
Clinical Cancer Research 13, 3536, June 15, 2007. doi: 10.1158/1078-0432.CCR-06-2828
© 2007 American Association for Cancer Research
Expression of Erythropoietin Receptor and In vitro Functional Effects of Epoetins in B-Cell Malignancies
Parviz Kokhaei1,2,3,
Amir Osman Abdalla1,2,
Lotta Hansson1,2,
Eva Mikaelsson1,2,
Manfred Kubbies4,
Anton Haselbeck4,
Helena Jernberg-Wiklund4,
Håkan Mellstedt1,2 and
Anders Österborg1,2,5
Authors' Affiliations: 1 Departments of Oncology and Pathology, Karolinska Institutet and 2 Departments of Hematology and Oncology, Karolinska University Hospital, Stockholm, Sweden; 3 Department of Immunology, Semnan Medical University, Semnan, Iran; 4 Roche Pharmaceutical Research, Department of Biology, Penzberg, Germany; and 5 Department of Genetics and Pathology, Rudbeck Laboratory, Uppsala University, Uppsala, Sweden
Requests for reprints: Anders Österborg, Department of Oncology, Karolinska University Hospital Solna, SE-171 76 Stockholm, Sweden. Phone: 46-8-517-755-08; Fax: 46-8-318-327; E-mail: anders.osterborg{at}karolinska.se.
 |
Abstract
|
|---|
Purpose: Erythropoietin (EPO) and EPO receptor (EPO-R) expression have been reported in solid tumors and are claimed to regulate tumor growth; however, no data have been published on this issue in B-cell malignancies or normal lymphoid cells. This report describes genomic/protein EPO-R expression and in vitro effects of recombinant human EPO (epoetin) in B-cell chronic lymphocytic leukemia (B-CLL), mantle-cell lymphoma (MCL), and multiple myeloma (MM).
Experimental Design: Blood samples were obtained from patients with B-CLL, MCL, and healthy volunteers, and bone marrow was obtained from MM patients. EPO-R mRNA was detected by reverse transcription-PCR. EPO-R surface expression was investigated by flow cytometry using digoxigenin-labeled epoetin and polyclonal rabbit antiEPO-R antibody for intracellular receptor. Tumor cell stimulation was determined in vitro using [3H]thymidine incorporation and CD69 expression after exposure to epoetin
or ß or darbepoetin
.
Results: EPO-R mRNA was detected in mononuclear cells from 32 of 41 (78%) B-CLL and 5 of 7 (71%) MCL patients, and 21 of 21 (100%) MM samples. Expression was also detected in highly purified T cells from six of eight B-CLL patients, four of four MM patients, and normal donor B and T cells. Surface EPO-R protein was not detected. Intracellular EPO-R staining with antiEPO-R antibodies was unspecific. No tumor-stimulatory effect was observed with high epoetin concentrations.
Conclusions: EPO-R gene is frequently expressed in lymphoid malignancies and normal B and T cells. However, there was no surface protein expression and no epoetin-induced in vitro stimulation of tumor B cells, indicating that epoetin therapy in vivo is likely to be safe in patients with lymphoid malignancies.
Erythropoietin (EPO), the principal regulator of erythropoiesis, is a glycoprotein hormone produced by the kidney and fetal liver (1). EPO prevents apoptosis, stimulates growth, and promotes the differentiation of RBC progenitors by interacting with a specific transmembrane receptor (EPO-R) expressed on the cell surface (2). EPO-R is a member of a cytokine receptor family that lacks the tyrosine kinase domain (2). Upon activation, EPO-R homodimers undergo conformational changes and initiate a Janus kinase signal transducer, which, in turn, activates the transcription factor STAT5 that regulates cell proliferation and differentiation (24). EPO and EPO-R expression have recently been shown in several nonhematopoietic tissue types, including embryonic, nervous system, uterine, ovarian, and endothelial cells, suggesting a broader biological role for EPO signaling (58). The EPOEPO-R pathway might be involved in a variety of cellular functions, including cellular growth, survival, and proliferation as well as in the promotion of angiogenesis and the prevention of ischemic and toxic-stress tissue injuries (514).
Great concern and debate have recently emerged about the potential role of EPO and recombinant human EPO in promoting tumorigenesis not only in vitro (24) but also in vivo (1517). EPO and EPO-R were reported to be expressed in a variety of malignant human cell lines and solid tumors, including breast, prostate, ovarian, uterine, and renal cancers (3, 4, 18, 19). Moreover, in some reports, exogenously added epoetin was described as having a tumor cell growthpromoting effect (4, 18, 20, 21). Other studies have failed to detect such an effect in vitro (2224). Further uncertainty was evident from two prospective randomized studies on epoetin therapy in head and neck (17) and breast cancer (15), where epoetin-treated patients had an inferior outcome in particular in patients whose tumors were EPO-R positive (25). Recently, another head and neck cancer study was terminated early at an interim analysis due to inferior outcome in the epoetin group (26).
As epoetin is frequently used in oncology practice to treat chemotherapy-induced anemia in patients with cancer (2729), a better understanding of in vitro and in vivo EPO-R and epoetin interactions in various types of cancer is of high safety priority. To our knowledge, there are no published data on EPO-R expression in normal and malignant lymphoid cells or on the in vitro effects of epoetin on tumor cells from patients with lymphoid malignancies. Based on the negative effect reported of epoetin therapy in patients with EPO-Rpositive head and neck tumors (25) and previous data suggesting that myeloma cell lines may be stimulated by epoetin in vitro (30), we initiated a study on genomic and protein expression of EPO-R in patients with B-cell chronic lymphocytic leukemia (B-CLL), mantle-cell lymphoma (MCL), and multiple myeloma (MM). We also investigated the in vitro functional effects of epoetin
, epoetin ß, and darbepoetin
on purified tumor cells, as well as analyzing the genomic expression of EPO-R in normal B and T cells.
 |
Materials and Methods
|
|---|
Patients. After informed consent according to the protocol approved by the institutional ethical committee and in keeping with the Helsinki Declaration on research on human subjects, peripheral blood samples from patients with B-CLL and MCL, and bone marrow aspirates from patients with MM, were obtained. The clinical characteristics of the patients are shown in Table 1
(31, 32). Peripheral blood was also obtained from six healthy men (mean age 32.5 ± 1.4 years) as controls.
Isolation of peripheral blood mononuclear cells and purification of CD19+ cells. Peripheral blood mononuclear cells (PBMC) were isolated by Ficoll-Hypaque (Amersham Pharmacia Biotech) density gradient centrifugation (33). Cells were washed thrice with PBS (pH 7.2; GIBCO), applied on a nylon wool column (Biotest; ref. 33), and incubated at 37°C for 1 h. Unabsorbed cells were removed by extensive washing with warm (37°C) culture medium (RPMI 1640; GIBCO). B cells were eluted from the column (33). The purity of CD19+ cells, determined by flow cytometry, was >98%. Purified B cells were then used for RNA extraction and subsequent reverse transcription-PCR (RT-PCR)based EPO-R expression analysis, as well as for functional studies.
Isolation of bone marrow mononuclear cells and purification of CD138+ cells. Bone marrow aspirates (4-8 mL) from MM patients were diluted in equal volumes of RPMI, applied to a filter (pore size 40 or 70 µm) to remove debris and fat particles, and subjected to Ficoll separation (33) to isolate bone marrow mononuclear cells (BMMC). Cells were washed twice with PBS or Iscove's modified Dulbecco's medium (Sigma Aldrich) containing 2% FCS and 2 mmol/L EDTA, and the CD138+ cell portion was purified using MidiMACS columns (Miltenyi Biotec) according to the manufacturer's instructions. Purity of the CD138+ fraction, determined by flow cytometry analysis or May-Grünwald-Giemsa staining and morphology, was >95%. The cells were resuspended in complete medium (RPMI 1640 supplemented with 10% heat-inactivated pooled human AB+ serum, 2 mmol/L L-glutamine,100 IU/mL penicillin, and 100 µg/mL streptomycin) and used for the proliferation assay and RNA extraction.
RT-PCR analysis. Total RNA was extracted from 2 x 106 PBMC or purified tumor cells with RNA-Bee (BioSite) using the guanidine thiocyanate phenol-chloroform extraction or TRIzol reagent (Invitrogen) method, according to the manufacturer's recommendation. RNA was denatured at 65°C for 5 min and immediately chilled on ice. First-strand cDNA synthesis was done in a 20 µL reaction mixture containing 0.5 µg RNA in a 10 mL volume, 4 µL 5x buffer (Invitrogen), 1.5 µL DTT (100 mmol/L), 2 µL deoxynucleotide triphosphates (5 mmol/L each; Amersham Biosciences), 1.0 µL random hexamer primers (100 pmol/µL, Amersham Biosciences), 0.5 µL distilled water, and 1.0 µL M-MLV reverse transcriptase (200 units/µL, GIBCO). The reaction mixture was incubated at 42°C for 45 min followed by 5 min at 70°C to inactivate reverse transcriptase. Quality of cDNA was confirmed for all samples by RT-PCR for ß-actin. cDNA samples were then stored at 20°C. RT-PCR was done in a 25 µL reaction mixture using 2.5 µL of 10x buffer, 1 µL magnesium chloride (25 mmol/L), 1.5 µL deoxynucleotide triphosphates (10 mmol/L), 5 pmol of each primer, and one unit of Ampli-Taq Gold DNA polymerase (Perkin-Elmer/Applied Biosystems). Target (patient) cDNA (2 µL) was included in each reaction volume except for the negative controls. PCR was done in 35 concurrent cycles, using the temperature sequence 1 min at 94°C, 1 min at 61°C, and 1.5 min at 72°C.
For detection of EPO-Rspecific cDNA, the following primer pairs were used: sense accgtgtcatccacatcaat and antisense gccttcaaactcgctctctg, resulting in an amplicon size of 485 bp (34). The PCR product was cloned, sequenced, and compared with EPO mRNA sequences available from GenBank.
Surface EPO-R flow cytometry. Digoxigenin-labeled epoetin binding in viable tumor cells was used to analyze EPO-R expression. The digoxigenin label was covalently bound to epoetin sialic acids via hydrazide linker. This modification did not affect its capacity to stimulate proliferation (data not shown). The UT-7 cell line served as a positive control for EPO-R expression (35). The specificity of epoetin-digoxigenin binding was shown by competitive inhibition in the presence of a 100x excess of unlabeled epoetin ß (NeoRecormon, Roche Diagnostics GmbH) added 30 min before EPO-digoxigenin labeling (see Results). All staining steps were done on ice in 100 µL PBS/10% human AB plasma for 30 min, except the initial epoetin competitive inhibition test that was done in RPMI 1640/10% FCS. The washing steps were done with 3 mL PBS/10% human AB plasma at speed 400 x g for 10 min. Three concentrations of EPO-digoxigenin (1, 3, or 10 nmol/L) were used for staining.
Before staining, the cells were washed once and resuspended at a concentration of 5 x 105 cells/100 µL. The labeling steps were as follows: EPO-digoxigenin labeling for 5 h, wash; incubation with 10 µg biotin-labeled antidigoxigenin antibody (Jackson ImmunoResearch), wash; staining with 5 µg avidin-FITC (BD PharMingen), wash; incubation with 5 µg biotin-labeled murine IgG (DakoCytomation), wash; and staining with 7 µg FITC-labeled antimurine antibody (Caltag Laboratories). After the final washing step, the cells were resuspended in 300 µL PBS/10% human AB plasma, and 1 µg/mL (final concentration) of propidium iodide was added for dead cell staining. All stainings were done at 4°C. The EPO-R/EPO-digoxigenin complex is quite stable when located outside the cells (UT-7 cell line), and the detection level of this method is
300 receptors per cell (data not shown).
The cells were analyzed on a fluorescence-activated cell sorter scan flow cytometer (BD Bioscience). The viable cell population was identified in the forward scatter/propidium iodide dot plot as propidium iodidenegative cells and the mean fluorescence of the FITC label was recorded.
Intracellular EPO-R flow cytometry. For indirect staining of intracellular EPO-R, cells were fixed with 2% paraformaldehyde on ice for 10 min in the dark, permeabilized with 0.1% saponin in PBS, and incubated with the primary polyclonal rabbit antiEPO-R antibody (Santa Cruz Biotechnology, SDS Biosciences) at different concentrations (from 8.0 to 0.02 µg) for 30 min at room temperature in the dark. Goat anti-rabbit FITC-conjugated secondary antibody was then added to washed cells and incubated for 15 min at 4°C in the dark. After a final wash, the cells were resuspended in PBS and analyzed using a FACSCalibur flow cytometer (BD Biosciences) and CellQuest software. A minimum of 10,000 lymphocyte-gated events were acquired and cells were analyzed by forward and side scatter. Criteria for positive staining were set at fluorescence intensities displayed by <1% of cells stained with the isotype controls.
Proliferation assay (DNA synthesis). PBMC or purified tumor cells (2 x 105) in complete medium were placed in a 96-well U-bottomed plate in triplicate and incubated at 37°C for 5 days. Cells were cultured either alone or with 100 IU/mL of epoetin
(Eprex, Janssen-Cilag AB), epoetin ß, or the equivalent concentration of darbepoetin
(500 ng/mL; Aranesp, Amgen AB) in triplicate. This concentration is at least 5-fold the physiological concentration of EPO in human peripheral blood (36). [3H]thymidine (Amersham Pharmacia Biotech) was added to each well at a concentration of 1 µCi during the last 18 h of the culture period. The plates were harvested and the incorporated [3H]thymidine was quantified using a ß scintillation counter (Microß 1450, Wallac). In some experiments, 5 x 103 irradiated (100 Gy) CD40L-transfected fibroblasts were seeded in the wells 6 h before the proliferation experiment to provide costimulatory signals.
CD69 expression assay. To assess if epoetin can induce expression of the activation marker CD69, 2 x 106 PBMC were placed in each 24-well plate in a 1 mL volume with epoetin
, epoetin ß, or darbepoetin
. PBMC or purified tumor cells were cultured alone as controls. In parallel on the same plate, 2 x 105 irradiated CD40L-transfected fibroblasts were seeded in each 24-well plate 6 h before the experiment and PBMC were added alone or in combination with epoetin
, epoetin ß, or darbepoetin
. The cells were incubated for 48 h, and CD69 expression was assessed by flow cytometry.
 |
Results
|
|---|
Genomic expression of EPO-R in malignant cells
The genomic expression of EPO-R in B-CLL, MCL, and MM tumor cells is summarized in Table 2
. Figure 1A
shows examples of EPO-R mRNA expression or nonexpression in PBMC from B-CLL patients, as detected by RT-PCR. Figure 1B shows a case of EPO-R mRNA expression in the enriched T cell, but not in the tumor B-cell fraction in PBMC from a patient with B-CLL. Figure 1C shows EPO-R mRNA expression in both T-cell and tumor B-cell fractions from a B-CLL patient, and EPO-R gene expression in the CD138+ fraction from a MM patient. Expression in PBMC from a patient with MCL as well as in T- and B-cell fractions from a healthy control are also shown.
View this table:
[in this window]
[in a new window]
|
Table 2. EPO-R mRNA expression in PBMC and blood lymphoid cell subsets from patients with B-CLL or MCL, or healthy donors, and BMMC from MM
|
|

View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. A, examples of EPO-R mRNA expression and nonexpression in PBMC from patients with B-CLL, as detected by subsequent RT-PCR. cDNA from the K562 cell line and nontemplate PCR mix were used as positive and negative controls, respectively. B, an example of EPO-R mRNA expression in the enriched T-cell fraction, but not in the enriched tumor B-cell fraction, of PBMC from a patient with B-CLL. C, examples of EPO-R mRNA expression in highly enriched tumor and non-tumor cell fractions from patients with B-CLL, MCL, and MM, as well as in enriched T and B cells from a healthy control.
|
|
In total, EPO-R mRNA was detected in PBMC of 32 of 41 (78%) B-CLL patients (Table 2). Positive results were confirmed in highly purified tumor B cells from 7 of 10 (70%) B-CLL patients. EPO-R expression was also detected in cells with mutated (7 of 9) and unmutated (7 of 7) immunoglobulin VH phenotypes. Repeated analyses from two individual patients revealed that EPO-R mRNA expression seemed not to be influenced by chemotherapy (data not shown). EPO-R mRNA was detected in the purified T-cell fraction of 6 of 8 (75%) B-CLL patients and, in samples from two B-CLL patients, EPO-R mRNA was detected in the T-cell fraction but not in the enriched tumor B-cell fraction (Fig. 1B). BMMC from 21 of 21 (100%) and highly purified plasma cells (CD138+) from 8 of 8 (100%) MM patients also expressed EPO-R mRNA, as well as PBMC from 5 of 7 (71%) MCL patients (Table 2). The tumor-depleted fractions of BMMC, containing mainly T cells, from four MM patients were positive for EPO-R mRNA expression. Purified normal B cells and purified T cells from four and six healthy donors, respectively, were all found to express EPO-R mRNA (Table 2).
EPO-R protein expression
Surface staining. The surface EPO-R detection technique using digoxigenin-labeled epoetin was done using the EPO-Rpositive cell line UT-7 (35) as a positive control. Figures 2
and 3
show the results of the flow cytometry analysis of EPO-R protein surface expression on UT-7 cells as well as on B-CLL cells and MM plasma cells, respectively. Binding of EPO-digoxigenin could be detected on UT-7 cells significantly above the background staining level with EPO-digoxigenin concentrations in the range of 1 to 10 nmol/L (Figs. 2 and 3). The mean ± SD increase of UT-7specific EPO-digoxigenin binding relative to the digoxigenin-control (set as 100%) was 216 ± 50% (1 nmol/L EPO-digoxigenin), 255 ± 50% (3 nmol/L EPO-digoxigenin), and 281 ± 81% (10 nmol/L EPO-digoxigenin). The specificity of UT-7 expression was evident by competitive blockage of EPO-digoxigenin in the presence of an excess (x100) of unlabeled epoetin (Figs. 2 and 3), and the relative fluorescence intensities decreased to 112 ± 2%, 116 ± 3%, and 131 ± 9%, respectively. Student's t test analysis of the absolute values revealed statistical significance of the increase of all EPO-digoxigenin labels on UT-7positive control cells over the digoxigenin-control (P = 0.001-0.008). In the presence of a 100x excess of unlabeled EPO, none of the EPO-digoxigeninlabeled UT-7 samples reached significance over the digoxigenin-control (P = 0.235-0.955), indicating specificity and robustness of the technique. Contrary to the results obtained with the UT-7 cells, EPO-R protein could not be detected on the cell surface of enriched tumor cells from any of the nine tested B-CLL patients (Fig. 2; five of these patients were EPO-R positive at the mRNA level and four were mRNA negative). Similarly, enriched plasma cells from four EPO-R mRNApositive MM patients stained negative for surface EPO-R (Fig. 3), irrespective of the EPO-digoxigenin concentration used and with or without epoetin competition. A somewhat higher and more variable unspecific (background) staining was observed in the MM patients (Fig. 3) than in CLL patients (Fig. 2), which may be explained by a higher and variable proportion of preapoptotic/apoptotic cells in the MM samples as revealed by propidium iodide/Annexin V staining (data not shown).

View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Flow cytometry analysis of EPO-R protein expression on the surface of tumor cells from patients with B-CLL. Patient numbers (Pt #) one to nine; five patients were EPO-R mRNApositive and four were negative. Three concentrations (1, 3, or 10 nmol/L) of EPO-digoxigenin (DIG; +antidigoxigenin FITC) were used without (unfilled columns) and with (filled columns) epoetin competition. UT-7, EPO-Rpositive control cell line; auto, autofluorescence of cells; <DIG> ctrl, staining of cells with all reagents but without prior incubation with EPO-digoxigenin.
|
|

View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Flow cytometry analysis of EPO-R protein expression on the surface of EPO-R mRNApositive myeloma plasma cells from four patients with MM. Three concentrations (1, 3, and 10 nmol/L) of EPO-digoxigenin (+antidigoxigenin FITC) were used without (unfilled columns) and with (filled columns) epoetin competition.
|
|
Intracellular staining. Intracellular EPO-R protein expression was assessed by flow cytometry using commercially available rabbit polyclonal antiEPO-R antibodies (see Materials and Methods). The results of a representative double-staining experiment on B-CLL cells from one EPO-R mRNApositive and one EPO-R mRNAnegative patient are shown in Fig. 4A and B
, respectively. Weak positive staining was obtained in the EPO-R mRNApositive patient and an almost identical staining pattern was seen in the EPO-R mRNAnegative patient. Additional experiments, using extensive washing and stepwise serial dilutions of the antibody (from 8.00 to 0.02 µg), could not eliminate unspecific binding. Similar results were obtained using the cytospin technique (data not shown). Testing of additional patients (eight with B-CLL and four with MCL) revealed identical results.

View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. An example of nonspecific intracellular staining for EPO-R protein expression in B-CLL tumor cells using a rabbit polyclonal antiEPO-R antibody. A, EPO-R mRNApositive tumor cells. B, EPO-R mRNAnegative tumor cells. PE, phycoerythrin.
|
|
Functional effects of epoetins on tumor cells
We tested the ability of epoetin
, epoetin ß, and darbepoetin
to induce tumor cell proliferation ([3H]thymidine incorporation) in enriched tumor cells from eight patients with B-CLL (Fig. 5A
) and four patients with MCL (Fig. 5B). BMMC from four MM patients were also tested for epoetin-induced proliferation (Fig. 5C). No significant epoetin-induced proliferation was observed after in vitro stimulation of tumor cells of any of the three epoetin preparations. As a positive control, all three epoetin preparations were also tested together with the EPO-Rpositive cell line K562 and a significant stimulatory effect was observed (P < 0.05; Fig. 5D).
The viability of CLL cells in routine culture was reduced according to the length of the culture period. The average viability was reduced from 98% at day 1 to 44 ± 5.7% after 96 h culture, as revealed by Annexin V staining (data not shown). Addition of epoetin did not alter this pattern.
Additional experiments were done in tumor cells from B-CLL and MCL patients by coculturing cells with irradiated CD40L-transfected fibroblasts. No additional stimulatory effect was observed with the addition of epoetin to cell cultures (data not shown).
We then analyzed the expression of CD69 (cellular activation marker) in eight patients with B-CLL and four patients with MCL before and after stimulation of tumor cells with one of the three epoetin preparations alone, or in combination with irradiated CD40L-transfected fibroblasts as costimulators. No epoetin-induced activation was observed with epoetin alone or on top of the marked (and significant) activation induced by CD40L (Fig. 6A and B
).
 |
Discussion
|
|---|
Apart from its well-known central role in erythropoiesis, emerging data now seem to indicate that EPO also has pleiotropic functions in various normal cell types (6, 37). EPO-R expression has recently been identified in many nonerythroid tissue types, including the central nervous system, retina, heart, vascular endothelium, kidney, lung, liver, and gastrointestinal and reproductive tracts (5, 6, 37). Clinically beneficial effects have been claimed for EPO signaling through up-regulation of various pathways. These include not only stimulation of erythropoiesis, but also antiapoptotic, anti-inflammatory, immunomodulatory, angiogenic, neurotrophic, and neuroprotective mechanisms (5, 6, 8, 13, 37). EPO generally protects cells from injury, most notably after ischemic insult (7, 10, 11, 38). Hypoxia-driven EPO and EPO-R overexpression enhance ischemic and hypoxic neural cell survival (39, 40). EPO signaling might also protect against light-induced retinal degeneration (41), enhance fibrin-induced wound healing (12), and increase chances of recovery from ischemic myocardial injuries (5).
However, some recent reports indicated that EPO-R may be expressed by various tumor cell types and that EPO signaling might also be implicated in promoting the growth and survival of cancer cells in solid tumors and malignant cell lines (2, 4, 18, 20, 21). These include prostate (42), head and neck (43, 44), melanoma (45), female reproductive organs (19, 46, 47), breast (3, 48), and nonsmall cell lung cancers (49). EPO signaling is also reported to correlate positively with tumor hypoxia (50) and induce cancer cell resistance to ionizing radiation and chemotherapy (44, 51). Further concerns were raised in vivo from clinical observations in patients, as two recently published randomized trials that prospectively analyzed survival effects of epoetin therapy in patients with breast cancer (15) and head and neck tumors (17) both reported an inferior outcome in patients treated with epoetin. In patients with head and neck cancer, the negative survival effect seemed to be confined to patients with EPO-Rpositive tumors only (25). Furthermore, another large randomized trial on epoetin therapy in patients with head and neck tumors receiving radiotherapy was closed early due to inferior outcome in the epoetin group at an interim analysis (26). Other recently published in vitro studies reported that epoetin did not affect tumor growth or angiogenesis in tumors (22, 24), and there are reports of epoetin-induced sensitization of malignant cells to chemotherapy and/or radiotherapy (52, 53) or no interference with the antiproliferative and cytotoxic effects of antitumor drugs (24).
Although epoetin is used frequently to correct anemia not only in solid but also in lymphoproliferative malignancies (54, 55), there are no published data on EPO-R expression and the functional in vitro effects of epoetin on tumor cells from patients with lymphoid cancers. There are, however, reports suggesting that epoetin may stimulate myeloma cell lines in vitro (30). Our study is the first to analyze the genomic and protein expression of EPO-R in various B-cell tumors and the in vitro functional effect of various epoetin preparations on such tumor cells. We also analyzed genomic EPO-R expression in normal B and T cells in a limited number of patients and controls. PBMC/BMMC or purified tumor cells from most, but not all, B-CLL, MCL, and MM patients (70-100%) expressed EPO-R mRNA as assessed by RT-PCR (Table 2; Fig. 1A-C). In the lymphoid cellenriched subset analyses, measures were taken to obtain highly purified cell subsets to minimize the risk of false-positive results caused by contamination with the remaining nonenriched (PBMC/BMMC) cell fraction. Due to the sensitivity of the PCR analysis, such contamination could not be fully excluded; however, this is unlikely to explain the reproducible findings of completely negative PCR results in the cell subset analysis.
Despite frequent genomic EPO-R expression, the corresponding EPO-R protein could not be detected on the surface of any of the tumor cells from B-CLL and MM patients assessed by a sensitive EPO-digoxigenin + antidigoxigenin FITClabeled surface staining flow cytometry technique. No functional effects were observed in vitro because high concentrations of three different epoetins (epoetin
, epoetin ß, and darbepoetin
) failed to induce activation and/or proliferation of tumor cells during a 5-day culture period, with or without CD40L-transfected fibroblast costimulation. These results suggest that EPO-R is frequently expressed at the gene level, but not as a surface protein on malignant B cells, and that exogenously added epoetin does not induce tumor growth or activation under the experimental conditions used.
An unexpected finding in our study was that normal lymphoid (B and T) cells may also express EPO-R at the gene level (Fig. 1C). These results need to be confirmed in extended in vitro studies to understand the frequency and biological implication of normal B- and T-cell EPO-R gene expression. It could be speculated that EPO gene expression in lymphoid cells is related to a broader, yet to be identified, physiological function.
It is not clear from this study why EPO-R mRNA should fail to translate into functional protein. It is possible that genes may be suppressed or even silenced by cell cycle control mechanisms when their product protein is deemed adversely to affect normal cellular homeostasis (5658). We used a sensitive flow cytometry technique for surface EPO-R detection, including the positive control cell line UT-7, which is known to express a low or intermediate copy number of EPO-R (35). Therefore, the negative flow cytometry data are unlikely to be due to the detection limits of the technique used. In addition, we failed to obtain reliable and specific staining results with one of the commercially available polyclonal rabbit antibodies designed for intracellular EPO-R protein detection (Fig. 4). This is in line with another recent report showing that most of these antibodies seem to bind unspecifically and cross-react with nonEPO-R proteins (59). Moreover, in a further antibody study, EPO-R localization was exclusively cytosolic and no specific epoetin binding was observed in in vivo xenografts (60). Thus, the findings of Elliott et al. (59), LaMontagne et al. (60), and our data indicate that the results from previously published articles, which only used antibodies for analysis of EPO-R expression in tumors, should be viewed with caution.
 |
Acknowledgments
|
|---|
We thank Dr. Hoesel (Roche Diagnostics GmbH, Mannheim, Germany) for providing EPO-digoxigenin and Leila Relander for secretarial help.
 |
Footnotes
|
|---|
Grant support: Swedish Cancer Society, the Cancer Society in Stockholm, King Gustav V Jubilee Fund, Gunnar Nilsson Foundation, the Torsten and Ragnar Söderberg's Foundation, the Cancer and Allergy Foundation, the Swedish Society for Medical Research, the Stockholm County Council, and Karolinska Institutet Foundations, and research funding from F. Hoffmann-La Roche Ltd.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Note: P. Kokhaei and A.O. Abdalla contributed equally to this study.
Conflict of interest statement: Anders Österborg has received unrestricted financial support for research from F. Hoffmann-La Roche Ltd., and M. Kubbies and A. Haselbeck are employees of F. Hoffmann-La Roche Ltd.
Received 11/29/06;
revised 2/14/07;
accepted 3/29/07.
 |
References
|
|---|
- Koury MJ. Erythropoietin: the story of hypoxia and a finely regulated hematopoietic hormone. Exp Hematol 2005;33:126370.[CrossRef][Medline]
- Farrell F, Lee A. The erythropoietin receptor and its expression in tumor cells and other tissues. Oncologist 2004;9 Suppl 5:830.[Abstract/Free Full Text]
- Arcasoy MO, Amin K, Karayal AF, et al. Functional significance of erythropoietin receptor expression in breast cancer. Lab Invest 2002;82:9118.[Medline]
- Yasuda Y, Fujita Y, Matsuo T, et al. Erythropoietin regulates tumour growth of human malignancies. Carcinogenesis 2003;24:10219.[Abstract/Free Full Text]
- Lewis LD. Preclinical and clinical studies: a preview of potential future applications of erythropoietic agents. Semin Hematol 2004;41:1725.[Medline]
- Sasaki R. Pleiotropic functions of erythropoietin. Intern Med 2003;42:1429.[Medline]
- Siren AL, Fratelli M, Brines M, et al. Erythropoietin prevents neuronal apoptosis after cerebral ischemia and metabolic stress. Proc Natl Acad Sci U S A 2001;98:40449.[Abstract/Free Full Text]
- Weiss MJ. New insights into erythropoietin and epoetin alfa: mechanisms of action, target tissues, and clinical applications. Oncologist 2003;8 Suppl 3:1829.[Abstract/Free Full Text]
- Yasuda Y, Masuda S, Chikuma M, Inoue K, Nagao M, Sasaki R. Estrogen-dependent production of erythropoietin in uterus and its implication in uterine angiogenesis. J Biol Chem 1998;273:253817.[Abstract/Free Full Text]
- Brines ML, Ghezzi P, Keenan S, et al. Erythropoietin crosses the blood-brain barrier to protect against experimental brain injury. Proc Natl Acad Sci U S A 2000;97:1052631.[Abstract/Free Full Text]
- Chong ZZ, Kang JQ, Maiese K. Erythropoietin: cytoprotection in vascular and neuronal cells. Curr Drug Targets Cardiovasc Haematol Disord 2003;3:14154.[CrossRef][Medline]
- Haroon ZA, Amin K, Jiang X, Arcasoy MO. A novel role for erythropoietin during fibrin-induced wound-healing response. Am J Pathol 2003;163:9931000.[Abstract/Free Full Text]
- Kalialis LV, Olsen NV. [Erythropoietina new therapy in cerebral ischemia?]. Ugeskr Laeger 2003;165:247781.[Medline]
- Watanabe D, Suzuma K, Matsui S, et al. Erythropoietin as a retinal angiogenic factor in proliferative diabetic retinopathy. N Engl J Med 2005;353:78292.[Abstract/Free Full Text]
- Leyland-Jones B, Semiglazov V, Pawlicki M, et al. Maintaining normal hemoglobin levels with epoetin alfa in mainly nonanemic patients with metastatic breast cancer receiving first-line chemotherapy: a survival study. J Clin Oncol 2005;23:596072.[Abstract/Free Full Text]
- Glaspy JA. The development of erythropoietic agents in oncology. Expert Opin Emerg Drugs 2005;10:55367.[CrossRef][Medline]
- Henke M, Laszig R, Rube C, et al. Erythropoietin to treat head and neck cancer patients with anaemia undergoing radiotherapy: randomised, double-blind, placebo-controlled trial. Lancet 2003;362:125560.[CrossRef][Medline]
- Westenfelder C, Baranowski RL. Erythropoietin stimulates proliferation of human renal carcinoma cells. Kidney Int 2000;58:64757.[CrossRef][Medline]
- Yasuda Y, Fujita Y, Masuda S, et al. Erythropoietin is involved in growth and angiogenesis in malignant tumours of female reproductive organs. Carcinogenesis 2002;23:1797805.[Abstract/Free Full Text]
- Acs G, Acs P, Beckwith SM, et al. Erythropoietin and erythropoietin receptor expression in human cancer. Cancer Res 2001;61:35615.[Abstract/Free Full Text]
- Pajonk F, Weil A, Sommer A, Suwinski R, Henke M. The erythropoietin-receptor pathway modulates survival of cancer cells. Oncogene 2004;23:898791.[CrossRef][Medline]
- Hardee ME, Kirkpatrick JP, Shan S, et al. Human recombinant erythropoietin (rEpo) has no effect on tumour growth or angiogenesis. Br J Cancer 2005;93:13505.[CrossRef][Medline]
- Mittelman M, Zeidman A, Kanter P, et al. Erythropoietin has an anti-myeloma effecta hypothesis based on a clinical observation supported by animal studies. Eur J Haematol 2004;72:1555.[CrossRef][Medline]
- Gewirtz DA, Di X, Walker TD, Sawyer ST. Erythropoietin fails to interfere with the antiproliferative and cytotoxic effects of antitumor drugs. Clin Cancer Res 2006;12:22328.[Abstract/Free Full Text]
- Henke M, Mettern D, Pepe M, et al. Do erythropoietin receptors on cancer cells explain unexpected clinical findings? J Clin Oncol 2006;24:470813.[Abstract/Free Full Text]
- Overgaard J. Study of the importance of novel erythropoiesis stimulating protein (Aranesp®) for the effect of radiotherapy in patients with primary squamous cell carcinoma of the head and neck. Interim analysis of the DAHANCA 10 study; 1 December 2006. Available from http://conman.au.dk/dahanca/get_media_file.php?mediaid=125.
- Bokemeyer C, Aapro MS, Courdi A, et al. EORTC guidelines for the use of erythropoietic proteins in anaemic patients with cancer. Eur J Cancer 2004;40:220116.[CrossRef][Medline]
- Jones M, Schenkel B, Just J, Fallowfield L. Epoetin alfa improves quality of life in patients with cancer: results of metaanalysis. Cancer 2004;101:172032.[CrossRef][Medline]
- Cortes J, O'Brien S, Quintas A, et al. Erythropoietin is effective in improving the anemia induced by imatinib mesylate therapy in patients with chronic myeloid leukemia in chronic phase. Cancer 2004;100:2396402.[CrossRef][Medline]
- Okuno Y, Takahashi T, Suzuki A, et al. Expression of the erythropoietin receptor on a human myeloma cell line. Biochem Biophys Res Commun 1990;170:112834.[CrossRef][Medline]
- Durie BG, Salmon SE. A clinical staging system for multiple myeloma. Correlation of measured myeloma cell mass with presenting clinical features, response to treatment, and survival. Cancer 1975;36:84254.[CrossRef][Medline]
- Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS. Clinical staging of chronic lymphocytic leukemia. Blood 1975;46:21934.[Abstract/Free Full Text]
- Boyum A. Separation of lymphocytes, lymphocyte subgroups and monocytes: a review. Lymphology 1977;10:716.[Medline]
- Assandri R, Egger M, Gassmann M, et al. Erythropoietin modulates intracellular calcium in a human neuroblastoma cell line. J Physiol 1999;516 Pt 2:34352.[Abstract/Free Full Text]
- Hermine O, Meyeux P, Titeux M, et al. Granulocyte-macrophage colony-stimulating factor and erythropoietin act competitively to induce two different programs of differentiation in the human pluripotent cell line UT-7. Blood 1992;80:30609.[Abstract/Free Full Text]
- Cazzola M, Guarnone R, Cerani P, Centenara E, Rovati A, Beguin Y. Red blood cell precursor mass as an independent determinant of serum erythropoietin level. Blood 1998;91:213945.[Abstract/Free Full Text]
- Buemi M, Cavallaro E, Floccari F, et al. The pleiotropic effects of erythropoietin in the central nervous system. J Neuropathol Exp Neurol 2003;62:22836.[Medline]
- Chong ZZ, Kang JQ, Maiese K. Erythropoietin fosters both intrinsic and extrinsic neuronal protection through modulation of microglia, Akt1, Bad, and caspase-mediated pathways. Br J Pharmacol 2003;138:110718.[CrossRef][Medline]
- Bernaudin M, Marti HH, Roussel S, et al. A potential role for erythropoietin in focal permanent cerebral ischemia in mice. J Cereb Blood Flow Metab 1999;19:64351.[Medline]
- Sinor AD, Greenberg DA. Erythropoietin protects cultured cortical neurons, but not astroglia, from hypoxia and AMPA toxicity. Neurosci Lett 2000;290:2135.[CrossRef][Medline]
- Grimm C, Wenzel A, Groszer M, et al. HIF-1-induced erythropoietin in the hypoxic retina protects against light-induced retinal degeneration. Nat Med 2002;8:71824.[CrossRef][Medline]
- Arcasoy MO, Amin K, Vollmer RT, Jiang X, Demark-Wahnefried W, Haroon ZA. Erythropoietin and erythropoietin receptor expression in human prostate cancer. Mod Pathol 2005;18:42130.[CrossRef][Medline]
- Mohyeldin A, Lu H, Dalgard C, et al. Erythropoietin signaling promotes invasiveness of human head and neck squamous cell carcinoma. Neoplasia 2005;7:53743.[CrossRef][Medline]
- Lai SY, Childs EE, Xi S, et al. Erythropoietin-mediated activation of JAK-STAT signaling contributes to cellular invasion in head and neck squamous cell carcinoma. Oncogene 2005;24:44429.[CrossRef][Medline]
- Kumar SM, Acs G, Fang D, Herlyn M, Elder DE, Xu X. Functional erythropoietin autocrine loop in melanoma. Am J Pathol 2005;166:82330.[Abstract/Free Full Text]
- Acs G, Zhang PJ, McGrath CM, et al. Hypoxia-inducible erythropoietin signaling in squamous dysplasia and squamous cell carcinoma of the uterine cervix and its potential role in cervical carcinogenesis and tumor progression. Am J Pathol 2003;162:1789806.[Abstract/Free Full Text]
- Acs G, Xu X, Chu C, Acs P, Verma A. Prognostic significance of erythropoietin expression in human endometrial carcinoma. Cancer 2004;100:237686.[CrossRef][Medline]
- Acs G, Zhang PJ, Rebbeck TR, Acs P, Verma A. Immunohistochemical expression of erythropoietin and erythropoietin receptor in breast carcinoma. Cancer 2002;95:96981.[CrossRef][Medline]
- Dagnon K, Pacary E, Commo F, et al. Expression of erythropoietin and erythropoietin receptor in non-small cell lung carcinomas. Clin Cancer Res 2005;11:9939.[Abstract/Free Full Text]
- Arcasoy MO, Amin K, Chou SC, Haroon ZA, Varia M, Raleigh JA. Erythropoietin and erythropoietin receptor expression in head and neck cancer: relationship to tumor hypoxia. Clin Cancer Res 2005;11:207.[Abstract/Free Full Text]
- McBroom JW, Acs G, Rose GS, et al. Erythropoeitin receptor function and expression in epithelial ovarian carcinoma. Gynecol Oncol 2005;99:5717.[CrossRef][Medline]
- Belenkov AI, Shenouda G, Rizhevskaya E, et al. Erythropoietin induces cancer cell resistance to ionizing radiation and to cisplatin. Mol Cancer Ther 2004;3:152532.[Abstract/Free Full Text]
- Carvalho G, Lefaucheur C, Cherbonnier C, et al. Chemosensitization by erythropoietin through inhibition of the NF-kappaB rescue pathway. Oncogene 2005;24:73745.[CrossRef][Medline]
- Österborg A, Brandberg Y, Molostova V, et al. Randomized, double-blind, placebo-controlled trial of recombinant human erythropoietin, epoetin Beta, in hematologic malignancies. J Clin Oncol 2002;20:248694.[Abstract/Free Full Text]
- Cazzola M, Beguin Y, Kloczko J, Spicka I, Coiffier B. Once-weekly epoetin beta is highly effective in treating anaemic patients with lymphoproliferative malignancy and defective endogenous erythropoietin production. Br J Haematol 2003;122:38693.[CrossRef][Medline]
- Vaux DL, Cory S, Adams JM. Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature 1988;335:4402.[CrossRef][Medline]
- Contasta I, Pellegrini P, Berghella AM, Adorno D. Cell cycle control in cellular homeostasis during the immune response: interactions between TH1, TH2 cytokines, and Bcl2 and p53 molecules. Cancer Biother Radiopharm 2001;16:6371.[CrossRef][Medline]
- Adams JM, Cory S. The Bcl-2 protein family: arbiters of cell survival. Science 1998;281:13226.[Abstract/Free Full Text]
- Elliott S, Busse L, Bass MB, et al. Anti-Epo receptor antibodies do not predict Epo receptor expression. Blood 2005;107:18925.[Medline]
- LaMontagne KR, Butler J, Marshall DJ, et al. Recombinant epoetins do not stimulate tumor growth in erythropoietin receptor-positive breast carcinoma models. Mol Cancer Ther 2006;5:34755.[Abstract/Free Full Text]