| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cancer Therapy: Preclinical |
Authors' Affiliations: 1 Divison of Apoptosis Regulation, D040, German Cancer Research Center (DKFZ); Departments of 2 Internal Medicine and 3 Surgery, University of Heidelberg, Heidelberg, Germany; 4 Department of Internal Medicine I, Johannes Gutenberg University Mainz, Mainz, Germany; and 5 Department of Plant Science, Laboratory of Molecular Biology, Wageningen University, Wageningen, the Netherlands
Requests for reprints: Henning Walczak, Division for Apoptosis Regulation, D040, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 580, Heidelberg D-69120, Germany. Phone: 49-6221-423701; Fax: 49-6221-423699; E-mail: h.walczak{at}dkfz.de.
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
Experimental Design: To clarify this issue, we comprehensively tested four different recombinant forms of TRAIL for their apoptosis-inducing capacity on PHH obtained from a total of 55 human livers between day 1 and day 8 of in vitro culture.
Results: One day after single-cell isolation, all but one recombinant form of TRAIL [i.e., an untagged form of TRAIL (TRAIL.0)] induced apoptosis in PHH. Apoptosis induction by TRAIL in these cells could only be fully inhibited by concomitant blockade of TRAIL receptor 1 and TRAIL receptor 2. At day 4 of in vitro culture, when surrogate markers indicated optimal hepatocyte in vitro function, only high doses of cross-linked FLAG-TRAIL killed PHH whereas the other three recombinant TRAIL forms did not. Strikingly, cotreatment of day 4 PHH with cisplatin sensitized for TRAIL-induced apoptosis whereas 5-fluorouracil, etoposide, gemcitabine, irinotecan, or oxaliplatin, which are commonly used in the treatment of gastrointestinal cancers, did not.
Conclusion: Our data show that whereas TRAIL alone or together with selected chemotherapeutic drugs seems to be safe, the combination of TRAIL with cisplatin is toxic to PHH.
TRAIL induces apoptosis in a wide variety of human cancer cell lines (8), but not in most normal human cells (9–11). A nontagged recombinant form of TRAIL (i.e., the Apo2L.0 form) is currently under development as a biotherapeutic agent (reviewed in refs. 12, 13). However, it was reported that normal human hepatocytes undergo apoptosis when incubated with a recombinant polyhistidine–tagged or a cross-linked FLAG–tagged soluble form of human TRAIL in vitro (14, 15). These findings raised the concern of potential liver toxicity of systemic TRAIL administration in humans (16). Thus far, the in vivo safety of TRAIL administration has mainly been shown in different animal models (9, 10, 17). Leucine-zipper (LZ)-tagged versions of human and murine TRAIL (LZ-TRAIL) did not show any adverse effects in normal tissue in mice (18). Apo2L.0 was not toxic to isolated human and cynomolgus hepatocytes and was well tolerated in vivo in cynomolgus monkeys and chimpanzees (17, 19). Thus far, adverse effects of TRAIL on hepatocytes have only been shown in isolated human hepatocytes. In addition, contradicting results have been reported on the TRAIL sensitivity of primary human hepatocytes (PHH), which could only partially be explained by the use of different forms of recombinant TRAIL. In preclinical studies, TRAIL has shown to be a promising antitumor agent, which, in combination with chemotherapeutic drugs, synergistically kills many tumor cells (reviewed in ref. 20). However, potential toxic effects of such a combined therapy on primary human liver cells have not been sufficiently investigated far.
In the present study, we comprehensively investigated the hepatotoxicity of four different recombinant TRAIL forms on PHH and continuously monitored the apoptosis-inducing potential of TRAIL between day 1 and day 8 of in vitro culture. A novel recombinant version of TRAIL, isoleucine-zipper-TRAIL (iz-TRAIL), was analyzed for its cytotoxic activity in hepatoma cell lines and PHH.
Furthermore, we tested a panel of chemotherapeutic drugs which are widely used in the clinic for their TRAIL-sensitizing potential on PHH. Of clinical relevance, we found that cisplatin sensitized PHH for TRAIL-induced apoptosis. It will be important to take this into account when the combined clinical use of TRAIL with chemotherapy is considered.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Isolation and culture of PHH. PHH were isolated from healthy liver tissue obtained from patients undergoing partial liver resection with a two-step perfusion technique described by Berry and Friend (5) and modified by Schulze-Bergkamen et al. (21). The isolation procedure was approved by the Ethics Committee, Medical Faculty, University of Heidelberg. Cells were then seeded in maintenance medium supplemented with 10% FCS (Life Technologies) at a density of 1.0 x 105 to 1.5 x 105 viable cells/cm2 on collagen-coated culture plates (collagen type I; Serva Biochemicals, Heidelberg, Germany). The maintenance medium was changed 2 hours after seeding for William's medium E supplemented with 5% FCS, after another 12 hours and every day thereafter for serum-free William's medium E. All experiments were done in FCS-free maintenance medium. Cells were incubated at 37°C and 10% CO2.
Antibodies and reagents. The monoclonal anti-FLICE antibody C15 (22) and anti-APO-1 (23) were obtained from Alexis Corp. (San Diego, CA). Anti–poly(ADP-ribose) polymerase (clone C-2-10) was purchased from Biomol (Hamburg, Germany) and extracellular signal–regulated kinase 1 was from Transduction Laboratories (San Diego, CA). LZ-TRAIL was produced as described (9). A synthetic isoleucine zipper (iz) sequence (IEKKIEA)4 (24) was generated de novo via an oligonucleotide-based cloning procedure. Shortly, two oligonucleotides (ATACCATGGGTATTGAAAAAAAAATTGAAGCGATTGAAAAGAAGATCGAGGCATCGAGAAGAA and GGTAGATCTCGCTTCAATTTTTTTTTCAATCGCTTCAATTTTCTTCTCGATGGCCTCGATCTTC) were hybridized and filled up with Klenow polymerase. Subsequently, the fragment was digested with NcoI and BglII and inserted by a two-fragment ligation together with TRAIL cDNA (coding for amino acids 95-281) into pET28a (Novagen, San Diego, CA). The recombinant protein was expressed in E. coli Rosetta (DE3) pLysS at 18°C overnight. The purification of iz-TRAIL was done as described before for untagged TRAIL (10). The recombinant human FLAG-TRAIL was produced as described (25) and cross-linked by an anti-FLAG antibody (M2; Sigma, Deisenhofen, Germany). TRAIL.0 was produced and expressed as described (10). All TRAIL receptor–specific antibodies are available from Alexis: HS101, HS201, HS301, and HS401. For immunohistochemistry, we used mouse immunoglobulin G1 (IgG1) culture supernatant of TR1.02 (TRAIL-R1), TR2.21 (TRAIL-R2), TR3.06 (TRAIL-R3), TR4.18 (TRAIL-R4), and anti-APO-1. Horseradish peroxidase–conjugated goat anti-mouse IgG1, IgG2b, and anti-rabbit were obtained from Southern Biotechnology Associates (Birmingham, AL). For fluorescence-activated cell sorting (FACS) analysis, biotinylated secondary goat anti-mouse antibodies (Southern Biotechnology Associates, Birmingham, United Kingdom) and streptavidin-phycoerythrin (PharMingen, Hamburg, Germany) were used. Chemotherapeutic drugs were kindly provided by the pharmacy of the University of Heidelberg. All other chemicals used were of analytic grade and were purchased from Merck (Darmstadt, Germany) or Sigma Chemical Co. (St. Louis, MO).
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Cells (1 x 105) were seeded in 96-well plates (Costar, Cambridge, MA) directly after isolation. After the indicated time, 2.5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma Chemical) was added for 4 hours, cells were lysed, and the percentage of viable cells was calculated as described before (26).
FACS analysis. PHH were detached from the plates by EDTA (2 mmol/L). Cells were incubated with monoclonal antibodies against the TRAIL receptors, CD95, or control mIgG1, followed by biotinylated secondary goat anti-mIgG1 F(ab)2 antibody fragments and streptavidin-phycoerythrin. Surface staining was determined on a FACS Calibur cytometer (Becton Dickinson, Heidelberg, Germany).
Western blot analysis. Preparation of cell lysates and immunoblotting were done as described before (26). For Western blot analysis, supernatants were denatured and 20 µg of protein were separated on 4% to 12% NuPage Bis-Tris gradient gels (Novex, San Diego, CA) in MOPS buffer. For stripping, blots were incubated in 50 mmol/L glycine-HCl (pH 2.3) for 15 minutes at room temperature. Subsequently, blots were washed, blocked, and reprobed again.
Reverse transcription-PCR. Total RNA was isolated from cells using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the instructions of the manufacturer. Five micrograms of total RNA were transcribed into cDNA using the M-MuLV reverse transcriptase (AppliChem, Darmstadt, Germany) according to the instructions of the manufacturer. PCR was done using 0.4 µmol/L of each primer (ß-actin, forward: GCGACGAGGCCCAGAGCA and reverse: CCCGGCCAGCCAGGTCCAG; TRAIL-R1, forward: TGTTGTTGCATCGGCTCAGGTTGT and reverse: GAGGCGTTCCGTCCAGTTTTGTTG; TRAIL-R2, forward: GGCCCCACAACAAA-AGAGGTC and reverse: CAGCCCCAGGTCGTTGTGAGC; TRAIL-R3, forward: ACGGCG-TCGGGAACCATACC and reverse: GCTACACTTCCGGCACATCTCTG; TRAIL-R4, forward: CCCCCGGCAGGACGAAGTT and reverse: CTCCTCCGCTGCTGGGGTTTT), deoxynucleotide triphosphates (Sigma), and Taq polymerase (Qiagen). PCR conditions were as follows: initial denaturation, 5 minutes 95°C; cycle, 1 minute 94°C, 1 minute 56°C, 1 minute 72°C; final elongation, 15 minutes 72°C.
Immunohistochemistry. Formalin-fixed, paraffin-embedded liver tissue samples were cut into 3-µm sections, dewaxed, and pretreated in 10 mmol/L citrate buffer. Unspecific antibody binding was blocked by incubation with 20 mg/mL bovine serum albumin (20 mg/mL; Serva) and human 
-globulin (Gamma-Venin, 1 mg/mL; Aventis- Behring, Marburg, Germany). Antibodies against TRAIL-R1 to TRAIL-R4 were incubated at 4°C overnight or, in the case of CD95, for 1 hour at room temperature. Sections were washed, incubated with blocking solution [20% normal goat serum (Dianova) in PBS], followed by the secondary antibody (biotinylated goat anti mouse, Dianova) at room temperature, rinsed twice and incubated with streptavidin-alkaline phosphatase (BioGenex, San Ramon, CA). After washing, color reaction was developed using Fast Red Substrate System (DAKO, Glostrup, Denmark). After counterstaining with hematoxylin (DAKO), the sections were mounted in glycergel (DAKO).
Hoechst 33342 stain. For the nuclear staining with Hoechst 33342, cells were seeded in chamber slides at a density of 100,000/cm2. After treatment, cells were washed in PBS, fixed in 4% formalin, washed again, and incubated for 2 minutes in Hoechst 33342 (1 µg/mL in PBS).
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
PHH were cultured for up to 8 days in vitro. Between in vitro day 1 and day 8, PHH were exposed to different concentrations of LZ-TRAIL for 24 hours and cell viability was measured (Fig. 1A ). At day 1, up to 70% of the cells could be killed with LZ-TRAIL. However, at day 2 and day 3, increasingly less cells died on treatment with LZ-TRAIL. At day 4, PHH became TRAIL resistant even at high doses of LZ-TRAIL (Fig. 1A). This resistance was maintained at least until day 8 of in vitro culture (data not shown). In contrast, cells showed a high and sustained sensitivity for CD95L-induced apoptosis from day 1 until day 8. Thus, freshly isolated hepatocytes seem to be sensitive for TRAIL-induced cell death only directly after isolation.
|
To test the apoptosis-inducing capacity in tumor cells, we also treated the hepatoma cell line HepG2 with the four recombinant forms of TRAIL. LZ-TRAIL showed the highest apoptosis-inducing capacity on HepG2 cells (Fig. 1D). At higher concentrations, iz-TRAIL and cross-linked FLAG-TRAIL killed nearly as efficiently. However, TRAIL.0, which did not induce apoptosis in PHH at day 1 and day 4, was still able to induce substantial, albeit slightly reduced apoptosis in HepG2 cells in comparison with the other recombinant forms of TRAIL.
We next tested whether incubation of PHH with TRAIL or, as a control, with CD95L resulted in cleavage of caspase-8 and poly(ADP-ribose) polymerase and whether there was a difference at day 1 and day 4 of in vitro culture (Fig. 1E). Poly(ADP-ribose) polymerase, a substrate of executioner caspases, was cleaved on LZ-CD95L treatment of cultured hepatocytes at day 1 and day 4, but only in day 1 cultured hepatocytes when treated with LZ-TRAIL.
At day 1, caspase-8 processing was clearly visible after 4-hour treatment with LZ-CD95L. As expected, treatment of PHH at day 1 with LZ-TRAIL induced a significant caspase-8 cleavage. However, at day 4, even 8 hours of LZ-TRAIL treatment did not result in any detectable caspase-8 processing. Therefore, whereas PHH remained sensitive towards LZ-CD95L-induced apoptosis, they became resistant to LZ-TRAIL-mediated apoptosis.
TRAIL-induced apoptosis of PHH at day 1 is mediated by TRAIL-R1 and TRAIL-R2. Because TRAIL was capable of killing 
40% of PHH at day 1 but not at day 4, we tested whether TRAIL sensitivity is based on a differential expression of TRAIL receptors in native liver tissue and at day 1 and day 4 of in vitro culture. Transcripts of mRNA could be detected for all TRAIL receptors without any significant difference in the expression level between the primary liver tissue and liver cells of day 1 or day 4 culture (Fig. 2A
). However, in none of 12 different preparations of PHH cell-surface expression of any of the TRAIL receptors could be detected at day 0, day 1, or day 4 by FACS analysis (Fig. 2B). In contrast, TRAIL-sensitive HepG2 cells exhibited strong positive staining for TRAIL-R1 and TRAIL-R2 (Fig. 2B). Immunohistochemical staining of primary liver tissue showed a locally variable intensity for TRAIL-R1, which, however, was restricted to a cytoplasmic pattern without any membrane-associated signal (Fig. 2C). Between faintly stained hepatocytes, some strongly TRAIL-R1-positive sinusoidal cells were visible, resembling the staining pattern of Kupffer cells as detected with a CD68 costaining (data not shown). Staining of hepatocytes for TRAIL-R2, TRAIL-R3, and TRAIL-R4 showed mostly a cytoplasmic pattern. In contrast, CD95 hepatocyte surface expression could be detected by both FACS stain and immunohistochemistry (Fig. 2C). These data suggest a very low level and rather a cytoplasmic, instead of a membrane-bound, TRAIL receptor expression, which is in contrast to numerous hepatoma cell lines where TRAIL receptors could be readily detected by either method (26–28).
|
Cisplatin sensitizes PHH for TRAIL-induced apoptosis. Many tumor cell lines and cells derived from primary human tumors have been shown to be resistant to TRAIL-induced apoptosis (29). Therefore, in a number of studies, irradiation (30, 31) or chemotherapeutic drugs, including 5-fluorouracil (26), etoposide (32), cisplatin (33), oxaliplatin (34), irinotecan (35, 36), and gemcitabine (36), have been used together with TRAIL to sensitize tumor cells for TRAIL-induced apoptosis. However, such cotreatments can only be of clinical benefit if they do not sensitize normal cells, especially normal human liver cells. We therefore tested whether treatment with either of these drugs in combination with TRAIL exhibited any in vitro toxicity on PHH.
We exposed day 4 PHH to LZ-TRAIL in combination with increasing concentrations of 5-fluorouracil, irinotecan, gemcitabine, etoposide, oxaliplatin, and cisplatin, respectively, and determined cell viability after 24 hours (Fig. 3A ). 5-Fluorouracil, irinotecan, gemcitabine, and etoposide neither showed a considerable toxicity when administered alone nor did they sensitize PHH for TRAIL-induced cell death. Although the highest concentrations of oxaliplatin were toxic to PHH, there was no sensitization for TRAIL-induced apoptosis. In contrast, cisplatin itself was not toxic to PHH but showed a synergistic effect for TRAIL-induced cell death at high concentrations.
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
We found that freshly isolated human hepatocytes had become partially sensitive to all but one form of TRAIL but gradually reassumed resistance until day 3 and remained resistant until day 8 of in vitro culture (Fig. 1 and data not shown). After 4 days of in vitro culture, only high concentrations of cross-linked FLAG-TRAIL were still able to induce apoptosis (Fig. 1). At this time point, all other recombinant forms of TRAIL were unable to induce apoptosis in PHH. Only the untagged form of TRAIL (TRAIL.0) did not induce apoptosis in PHH at either time point.
Because we could not detect differences in the expression level of any one of the TRAIL receptors between TRAIL-sensitive PHH at day 1 and TRAIL-resistant PHH at day 4, we assume that intracellular mechanisms are responsible for the restored resistance of isolated human hepatocytes at day 4. Human hepatocytes (27) and liver cells from nonhuman primates (10, 19) have been shown to be TRAIL resistant in vivo. In accordance with our data, TRAIL-induced apoptosis has only been reported in freshly seeded hepatocytes (37, 38) but not after a 4-day period of in vitro culture (27). We hypothesize that the in vitro sensitivity of cultured human hepatocytes of day 1 could represent an in vitro artifact caused by the isolation procedure and the adaptation to the culture conditions. In this context, it has been shown that the albumin production rate, a surrogate marker of hepatocyte function, is dramatically reduced directly after single-cell isolation and reaches a maximum rate at about day 5 of in vitro culture (39, 40), indicating that freshly isolated human hepatocytes may not represent a suitable model in this respect.
On the other hand, cross-linked FLAG-TRAIL induces apoptosis in PHH not only at day 1 but also at day 4. In accordance with our data, Ichikawa et al. (15) reported an induction of apoptosis in PHH on treatment with a cross-linked FLAG-TRAIL. Yet interestingly, cross-linked FLAG-TRAIL was not the most potent inducer of apoptosis in cancer cells when compared with LZ-TRAIL or iz-TRAIL.
The surface expression of TRAIL receptors on isolated human hepatocytes is still a matter of debate (15, 27, 38). In contrast to Mori et al. (38), we and others (15, 27) could not detect a substantial surface expression of either TRAIL receptor on the surface of PHH. On the mRNA level, equal TRAIL receptor expression was detected at days 0, 1, and 4. The immunohistochemical analysis of paraffin-embedded liver tissue revealed cytoplasmic staining, but no membrane staining, for TRAIL-R1 and TRAIL-R2, which was also found by Spierings et al. (41). However, because blockade of either TRAIL-R1 or TRAIL-R2 substantially and equally inhibited TRAIL-induced apoptosis, both TRAIL receptors are mediators of TRAIL-mediated hepatocyte apoptosis at day 1 (Fig. 2D). Thus, these two receptors must both be present and functional on the surface of day 1 hepatocytes at levels which are below the detection limit of the sensitive surface stains shown in Fig. 2B. This is in accordance with the induction of apoptosis in freshly isolated human hepatocytes at day 1 by agonistic cross-linked TRAIL-R1 and TRAIL-R2 antibodies (38).
Many preclinical studies have shown that cotreatment with TRAIL and chemotherapeutic drugs can overcome resistance to chemotherapy in many cancer types (reviewed in refs. 12, 13). Therefore, the future clinical application of TRAIL might include the simultaneous or sequential cotreatment with different chemotherapeutic drugs. Treatment of PHH at day 4 with 5-fluorouracil, gemcitabine, etoposide, or irinotecan did not result in sensitization for TRAIL-induced apoptosis, indicative of nontoxicity of the combinatorial use of TRAIL with these chemotherapeutic agents on human liver tissue. These data are in accordance with a xenograft mouse model of hepatic metastases of a human colon cancer cell line (35). In contrast, in our experiments, cisplatin showed a substantial sensitization of PHH for TRAIL-mediated apoptosis, indicating that the combination of TRAIL with cisplatin seems to be unfavorable for future therapeutic strategies.
Taken together, we could show that TRAIL sensitivity of PHH depends not only on the specific recombinant form of TRAIL applied but also on the time point of the onset of TRAIL stimulation with respect to the start of hepatocyte in vitro culture. Recombinant iz-TRAIL, a novel stable form of recombinant soluble TRAIL, showed a potent antitumor activity but did not induce apoptosis in PHH at day 4 in vitro. Finally, we could show that chemotherapeutic agents differ substantially in their ability to sensitize TRAIL-resistant PHH for TRAIL-induced apoptosis. Our data show that the combination of TRAIL with certain, but not all, chemotherapeutic drugs might open the therapeutic window for more effective but still safe treatment of cancer.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Note: T.M. Ganten and R. Koschny contributed equally to this work.
Received 12/ 1/05; revised 1/24/06; accepted 2/20/06.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
B pathway. Immunity 1997;7:821–30.[CrossRef][Medline]B and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity 1997;7:813–20.[CrossRef][Medline]
sensitizes human hepatoma cells to TRAIL-induced apoptosis through DR5 up-regulation and NF-B inactivation. Oncogene 2003;22:1653–662.[CrossRef][Medline]This article has been cited by other articles:
|
|
 |
|
  M. E. Guicciardi and G. J. Gores Life and death by death receptors FASEB J, June 1, 2009; 23(6): 1625 - 1637. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S R Mucha, A Rizzani, A L Gerbes, P Camaj, W E Thasler, C J Bruns, S T Eichhorst, E Gallmeier, F T Kolligs, B Goke, et al. JNK inhibition sensitises hepatocellular carcinoma cells but not normal hepatocytes to the TNF-related apoptosis-inducing ligand Gut, May 1, 2009; 58(5): 688 - 698. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Vogler, H. Walczak, D. Stadel, T. L. Haas, F. Genze, M. Jovanovic, U. Bhanot, C. Hasel, P. Moller, J. E. Gschwend, et al. Small Molecule XIAP Inhibitors Enhance TRAIL-Induced Apoptosis and Antitumor Activity in Preclinical Models of Pancreatic Carcinoma Cancer Res., March 15, 2009; 69(6): 2425 - 2434. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Macher-Goeppinger, S. Aulmann, K. E. Tagscherer, N. Wagener, A. Haferkamp, R. Penzel, A. Brauckhoff, M. Hohenfellner, J. Sykora, H. Walczak, et al. Prognostic Value of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL) and TRAIL Receptors in Renal Cell Cancer Clin. Cancer Res., January 15, 2009; 15(2): 650 - 659. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Taniguchi, T. Yoshida, M. Horinaka, T. Yasuda, A. E. Goda, M. Konishi, M. Wakada, K. Kataoka, T. Yoshikawa, and T. Sakai Baicalein Overcomes Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Resistance via Two Different Cell-Specific Pathways in Cancer Cells but not in Normal Cells Cancer Res., November 1, 2008; 68(21): 8918 - 8927. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Vogler, H. Walczak, D. Stadel, T. L. Haas, F. Genze, M. Jovanovic, J. E. Gschwend, T. Simmet, K.-M. Debatin, and S. Fulda Targeting XIAP Bypasses Bcl-2-Mediated Resistance to TRAIL and Cooperates with TRAIL to Suppress Pancreatic Cancer Growth In vitro and In vivo Cancer Res., October 1, 2008; 68(19): 7956 - 7965. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Ashkenazi, P. Holland, and S. G. Eckhardt Ligand-Based Targeting of Apoptosis in Cancer: The Potential of Recombinant Human Apoptosis Ligand 2/Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (rhApo2L/TRAIL) J. Clin. Oncol., July 20, 2008; 26(21): 3621 - 3630. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Cao, P. Du, S.-H. Jiang, G.-H. Jin, Q.-L. Huang, and Z.-C. Hua Enhancement of antitumor properties of TRAIL by targeted delivery to the tumor neovasculature Mol. Cancer Ther., April 1, 2008; 7(4): 851 - 861. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Daniel, B. Yang, D. A. Lawrence, K. Totpal, I. Balter, W. P. Lee, A. Gogineni, M. J. Cole, S. F. Yee, S. Ross, et al. Cooperation of the proapoptotic receptor agonist rhApo2L/TRAIL with the CD20 antibody rituximab against non-Hodgkin lymphoma xenografts Blood, December 1, 2007; 110(12): 4037 - 4046. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Koschny, H. Holland, J. Sykora, T. L. Haas, M. R. Sprick, T. M. Ganten, W. Krupp, M. Bauer, P. Ahnert, J. Meixensberger, et al. Bortezomib Sensitizes Primary Human Astrocytoma Cells of WHO Grades I to IV for Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand-Induced Apoptosis Clin. Cancer Res., June 1, 2007; 13(11): 3403 - 3412. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
), 2 (
), 3 (
), and 4 (
), respectively, or with LZ-CD95L at the in vitro culture day 1 (
) and 4 (
), respectively. Cell viability was measured by MTT assay. Bars, SDs of three independent experiments. B and C, PHH in 96-well plates at day 1 (B) and day 4 (C) were treated for 24 hours with different concentrations of TRAIL.0 (
