
Clinical Cancer Research 13, 5056-5062, September 1, 2007. doi: 10.1158/1078-0432.CCR-07-0859
© 2007 American Association for Cancer Research
Imaging, Diagnosis, Prognosis |
CXCL12 G801A Polymorphism Is a Risk Factor for Sporadic Prostate Cancer Susceptibility
Hiroshi Hirata1,
Yuji Hinoda2,
Nobuyuki Kikuno1,
Ken Kawamoto1,
Angela V. Dahiya1,
Yutaka Suehiro2,
Yuichiro Tanaka1 and
Rajvir Dahiya1
Authors' Affiliations: 1 Department of Urology, San Francisco Veterans Affairs Medical Center and University of California, San Francisco, California, and 2 Department of Laboratory Medicine, Yamaguchi University Graduate School of Medicine, Yamaguchi, Japan
Requests for reprints: Rajvir Dahiya, Urology Research Center (112F), Veterans Affairs Medical Center and University of California at San Francisco, 4150 Clement Street, San Francisco, CA 94121. Phone: 415-750-6964; Fax: 415-750-6639; E-mail: rdahiya{at}urology.ucsf.edu.
 |
Abstract
|
|---|
Purpose: The chemokine CXCL12 and its receptor CXCR4 have been found to be associated with cancer metastasis. A single nucleotide polymorphism of CXCL12 G801A has been described and is regarded as a target for cis-acting factor that has the ability to up-regulate CXCL12 expression. Currently, there are no reports investigating the role of CXCL12 G801A polymorphism in prostate cancer (PC).
Experimental Design: We genotyped CXCL12 G801A and p53Arg72Pro in 167 PC patients and 167 age-matched healthy subjects. Genotyping was done with PCR-RFLP and confirmed by direct DNA sequencing. To investigate the effect of the CXCL12 G801A polymorphism on CXCL12 and CXCR4 expression, immunohistochemistry was done in genotyped PC tissues.
Results: A significant increase in the GA + AA genotype of the CXCL12 G801A polymorphism was observed in PC patients compared with healthy controls. The frequency of CXCL12 AA genotype was significantly higher in a group of patients with lymph node metastasis (23%) compared with those without metastasis (7%). The frequency of CXCL12 expression in AA + GA genotype carriers was significantly higher than that in GG genotype carriers. Among the carriers with CXCL12 GA + AA genotypes, CXCR4 expression was also significantly higher compared with those with the GG genotype. Moreover, among the groups with both CXCL12- and CXCR4-positive staining, the frequency of the CXCL12 GA + AA genotype was high. Although we did not find a significant relationship between the frequency of the Arg/Pro + Pro/Pro genotype of p53 Arg72Pro and susceptibility in PC, there was a combined effect of CXCL12 GA + AA genotype and the p53 72Arg/Pro + Pro/Pro genotype on the frequency of PC. These results indicate that the p53 codon 72 polymorphism may interact with CXCL12 G801A.
Conclusions: This is the first report showing that CXCL12 G801A polymorphism may be a risk factor for PC. Moreover, this study suggests that this polymorphism can be an important marker for detecting microinvasion and PC metastasis.
Prostate cancer (PC) is one of the most common malignancies in U.S. males (1). The etiology of PC is largely unknown, although several risk factors such as ethnicity, family history, and age are associated with the disease (2, 3). In addition, several dietary constituents have been linked to PC risk and prevention (4, 5). As prostate-specific antigen (PSA) screening test has spread, the number of curative patients tends to increase. However, a significant number of patients with lymph node metastasis have been identified at the radical prostatectomy (6). PC patients with lymph node metastasis have an increased risk of death (6). Lymph node metastasis increases the risk of distant metastasis including the bone. The mechanism of bone metastasis is not well understood. As one possible metastatic mechanism, it has been shown that the SDF-1 (CXCL12)/CXCR4 chemokine axis is involved in PC metastasis (7). Chemokines play important roles in both normal embryonic development and migration and metastasis of cancer cells (8). SDF-1 belongs to the CXC subfamily of chemokines and is produced by stromal cells. Expression of its only receptor CXCR4 is low or absent in normal prostate epithelia (8). Sun et al. (9) investigated the expression of CXCR4 and CXCL12 in PC and found that the expression of CXCR4 correlated with increased malignancy. The expression of CXCL12 mRNA was elevated in metastatic disease, but not in localized PC (9). A single nucleotide polymorphism (SNP) at position 801 (G to A) in the 3'-untranslated region (3'UTR), whose A allele is regarded as a target of cis-acting factors, has been shown to have the ability of up-regulating the expression of CXCL12 (10, 11). Recently, Dommange et al. (12) showed that CXCL12 801A carriers were associated with blast invasion in acute myelogenous leukemia (AML). They also investigated the correlation between the expression of CXCR4 and blast invasion in CXCL12 801 A carriers (12). CXCR4 is overexpressed in the cancer region and plays an important role in invasion and metastasis. The expression of CXCR4 is regulated by various factors including pVHL, vascular endothelial growth factor, hepatocyte growth factor, USF/c-Myc, nuclear factor-
B, promoter methylation, and CXCL12 (11). Recently, it was found that CXCR4 is also negatively regulated by the tumor suppressor gene p53 (13, 14).
The p53 is a tumor suppressor gene that initiates apoptosis in response to severe DNA damage. A p53 polymorphism at amino acid 72 (Arg/Pro; G/C) has been studied in many cancers (15–17). In an in vitro study, the p53 Arg/Arg genotype induced apoptosis more efficiently than the Pro/Pro genotype (18). The frequency of the Pro/Pro genotype has been reported to be high in various cancer patients (15–17), and it has been thought that this genotype may be linked to decreased p53 function.
Therefore, with these evidences, we hypothesized that (a) the CXCL12 polymorphism may increase the expression of CXCL12 and increase the metastasis of PC to the lymph node; (b) the CXCL12 polymorphism may be an important indicator of occult and lymph node metastasis; and (c) the p53 codon 72 polymorphism may attenuate the function of p53, thereby affecting the function of CXCL12/CXCR4 and indirectly promoting PC invasion and metastasis.
To test this hypothesis, we did a case-control study by examining polymorphisms in CXCL12 G801A and p53 Arg72Pro. We also investigated the relationship between expression of CXCL12/CXCR4 in PC tissues and genotypes with CXCL12 G801A polymorphism.
 |
Materials and Methods
|
|---|
Samples. A total of 167 patients with pathologically confirmed PC and 167 age-matched control individuals were enrolled in this study. The mean ages of the patient and control groups were 68 ± 10 and 68 ± 10 years, respectively (Table 1
).
Genomic DNA was obtained from the peripheral blood of healthy controls and patients. All of the patients tested were diagnosed with PC on the basis of histopathologic findings from radical prostatectomy. They were classified according to the WHO criteria and staged according to the tumor-node-metastasis (TNM) classification and the Gleason grading system.
Healthy controls consisted of random volunteers with no apparent abnormal findings upon medical examination at Shimane University Hospital. Peripheral blood samples were obtained from the patients and controls after written informed consent was obtained. All patients and healthy controls were native Japanese and resided in the Shimane prefecture or adjacent prefectures. Peripheral blood samples were obtained from the patients and controls after written informed consent was obtained.
None of these patients had received androgen deprivation therapy before radical prostatectomy. There were no significant differences between patients and control groups with regard to family history of cancer and body mass index.
Genotyping. Polymorphisms were analyzed by PCR-RFLP. The PCR primers of p53 and CXCL12 were TTGCCGTCCCAAGCAATGCAATGGATGA (P53-F), TCTGGGAAGGGACAGAAGATGAC (P53-R), CTGGGCAAAGCTAGTGAAG (CXCL12-F), and AGAACGTGGAGGATGTGGAG (CXCL12-R), respectively (19). Each PCR reaction was carried out in a total volume of 20 µL consisting of 0.3 µL of a 10 µmol/L solution of each primer, 1.5 mmol/L MgCl2, 0.8 mmol/L deoxynucleotide triphosphate, 0.5 unit RedTaq DNA polymerase (Sigma), 1 µL of genomic DNA (80 ng/µL), and 15.6 µL H2O using a PTC 200 Thermal Cycler (MJ Research). PCR products were digested with BstuI and MspI (New England Biolabs) for p53 and CXCL12, respectively. The restricted products were analyzed in a 2% agarose gel containing ethidium bromide. To confirm the genotype ascribed by RFLP, the PCR products were subjected to direct sequencing (Fig. 1
).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1. The p53 codon 72 and CXCL12 G801A in gel after RFLP. For the p53 codon 72 and CXCL12 G801A polymorphisms, the Pro allele and the A allele were not cleaved by BstuI and MspI and had a single band with a fragment of 199 bp and 209 bp, respectively. The heterozygote had three bands. Each result was confirmed by direct sequencing.
|
|
Statistical analysis. Hardy-Weinberg equilibrium was evaluated using SNPAlyze version 2.2 (DYNACOM Co. Ltd.). The
2 test was used to compare the genotype frequency between patients and controls. The odds ratio (OR) was obtained by unconditional logistic regression analysis and adjusted for age as a continuous variable. All statistical analyses were done using StatView (version 5; SAS Institute Inc.). A P value of <0.05 was regarded as statistically significant.
Immunohistochemistry study. Immunostaining of CXCL12 and CXCR4 was done in formalin-fixed, paraffin-embedded specimens using a mouse monoclonal antibody (1:200 dilution) against human CXCL12 and CXCR4 (MAB350, MAB172, R&D Systems). The staining procedure was according to a commercial kit (Santa Cruz Biotechnology). The sections were counterstained with Harris' hematoxylin. A pathologist not involved in the present study evaluated the immunostaining under blind conditions. Immunohistochemical staining was graded on an arbitrary scale from 0 to 2+, with 0 representing negative expression (0-25% positive cells), 1+ representing weakly positive expression (25-50% positive cells), and 2+ representing strongly positive expression (50-100% positive cells). The scale was determined according to the average number of positive cells in 10 random fields of all slides.
 |
Results
|
|---|
Characteristics of PC patients and controls. Table 1 shows the mean age, pT, Gleason sum, preoperative serum PSA, and smoking status of individual PC patients. Two-tailed Student's t tests were used to compare the age distribution between patients and control subjects. There was no significant difference of mean age between cases and controls (Table 1). In the 167 PC cases, 108 (65%) were organ confined, and 85 (51%) had a Gleason sum of <7.
Hardy-Weinberg equilibrium. The genotype frequencies of the two polymorphisms in total samples (n = 234), PC patients (n = 167), and healthy controls (n = 167) were consistent with the Hardy-Weinberg equilibrium distribution (P value of >0.05).
p53 and CXCL12 gene polymorphisms and PC. Table 2
shows the genotype distribution of CXCL12 G801A (rs1801157) and p53 Arg72Pro (rs1042522) polymorphisms in PC cases and healthy controls. A significant increase in the G/A + A/A genotypes of CXCL12 G801A was observed in patients compared with controls [OR, 1.58; 95% confidence interval (95% CI), 1.03-2.43; P = 0.03; Table 2]. The frequency of the A allele of CXCL12 G801A also tended to increase in patients (OR, 1.39; 95% CI, 1.00-1.94; P = 0.05). There was no statistical difference in the genotypes of the p53 Arg72Pro polymorphisms between cases and controls (Table 2).
The effect of both p53 codon 72 polymorphism and CXCL12 polymorphisms in PC patients. Among p53 codon 72 Arg/Pro+Pro/Pro carriers, the frequency of the G/A + A/A genotype of CXCL12 G801A was significantly increased in PC patients compared with controls (OR, 1.72; 95% CI, 1.10-2.70; P = 0.02; Table 3
).
Relationship of the CXCL12 polymorphism with clinical parameters in PC patients. The relationship of the CXCL12 G801A polymorphism with clinicopathologic parameters, including age at diagnosis, Gleason sum, serum PSA, pT, and pN, in PC patients was evaluated. Among younger patients (<68 years), the frequency of the CXCL12 AA genotype was significantly increased (19%, 8%; P = 0.04; Fig. 2
). The frequency of CXCL12 AA genotype was significantly higher in the lymph node metastasis group (n = 16; 23%) compared with lymph node-negative group (n = 151; 7%; P < 0.01, Fig. 2). There was no difference between the two groups with regard to Gleason sum and pT criteria (Fig. 2).

View larger version (8K):
[in this window]
[in a new window]
|
Fig. 2. Association of the CXCL12 G801A polymorphism and clinical parameters in PC patients. The frequency of CXCL12 AA genotype was significantly higher in the lymph node metastasis group (4:16, 23%) compared with the lymph node–negative group (10:151, 7%; P < 0.01). There was no difference between the two groups with regard to Gleason sum and pT criteria.
|
|
Comparison of CXCR4 and CXCL12 expression with CXCL12 genotype. To investigate the effect of the CXCL12 G801A polymorphism on CXCL12 expression, immunohistochemistry was done in some of the genotyped PC tissues. Positive staining for CXCL12 was detected in 15 of 33 GG genotype (45%), 13 of 16 GA genotype (81%), and 1 of 1 AA genotype carriers (100%). The frequency of CXCL12 expression in AA + GA genotype carriers was significantly higher than that in GG genotype carriers (P = 0.012; Fig. 3A
, Table 4
). We also investigated the expression of CXCR4 according to CXCL12 G801A genotypes. Among the carriers with CXCL12 GA + AA genotypes, the CXCR4 expression was significantly higher than those with the GG genotype (P = 0.036; Fig. 3B, Table 5
). Because the expression of both CXCL12 and CXCR4 is higher among carriers with CXCL12 GA + AA genotypes, we compared the correlation between CXCL12 genotypes and CXCL12 + CXCR4 expression. In the group with both CXCL12- and CXCR4-positive staining, the frequency of the CXCL12 GA + AA genotype was high (Fig. 4
).

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 3. A and B, effect of CXCL12 genotype on CXCL12 and CXCR4 expression. Tumors were scored as follows: score 0, no appreciable staining or staining in <25% of cancer cells; score 1+, tumors with weak appreciable incomplete nuclear and cytoplasmic staining in 25% to 50% of cancer cells; score 2+, strong immunoreactivity of the nucleus and cytoplasm in >50% of cancer cells. Tumors classified as 0 was considered negative, and those scored as 1 plus 2 were classified as positive.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 4. CXCL12 and CXCR4 expression and the CXCL12 G801A genotypes. A, we compared the number of tumors staining positively for CXCL12 and CXCR4 following immunohistochemistry. Positive staining is regarded as an immunohistochemistry score 1 + 2. The number staining positively for both CXCL12 and CXCR4 is 23 (46%). B, in each immunohistochemistry group, we compared the frequency of CXCL12 GA + AA genotypes. Among the double positive staining CXCL12 and CXCR4 group, the frequency of the CXCL12 GA + AA genotypes is 52%, which was comparably higher compared with the other groups.
|
|
 |
Discussion
|
|---|
Prior studies have indicated that the chemokine CXCL12 (SDF-1
) and its receptor CXCR4 play an important role in metastatic cancers (8, 12). CXCL12 is produced by bone marrow stromal cells, including osteoblasts and endothelial cells (20), and CXCL12 is the only known ligand for CXCR4.
The CXCL12 G801A polymorphism was first described in HIV-infected patients. This SNP is in the 3'UTR region of the CXCL12 (SDF-1) gene, and HIV patients with the AA genotype exhibited a significantly delayed progression to acquired immunodeficiency syndrome (AIDS) because of up-regulation of CXCL12 due to the strong competition with syncytia induction variants (11). Recently, the CXCL12 G801A SNP was linked with blast invasion from the bone marrow in AML patients. Thus, 801A carriers were found to be associated with higher peripheral blood blast counts compared with 801GG genotype carriers in AML (12). CXCL12 G801A SNP studies have been done in several cancers, including lung, breast, and colorectal cancer (21–23). However, there are currently no reports investigating the CXCL12 polymorphism in PC. Therefore, this is the first case-control study to investigate the relationship between the CXCL12 G801A polymorphism and PC susceptibility. In this study, we found that the CXCL12 801A SNP was significantly associated with PC susceptibility (OR, 1.58; 95% CI, 1.03-2.43; P = 0.03; Table 2). In an in vitro and in vivo study, overexpression of CXCR4 was found to accelerate prostate tumor growth, invasion, and metastasis (9, 24).
In addition, PC cells have been shown to migrate and invade through the extracellular matrix components in response to CXCL12 in an in vitro study (25). Although in clinical samples, high expression of CXCR4 correlates with the presence of metastatic disease in PC patients (24). Taken together, these data strongly suggest that CXCL12 and CXCR4 are associated with PC metastasis (26, 27).
We also investigated the expression of CXCL12 and CXCR4 in PC tissues by immunohistochemistry. In our study, the expression of CXCL12 correlates with the expression of CXCR4 (Fig. 4A), and this result is in agreement with previous reports (27, 28). As a second step, we also compared CXCL12 and CXCR4 expression with the CXCL12 SNPs. Among CXCL12 801 A allele carriers (GA + AA genotypes), CXCL12 expression was significantly higher than that of CXCL12 G allele carriers (Fig. 3B, Table 5; P = 0.012). In addition, we also found a positive correlation between CXCL12 GA + AA genotype and CXCR4 expression. The frequency of the CXCL12 GA + AA genotype was highest in a group positive for both CXCL12 and CXCR4 expression among the four immunohistochemistry groups shown in Fig. 4B (52%). These results suggest that CXCL12 G801A SNP correlates with both CXCL12 and CXCR4 expression.
In a group with lymph node metastasis (n = 16), the frequency of CXCL12 801A carriers was significantly higher compared with that without metastasis (n = 151; 23%, 7%; P < 0.01). The mean age of a lymph node metastasis group is 68.4 years, and this is the same as that of a nonmetastasis group (68.4 years). Therefore, the CXCL12 G801A genotype may indicate the lymph node metastasis status in PC.
Recently, CXCR4 has been reported to be regulated negatively by the tumor suppressor gene p53 (13, 14). Moreover, p53 was also found to suppress stromal SDF-1 (CXCL12) production within both human and mouse (14). The p53 is a tumor suppressor gene that initiates apoptosis in response to severe DNA damage. In an in vitro study, the p53 Arg/Arg genotype induced apoptosis more efficiently than the Pro/Pro genotype (18). It has been reported that the frequency of the Pro/Pro genotype is higher in various cancer patients compared with controls (15–17), and this genotype may be linked to the decreased function of p53. Although we did not find a significant relationship between the frequency of the Arg/Pro + Pro/Pro genotype of p53 Arg72Pro and susceptibility in PC (Table 2; OR = 1.14, 95% CI = 0.72-1.78), there was a combined effect between the CXCL12 GA + AA genotype and the p53 72Arg/Pro + Pro/Pro genotype (Table 3; OR = 1.72, 95% CI = 1.10-2.70). The findings by Moskovits et al. (14) showing that the p53 codon 72 SNP decreased p53 function also resulted in higher production of CXCL12. Therefore, among CXCL12 801A carriers, production of CXCL12 may be further enhanced by the p53 72Pro SNP. These results indicate that the p53 codon 72 polymorphism may interact with CXCL12 G801A.
The average age of the patient in this study was 68 years old; therefore, we divided them into two groups. The frequency of CXCL12 GA + AA genotypes among patients under 68 years old is significantly higher compared with that among older age groups (OR, 2.69; 95% CI, 1.12-6.49) and, thus, may be an increased risk of PC in patients under 68 years old in our study (Fig. 2). Previous studies have shown the association of an early age of onset of PC with various polymorphisms, including vitamin D receptor (29) and CYP1A1 (30). These studies may support the idea that procarcinogenic polymorphisms can accelerate the development of PC. In this study, we could not investigate the relationship between the CXCL12 G801A polymorphism and prognosis because following prostatectomy, the patients underwent varying treatment, including hormone therapy, chemotherapy, and radiotherapy. However, it is well documented that lymph node metastasis is strongly linked to poor prognosis in PC (6).
In conclusion, this is the first report to show a significant association between the CXCL12 G801A polymorphism and PC metastasis. In addition, we also found a relationship between the CXCL12 G801A genotype and the expression of CXCL12 and CXCR4 in PC tissues. Therefore, the CXCL12 G801A polymorphism may be an important tool for indicating and detecting PC microinvasion and metastasis.
 |
Acknowledgments
|
|---|
We thank Dr. Roger Erickson for his support and assistance with the preparation of the manuscript.
 |
Footnotes
|
|---|
Grant support: Grants RO1CA101844, RO1AG21418, R01CA111470, R01CA108612, and T32-DK07790 from the NIH, Veterans Affairs Research Enhancement Award Program (REAP), Veterans Affairs Merit Review grants, and Yamada Science Foundation.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 4/11/07;
revised 6/ 8/07;
accepted 6/19/07.
 |
References
|
|---|
- Jemal A, Tiwari RC, Murray T, et al. Cancer statistics, 2004. CA Cancer J Clin 2004;50:8–29.
- Roemeling S, Roobol MJ, de Vries SH, Gosselaar C, van der Kwast TH, Schroder FH. Prevalence, treatment modalities and prognosis of familial prostate cancer in a screened population. J Urol 2006;175:1332–6.[CrossRef][Medline]
- Pienta KJ, Esper PS. Risk factors for prostate cancer. Ann Intern Med 1993;118:793–803.[Abstract/Free Full Text]
- Chan JM, Holick CN, Leitzmann MF, et al. Diet after diagnosis and the risk of prostate cancer progression, recurrence, and death (United States). Cancer Causes Control 2006;17:199–208.[CrossRef][Medline]
- Shukla S, Gupta S. Dietary agents in the chemoprevention of prostate cancer. Nutr Cancer 2005;53:18–32.[CrossRef][Medline]
- Cheng L, Zincke H, Blute ML, Bergstralh EJ, Scherer B, Bostwick DG. Risk of prostate carcinoma death in patients with lymph node metastasis. Cancer 2001;91:66–73.[CrossRef][Medline]
- Mochizuki H, Matsubara A, Teishima J, et al. Interaction of ligand-receptor system between stromal-cell–derived factor-1 and CXC chemokine receptor 4 in human prostate cancer: a possible predictor of metastasis. Biochem Biophys Res Commun 2004;320:656–63.[CrossRef][Medline]
- Balkwill F. Cancer and the chemokine network. Nat Rev Cancer 2004;4:540–50.[CrossRef][Medline]
- Sun YX, Wang J, Shelburne CE, et al. Expression of CXCR4 and CXCL12 (SDF-1) in human prostate cancers (PCa) in vivo. J Cell Biochem 2003;89:462–73.[CrossRef][Medline]
- Winkler C, Modi W, Smith MW, et al. Genetic restriction of AIDS pathogenesis by an chemokine gene variant. ALIVE Study, Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC). Science 1998;279:389–93.[Abstract/Free Full Text]
- Watanabe MA, de Oliveia Cavassin GG, Orellana MD, et al. SDF-1 gene polymorphisms and syncytia induction in Brazilian HIV-1 infected individuals. Microb Pathog 2003;35:31–4.[CrossRef][Medline]
- Dommange F, Cartron G, Espanel C, et al. CXCL12 polymorphism and malignant cell dissemination/tissue infiltration in acute myeloid leukemia. FASEB J 2006;20:1913–5.[Abstract/Free Full Text]
- Mehta SA, Christopherson KW, Bhat-Nakshatri P, et al. Negative regulation of chemokine receptor CXCR4 by tumor suppressor p53 in breast cancer cells: implications of p53 mutation or isoform expression on breast cancer cell invasion. Oncogene 2007;26:3329–37.[CrossRef][Medline]
- Moskovits N, Kalinkovich A, Bar J, Lapidot T, Oren M. p53 Attenuates cancer cell migration and invasion through repression of SDF-1/CXCL12 expression in stromal fibroblasts. Cancer Res 2006;66:10671–6.[Abstract/Free Full Text]
- Boersma BJ, Howe TM, Goodman JE, et al. Association of breast cancer outcome with status of p53 and MDM2 SNP309. J Natl Cancer Inst 2006;98:911–9.[Abstract/Free Full Text]
- Santos AM, Sousa H, Pinto D, et al. Linking P53 codon 72 and P21 nt590 genotypes to the development of cervical and ovarian cancer. Eur J Cancer 2006;42:958–63.[CrossRef][Medline]
- Schabath MB, Wu X, Wei Q, Li G, Gu J, Spitz MR. Combined effects of the p53 and p73 polymorphisms on lung cancer risk. Cancer Epidemiol Biomarkers Prev 2006;15:158–61.[Abstract/Free Full Text]
- Thomas M, Kalita A, Labrecque S, Pim D, Banks L, Matlashewski G. Two polymorphic variants of wild-type p53 differ biochemically and biologically. Mol Cell Biol 1999;19:1092–100.[Abstract/Free Full Text]
- Ara S, Lee PS, Hansen MF, Saya H. Codon 72 polymorphism of the TP53 gene. Nucleic Acids Res 1990;18:4961.[Free Full Text]
- Sun YX, Fang M, Wang J, Cooper CR, Pienta KJ, Taichman RS. Expression and activation of
(v)ß(3) integrins by SDF-1/CXC12 increases the aggressiveness of prostate cancer cells. Prostate 2007;67:61–73.[CrossRef][Medline] - Razmkhah M, Doroudchi M, Ghayumi SM, Erfani N, Ghaderi A. Stromal cell-derived factor-1 (SDF-1) gene and susceptibility of Iranian patients with lung cancer. Lung Cancer 2005;49:311–5.[CrossRef][Medline]
- Razmkhah M, Talei AR, Doroudchi M, Khalili-Azad T, Ghaderi A. Stromal cell-derived factor-1 (SDF-1) alleles and susceptibility to breast carcinoma. Cancer Lett 2005;225:261–6.[CrossRef][Medline]
- Dimberg J, Hugander A, Lofgren S, Wagsater D. Polymorphism and circulating levels of the chemokine CXCL12 in colorectal cancer patients. Int J Mol Med 2007;19:11–5.[Medline]
- Darash-Yahana M, Pikarsky E, Abramovitch R, et al. Role of high expression levels of CXCR4 in tumor growth, vascularization, and metastasis. FASEB J 2004;18:1240–2.[Abstract/Free Full Text]
- Singh S, Singh UP, Grizzle WE, Lillard JW, Jr. CXCL12–4 interactions modulate prostate cancer cell migration, metalloproteinase expression and invasion. Lab Invest 2004;84:1666–76.[CrossRef][Medline]
- Taichman RS, Cooper C, Keller ET, Pienta KJ, Taichman NS, McCauley LK. Use of the stromal cell-derived factor-1/CXCR4 pathway in prostate cancer metastasis to bone. Cancer Res 2002;62:1832–7.[Abstract/Free Full Text]
- Cooper CR, Chay CH, Gendernalik JD, et al. Stromal factors involved in prostate carcinoma metastasis to bone. Cancer 2003;97:739–47.[CrossRef][Medline]
- Chinni SR, Sivalogan S, Dong Z, et al. CXCL12/CXCR4 signaling activates Akt-1 and MMP-9 expression in prostate cancer cells: the role of bone microenvironment-associated CXCL12. Prostate 2006;66:32–48.[CrossRef][Medline]
- Oakley-Girvan I, Feldman D, Eccleshall TR, et al. Risk of early-onset prostate cancer in relation to germ line polymorphisms of the vitamin D receptor. Cancer Epidemiol Biomarkers Prev 2004;13:1325–30.[Abstract/Free Full Text]
- Vijayalakshmi K, Vettriselvi V, Krishnan M, Shroff S, Jayanth VR, Paul SF. Cytochrome p4501A1 gene variants as susceptibility marker for prostate cancer. Cancer Epidemiol Biomarkers Prev 2005;1:251–8.