medline]
- Nakayama K, Nagahama H, Minamishima YA, et al. Targeted disruption of Skp2 results in accumulation of cyclin E and p27(Kip1), polyploidy and centrosome overduplication. EMBO J 2000;19:206981.[CrossRef][Medline]
- Yoshida K, Nakayama K, Nagahama H, et al. Involvement of p27(KIP1) degradation by Skp2 in the regulation of proliferation in response to wounding of corneal epithelium. Invest Ophthalmol Vis Sci 2002;43:36470.[Abstract/Free Full Text]
- Tsuchiya A, Zhang GJ, Kanno M. Prognostic impact of cyclin-dependent kinase inhibitor p27kip1 in node-positive breast cancer. J Surg Oncol 1999;70:2304.[CrossRef][Medline]
- Esteva FJ, Sahin AA, Rassidakis GZ, et al. Jun activation domain binding protein 1 expression is associated with low p27(Kip1)levels in node-negative breast cancer. Clin Cancer Res 2003;9:56529.[Abstract/Free Full Text]
- Masuda TA, Inoue H, Sonoda H, et al. Clinical and biological significance of S-phase kinase-associated protein 2 (Skp2) gene expression in gastric carcinoma: modulation of malignant phenotype by Skp2 overexpression, possibly via p27 proteolysis. Cancer Res 2002;62:381925.[Abstract/Free Full Text]
- Signoretti S, Di Marcotullio L, Richardson A, et al. Oncogenic role of the ubiquitin ligase subunit Skp2 in human breast cancer. J Clin Invest 2002;110:63341.[CrossRef][Medline]
- Mori M, Staniunas RJ, Barnard GF, et al. The significance of carbonic anhydrase expression in human colorectal cancer. Gastroenterology 1993;105:8206.[Medline]
- Shibata K, Tanaka S, Shiraishi T, Kitano S, Mori M. G-protein gamma 7 is down-regulated in cancers and associated with p 27kip1-induced growth arrest. Cancer Res 1999;59:1096101.[Abstract/Free Full Text]
- Gstaiger M, Jordan R, Lim M, et al. Skp2 is oncogenic and overexpressed in human cancers. Proc Natl Acad Sci U S A 2001;98:50438.[Abstract/Free Full Text]
- Dong Y, Sui L, Watanabe Y, Sugimoto K, Tokuda M. S-phase kinase-associated protein 2 expression in laryngeal squamous cell carcinomas and its prognostic implications. Oncol Rep 2003;10:3215.[Medline]
- Oliveira AM, Okuno SH, Nascimento AG, Lloyd RV. Skp2 protein expression in soft tissue sarcomas. J Clin Oncol 2003;21:7227.[Abstract/Free Full Text]
- Shigemasa K, Gu L, O'Brien TJ, Ohama K. Skp2 overexpression is a prognostic factor in patients with ovarian adenocarcinoma. Clin Cancer Res 2003;9:175663.[Abstract/Free Full Text]
- Seki R, Okamura T, Koga H, et al. Prognostic significance of the F-box protein Skp2 expression in diffuse large B-cell lymphoma. Am J Hematol 2003;73:2305.[CrossRef][Medline]
- Kudo Y, Kitajima S, Sato S, et al. High expression of S-phase kinase-interacting protein 2, human F-box protein, correlates with poor prognosis in oral squamous cell carcinomas. Cancer Res 2001;61:70447.[Abstract/Free Full Text]
- Jmor S, Al-Sayer H, Heys SD, et al. Breast cancer in women aged 35 and under: prognosis and survival. J R Coll Surg Edinb 2002;47:6939.[Medline]
- Newman LA, Bunner S, Carolin K, et al. Ethnicity related differences in the survival of young breast carcinoma patients. Cancer 2002;95:217.[CrossRef][Medline]
- Rodrigues NA, Dillon D, Carter D, Parisot N, Haffty BG. Differences in the pathologic and molecular features of intraductal breast carcinoma between younger and older women. Cancer 2003;97:1393403.[CrossRef][Medline]
- Kollias J, Elston CW, Ellis IO, Robertson JF, Blamey RW. Early-onset breast cancer-histopathological and prognostic considerations. Br J Cancer 1997;75:131823.[Medline]
- Walker RA, Lees E, Webb MB, Dearing SJ. Breast carcinomas occurring in young women (<35 years) are different. Br J Cancer 1996;74:1796800.[Medline]
- Stal O, Carstensen J, Hatschek T, Nordenskjold B. Significance of S-phase fraction and hormone receptor content in the management of young breast cancer patients. Br J Cancer 1992;66:70611.[Medline]
- Gajdos C, Tartter PI, Bleiweiss IJ, Bodian C, Brower ST. Stage 0 to stage III breast cancer in young women. J Am Coll Surg 2000;190:5239.[CrossRef][Medline]
- Yokoi S, Yasui K, Saito-Ohara F, et al. A novel target gene, SKP2, within the 5p13 amplicon that is frequently detected in small cell lung cancers. Am J Pathol 2002;161:20716.[Abstract/Free Full Text]
- Pene F, Claessens YE, Muller O, et al. Role of the phosphatidylinositol 3-kinase/Akt and mTOR/P70S6-kinase pathways in the proliferation and apoptosis in multiple myeloma. Oncogene 2002;21:658797.[CrossRef][Medline]
- Spruck C, Strohmaier H, Watson M, et al. A CDK-independent function of mammalian Cks1: targeting of SCF(Skp2) to the CDK inhibitor p27Kip1. Mol Cell 2001;7:63950.[CrossRef][Medline]
- Ganoth D, Bornstein G, Ko TK, et al. The cell-cycle regulatory protein Cks1 is required for SCF(Skp2)-mediated ubiquitinylation of p27. Nat Cell Biol 2001;3:3214.[CrossRef][Medline]
- Rosner M, Hengstschlager M. Tuberin binds p27 and negatively regulates its interaction with the SCF component Skp2. J Biol Chem 2004;279:4870715.[Abstract/Free Full Text]
- Masuda TA, Inoue H, Nishida K, et al. Cyclin-dependent kinase 1 gene expression is associated with poor prognosis in gastric carcinoma. Clin Cancer Res 2003;9:56938.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
T. Fujita, W. Liu, H. Doihara, and Y. Wan
Regulation of Skp2-p27 Axis by the Cdh1/Anaphase-Promoting Complex Pathway in Colorectal Tumorigenesis
Am. J. Pathol.,
July 1, 2008;
173(1):
217 - 228.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ravaioli, F. Monti, M. M. Regan, F. Maffini, M. G. Mastropasqua, V. Spataro, M. Castiglione-Gertsch, I. Panzini, L. Gianni, A. Goldhirsch, et al.
p27 and Skp2 immunoreactivity and its clinical significance with endocrine and chemo-endocrine treatments in node-negative early breast cancer
Ann. Onc.,
April 1, 2008;
19(4):
660 - 668.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Chen, A. K. Seth, and A. E. Aplin
Genetic and Expression Aberrations of E3 Ubiquitin Ligases in Human Breast Cancer
Mol. Cancer Res.,
October 1, 2006;
4(10):
695 - 707.
[Abstract]
[Full Text]
[PDF]
|
 |
|