Clinical Cancer Research Grants Advances in Breast Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Clinical Cancer Research 13, 5314, September 15, 2007. doi: 10.1158/1078-0432.CCR-06-2660
© 2007 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, L.
Right arrow Articles by Coukos, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, L.
Right arrow Articles by Coukos, G.

Human Cancer Biology

Integrative Genomic Analysis of Phosphatidylinositol 3'-Kinase Family Identifies PIK3R3 as a Potential Therapeutic Target in Epithelial Ovarian Cancer

Lin Zhang1,2, Jia Huang3, Nuo Yang1, Joel Greshock3, Shun Liang1, Kosei Hasegawa1,6, Antonis Giannakakis1,7, Nikolaos Poulos1, Ann O'Brien-Jenkins1, Dionyssios Katsaros4, Ralf Butzow5, Barbara L. Weber3 and George Coukos1,2,3

Authors' Affiliations: 1 Center for Research on Early Detection and Cure of Ovarian Cancer, 2 Department of Obstetrics and Gynecology, and 3 Abramson Family Cancer Research Institute, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania; 4 Department of Obstetrics and Gynecology, University of Turin, Turin, Italy; 5 Departments of Obstetrics and Gynecology, University of Helsinki, Helsinki, Finland; 6 Department of Obstetrics and Gynecology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan; and 7 Laboratory of Gene Expression, Modern Diagnostic and Therapeutic Methods, Democritus University of Thrace, Alexandroupolis, Greece

Requests for reprints: Lin Zhang, University of Pennsylvania, Rm. 1209 BRB II/III, 421 Curie Boulevard, Philadelphia, PA 19104. Phone: 215-573-4780; Fax: 215-573-7627; E-mail: linzhang{at}mail.med.upenn.edu.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Purpose: The phosphatidylinositol 3'-kinase (PI3K) family plays a key regulatory role in various cancer-associated signal transduction pathways. Here, we investigated the genomic alterations and gene expression of most known PI3K family members in human epithelial ovarian cancer.

Experimental Design: The DNA copy number of PI3K family genes was screened by a high-resolution array comparative genomic hybridization in 89 human ovarian cancer specimens. The mRNA expression level of PI3K genes was analyzed by microarray retrieval approach, and further validated by real-time reverse transcription-PCR. The expression of p55{gamma} protein in ovarian cancer was analyzed on tissue arrays. Small interfering RNA was used to study the function of PIK3R3 in ovarian cancer.

Results: In ovarian cancer, 6 of 12 PI3K genes exhibited significant DNA copy number gains (>20%), including PIK3CA (23.6%), PIK3CB (27.0%), PIK3CG (25.8%), PIK3R2 (29.2%), PIK3R3 (21.3%), and PIK3C2B (40.4%). Among those, only PIK3R3 had significantly up-regulated mRNA expression level in ovarian cancer compared with normal ovary. Up-regulated PIK3R3 mRNA expression was also observed in liver, prostate, and breast cancers. The PIK3R3 mRNA expression level was significantly higher in ovarian cancer cell lines (n = 18) than in human ovarian surface epithelial cells (n = 6, P = 0.002). Overexpression of p55{gamma} protein in ovarian cancer was confirmed by tissue array analysis. In addition, we found that knockdown of PIK3R3 expression by small interfering RNA significantly increased the apoptosis in cultured ovarian cancer cell lines.

Conclusion: We propose that PIK3R3 may serve as a potential therapeutic target in human ovarian cancer.


Epithelial ovarian cancer continues to be the leading cause of death among gynecologic malignancies (1). The lack of preventive strategies, early diagnostic methods, and effective therapies to treat recurrent ovarian tumors creates a pressing need to understand its pathogenesis and to identify molecular targets for therapy (26). Cancer is a disease involving multistep dynamic changes in the genome. However, the oncogenic events as well as their cooperation that promote malignant transformation and growth remain largely unknown in ovarian carcinoma (2, 79).

Phosphatidylinositol 3'-kinase (PI3K), a novel intracellular transducer with lipid substrate specificity, is involved in a wide range of cancer-associated signaling pathways (2, 1017). It is recruited and activated by multiple receptor tyrosine kinases and generates second messengers via phosphorylation of membrane inositol lipids at the D3 position (18). A better understanding of the role of PI3K in ovarian cancer will undoubtedly provide new insights for pharmacologic intervention in this malignancy. Molecular cloning of PI3Ks reveals a large and complex family that contains three classes of multiple subunits and isoforms. However, how each subunit precisely contributes to the progress and maintenance of cancer is largely undetermined (14, 15). Amplification and/or mutations of the gene encoding the catalytic subunit {alpha} of PI3K, PIK3CA, have been reported in multiple solid tumors, including ovarian cancer (1925).

In the present study, we investigated the DNA copy number abnormalities of the genomic regions containing PI3K genes in 89 human cancer samples using a recently described high-resolution array comparative genomic hybridization (aCGH; refs. 26, 27). We also used an integrated bioinformatic approach to study the profile of most known isoforms of PI3K family in human ovarian cancer. We found that PIK3R3 might serve as a potential therapeutic target in this disease.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Patients and specimens. The specimens used in this study were collected at the University of Pennsylvania and the University of Turin, Italy. Specimens were analyzed by comparative genomic hybridization array (n = 89). All tumors were from primary sites and were immediately snap-frozen and stored at –80°C. Specimens were processed under procedures approved by the local institutional review boards and compliant with the Health Insurance Portability and Accountability Act act.

Cell lines and cell culture. A total of 18 ovarian cell lines were used in this study (28, 29). All cancer cell lines were cultured in DMEM (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen). Human ovarian surface epithelium (HOSE) cells were isolated by our laboratory or generously provided by Dr. Birrer (30). Four immortalized HOSE cells [IOSE398 (31), generously provided by Dr. Auersperg; and ITOSE4, ITOSE6 (30), and HOSE6-14 (32), generously provided by Dr. Birrer] were cultured in 1:1 media 199/MCDB 105 (Sigma) supplemented with 15% fetal bovine serum.

DNA isolation and aCGH. Genomic DNA was isolated from frozen tumors or cultured cells by overnight digestion, phenol-chloroform extraction, and ethanol precipitation. Bacterial artificial chromosome clones were cultured in YT broth containing 12.5 µg/mL chloramphenicol. Bacterial artificial chromosome DNA was extracted using 96-well blocks (REAL prep kits, Qiagen). DNA was then amplified by degenerate oligonucleotide primer-PCR and was resuspended to a final concentration of 10 to 15 µg/mL. Arrays were printed on Corning CMT Ultra-Gap slides. A minimum of two replicates per clone were printed on each slide. One microgram of tumor DNA and reference DNA were labeled with Cy3 or Cy5, respectively (Amersham), using the BioPrime Random-Primed Labeling Kit (Invitrogen). The tumor DNA and reference DNA were labeled with the opposite dye as well to account for difference in dye incorporation and provide additional data for analysis. Labeled tumor and reference DNA were combined and precipitated with human Cot-1 DNA to reduce nonspecific binding. DNA was resuspended and applied to arrays. Arrays were hybridized for 72 h at 37°C on a rotating platform. Images were scanned with an Affymetrix 428 microarray scanner and analyzed with GenePix software (Axon). The Cy3/Cy5 (tumor/reference DNA) fluorescent intensity ratio greater than or less than 1.2 was considered as alteration (Fig. 1B ). Analysis of aCGH data and determination of amplifications and losses were done using the software suite CGHAnalyzer (Fig. 1B). The aCGH results were validated by real-time PCR as previously described (33).


Figure 1
View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. DNA copy number alterations of the PI3K family in human ovarian cancer. A, DNA copy number alterations of PI3K gene family in 89 late-stage primary ovarian cancer specimens. Left, aCGH data of 12 PI3K family genes in 89 primary tumors. Right, the summary of aCGH data. Red, DNA copy number losses; green, copy number gains. A frequency of alteration >20% was considered significant. B, genomic profile of chromosome 1 in one ovarian cancer specimen. Red line, the experiment in which tumor DNA was labeled with Cy3 and reference DNA with Cy5; yellow line, the experiment with the opposite dye labeling. Vertical axis, the intensity ratio of Cy3 to Cy5. Thresholds for copy number gain or loss are 1.2 and 0.8, respectively. C, genomic profile of chromosome 1 in 89 ovarian cancer specimens. Yellow line, PIK3R3 is located at 1p3. Green, DNA copy number gains; red, losses.

 
Total RNA isolation and quantitative real-time reverse transcription-PCR. Total RNA was isolated from 1 x 106 cultured cells with TRIzol reagent (Invitrogen). After treatment with RNase-free DNase (Invitrogen), total RNA was reverse-transcribed using Superscript First-Strand Synthesis Kit for reverse transcription-PCR (Invitrogen) under conditions defined by the supplier. cDNA was quantified by real-time PCR on the ABI Prism 7900 Sequence Detection System (Applied Biosystems). PIK3R3 forward primer: GAGAGGGGAATGAAAAGGAGA, and reverse primer: ATCATGAATCTCACCCAGACG. PCR was done using Sybr Green PCR Core reagents (Applied Biosystems) according to manufacturer's instructions. PCR amplification of the housekeeping genes GAPDH was done for each sample as control for sample loading and to allow normalization among samples. A standard curve was constructed containing the human PIK3R3 cDNA and amplified by real-time PCR. Each sample was run in duplicate, and each PCR experiment included two nontemplate control wells. PCR products were confirmed as single bands using gel electrophoresis.

Microarray data retrieval and bioinformatic analysis. The public expression microarray data were retrieved from authors' Web site (3442) and further analyzed using the web-based microarray analysis software, ONCOMINE8 and SOURCE.9

Tissue microarray. The tissue microarray was provided by Dr. Butzow (Departments of Obstetrics and Gynecology, University of Helsinki, Helsinki, Finland) and constructed as described previously (43, 44). In brief, tumors were embedded in paraffin and 5-µm sections stained with H&E were obtained to select representative areas for biopsies. Four core tissue biopsies were obtained from each specimen. The presence of tumor tissue on the arrayed samples was verified on H&E-stained section.

Immunohistochemistry and image analysis. Immunohistochemistry was done using the Vectastain ABC Kit as described by the manufacturer (Vector). Primary antibody, anti-human p55{gamma} (1:50 Abgent), was incubated on sample sections for 2 h at room temperature or overnight at 4°C. The immunoreaction was visualized with 3,3'-diaminobenzidine (Vector). Staining was quantitated by image analysis. Images were collected through Cool SNAP Pro color digital camera (Media Cybernetics) and staining index was analyzed using Image-Pro Plus 4.1 software (Media Cybernetics).

RNA interference/transfection of synthetic small interfering RNA. Synthetic SMARTpool small interfering RNA (siRNA) targeting human PIK3R3 (Dharmacon) or appropriate siCONTROL nontargeting siRNAs (Dharmacon) were transfected into cultured cells. Transfection was done using LipofectAMINE 2000 (Invitrogen) following the manufacturer's instructions. Ovarian cancer cell lines were cultured in 24-well plate in antibiotics-free 10% fetal bovine serum plus medium. Upon 70% to 80% confluency, transfection of siRNAs at 100 nmol/L was done. Triplicate transfection was done for each experimental group and the experiment was repeated at least two more times. Forty-eight hours after transfection, total RNA was extracted to examine the PIK3R3 expression by real-time reverse transcription-PCR.

Apoptosis assays. Annexin V staining was detected by flow cytometry using the Apoptosis Detection Kit (R&D Systems). Both floating and adherent cells were collected, washed with PBS, and resuspended in binding buffer containing 10 mmol/L HEPES (pH 7.4), 140 mmol/L NaCl, and 2.5 mmol/L CaCl2. After 15-min incubation with Annexin V–biotin at room temperature, cells were resuspended and incubated in binding buffer containing 4 µg/mL streptavidin Red 670 (Invitrogen) for 15 min. The fluorescence emitted by cells was analyzed using a FACScan flow cytometer (Becton Dickinson).

Statistics. Statistical analysis was done using the SPSS statistics software package. All results were expressed as mean ± SD, and P < 0.05 was used for significance.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
DNA copy number alterations of the PI3K family in human ovarian cancer. Alterations in DNA copy number is a mechanism to modify gene expression and function; and the DNA dosage alterations occurring in somatic cells are frequent contributors to cancer. Over the past several years, aCGH has proven its value for analyzing DNA copy number variations. To determine the DNA copy number abnormalities in the PI3K family in ovarian cancer, high-resolution (~1 Mb) aCGH (26) was used in this study. The genomic loci of 12 known human PI3K family genes were identified at the University of California Santa Cruz Genome Bioinformatics Site.10 We analyzed a total of 89 late-stage primary tumors. DNA copy number alterations observed in >20% tumors were considered significant. Based on aCGH, we found 6 of the 12 PI3K family members with significant DNA copy number gains, including PIK3CA (23.6%), PIK3CB (27.0%), PIK3CG (25.8%), PIK3R2 (29.2%), PIK3R3 (21.3%), and PIK3C2B (40.4%; Fig. 1). This result indicated that select PI3K family members exhibited increased gene copy numbers in ovarian cancer.

Transcriptional profile of PI3K family in human cancer. Expression microarray has emerged as a powerful approach to study the gene expression profile of cancer. Hundreds of studies have presented analyses of cancer samples, identifying gene expression signatures for most major cancer types and subtypes and uncovering gene expression patterns that correlate with various characteristics of tumors (4549). To further study the expression profile of the PI3K family in ovarian cancer, public expression microarray data sets of human cancer were retrieved from the authors' Web site (3438, 40, 42) and analyzed by a web-based microarray bioinformatic tool, Oncomine.8 We examined the mRNA expression of the PI3K family between normal tissues and corresponding tumors in nine independent microarray studies (3438, 40, 42), including two ovarian cancer studies. Out of the six significantly amplified PI3K genes, only PIK3R3 had a significantly up-regulated mRNA expression level in ovarian cancer compared with normal ovary in both ovarian cancer studies. In addition, PIK3R3 expression levels were significantly increased in liver, prostate, and breast cancers (Fig. 2A ). We also compared the expression level of PIK3R3 in different cancer types based on two independent microarray studies (39, 41). In agreement with the first microarray screen, both studies indicated that PIK3R3 was highly expressed in ovarian, breast, and prostate cancers (Fig. 2B and C). We further validated the aCGH and microarray results in 22 human ovarian cancer specimens. First, the aCGH result was validated by real-time PCR (based on aCGH, amplification group: n = 5, real-time PCR normalized DNA copy number: 2.43 ± 0.55; nonamplification group: n = 17, normalized DNA copy number: 1.09 ± 0.20). There was a significant correlation (P < 0.01) between aCGH and real-time PCR validation examined by the Pearson correlation test. Second, the correlation between PIK3R3 DNA copy number amplification and its mRNA expression was further confirmed by real-time reverse transcription-PCR (relative PIK3R3 mRNA expression in amplified group: 622.00 ± 109.09, n = 5; in nonamplified group: 194.18 ± 111.86, n = 17). The mRNA expression of PIK3R3 was significantly higher in amplified group compared with nonamplified group (P < 0.01). Finally, to eliminate the misleading results due to the normal control samples for ovarian cancer microarray, we analyzed the PIK3R3 mRNA expression in 18 ovarian cancer cell lines and 6 HOSE cells (the proposed precursor cell of epithelial ovarian cancer) by quantitative real-time reverse transcription-PCR. We found significantly up-regulated PIK3R3 mRNA expression in established cancer cell lines compared with HOSE cells (P = 0.002; Fig. 3 ). The above data further confirmed that PIK3R3 is up-regulated in ovarian cancer.


Figure 2
View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Transcriptional profile of the PI3K family in human ovarian cancer. A, summary of retrieved microarray expression data of the PI3K family in human cancers and corresponding normal tissues. For each panel, from right to left: 1, liver cancer (normal n = 76, cancer n = 104; ref. 34); 2, prostate cancer (normal n = 21, cancer n = 57; ref. 35); 3, lung adenocarcinoma (normal n = 6, cancer n = 40; ref. 36); 4, squamous lung cancer (normal n = 6, cancer n = 13; ref. 36); 5, pancreatic cancer (normal n = 4, cancer n = 11; ref. 37); 6, colon cancer (normal n = 4, cancer n = 3; ref. 38); 7, breast cancer (normal n = 4, cancer n = 70; ref. 40); 8, ovarian cancer (normal n = 4, cancer n = 11; ref. 38); and 9, ovarian cancer (normal n = 4, cancer n = 28; ref. 42). B, microarray data of PIK3R3 expression in NCI-60 cell lines (39). C, microarray data of PIK3R3 expression among 11 different human solid cancer types (41).

 

Figure 3
View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Up-regulation of PIK3R3 mRNA in human ovarian cancer. A, PIK3R3 mRNA expression levels quantified by real-time reverse transcription-PCR in 6 HOSE cell lines and 18 established ovarian cancer cell lines. B, summarized result: PIK3R3 mRNA expression level is significantly up-regulated in ovarian cancer cell lines compared with HOSE cells (P = 0.002).

 
Overexpression of p55{gamma} protein in human ovarian cancer. Next, we analyzed the expression of the PIK3R3 protein product, p55{gamma}, in normal human ovary, early ovarian surface epithelium malignant transformation as well as ovarian carcinoma by immunohistochemistry. In normal human ovary, weak p55{gamma} expression was detected in follicles, especially theca cells, but not in stroma (Fig. 4A and B ). Minimum p55{gamma} staining could be detected in both the epithelium of normal ovary and in morphologically normal ovarian surface epithelial cells adjacent to early malignant transformation sites (Fig. 4C and D). In contrast, strong up-regulation of p55{gamma} expression was detected in adjacent transformed ovarian surface epithelial cells (Fig. 4C and E). In addition, strong p55{gamma} expression was found in both primary and metastatic ovarian cancer without polarized localization (Fig. 5A and B ). Finally, we examined a tissue array containing a large ovarian cancer collection. We observed that strong p55{gamma} expression could be detected in 100% of the ovarian cancer specimens (Fig. 5C). We observed that strong, medium, and weak p55{gamma} staining in 88%, 7%, and 5% of specimens, respectively.


Figure 4
View larger version (117K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Expression of p55{gamma} protein in human ovary and early malignant transformation. A and B, immunohistochemistry of p55{gamma} in normal human ovary. C to E, immunohistochemistry of p55{gamma} in ovarian surface epithelium undergoing early malignant transformation. C, morphologically normal epithelium next to malignant transformation; D and E, higher magnification of C.

 

Figure 5
View larger version (97K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Overexpression of p55{gamma} protein in human ovarian cancer. Immunohistochemistry of p55{gamma} in primary (A) and metastatic (B) ovarian cancer. C, immunohistochemistry of p55{gamma} in ovarian cancer tissue array.

 
Knockdown of PIK3R3 mRNA expression increases cell apoptosis in ovarian cancer in vitro. Our previous work has shown that increased PI3K signaling contributes to the survival of human ovarian cancer cells in vivo (17). In addition, blockade of PI3K function by kinase inhibitor Ly29004 or siRNA was able to significantly increase the apoptotic rate in cultured ovarian cancer cells (17, 50). Therefore, we tested the effect of PIK3R3 expression on cell apoptosis in vitro. Using siRNA, we specifically knocked down the PIK3R3 expression in two ovarian cancer cell lines, which were confirmed by Western blot (Fig. 6A ), and the apoptosis was quantified by Annexin V analysis. It was found that the knockdown of PIK3R3 expression significantly increased the percentage of apoptotic cells (both P < 0.05; Fig. 6B). This result strongly suggested that increased PIK3R3 expression might contribute to the ovarian cancer cell survival. In summary, our data proposed PIK3R3 as a potential oncogene in ovarian malignancy.


Figure 6
View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Knockdown of PIK3R3 increases apoptosis in ovarian cancer cells in vitro. A, Western blot confirming p55{gamma} knockdown in transfected cells. B, percentage of apoptotic cells in control and PIK3R3 siRNA-transfected A2780 and 2008 cells.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PI3K family might play critical roles in human cancer (1017). Some members of this gene family have been reported to gain function via genetic alterations in human cancer (1017). For example, PIK3CA exhibits DNA copy number amplification as well as mutations in human cancers, including ovarian cancer (1923). Molecular cloning of PI3Ks has revealed a large and complex family that contains three classes composed of multiple subunits and isoforms. However, how each subunit precisely contributes to the progress and maintenance of cancer is largely undetermined (14, 15). In addition, the information on global genomic alterations of this gene family is still absent for human cancers.

In the present study, we investigated the genomic alterations of most known PI3K family members in human ovarian cancer by an integrated genomic approach, including aCGH, expression microarray, and tissue arrays. Six of 12 PI3K family members were found to be significantly amplified in ovarian cancer. In agreement with other groups' reports (19, 20, 24), DNA copy number of PIK3CA was significantly amplified in our study. A large-scale microarray data retrieval approach was used to analyze the mRNA expression of this gene family in human cancer. We found that one of those six amplified members, PIK3R3, exhibited significantly up-regulated mRNA expression in ovarian carcinoma compared with normal ovary. To further analyze the expression of PIK3R3 with malignant progression in ovarian surface epithelium, we compared the PIK3R3 mRNA expression in ovarian cancer cell lines and HOSE cells, the proposed precursor cell of epithelial ovarian cancer. As a result, we found that PIK3R3 was significantly up-regulated in cancer cells, validating the microarray results. In addition, overexpression of p55{gamma} in ovarian cancer was confirmed by immunohistochemistry and tissue array study. Taken together, these data strongly suggest that the PI3K pathway may gain function via PIK3R3 amplification and overexpression in ovarian cancer.

It has been widely reported that PI3K contributes to tumor cell survival and antiapoptosis (1017). To test the function of PIK3R3 in ovarian cancer, we specifically knocked down its mRNA expression by siRNA and we found that the reduced PIK3R3 mRNA expression significantly increased apoptosis in vitro. Therefore, PIK3R3 may serve as a candidate therapeutic target for this disease.


    Acknowledgments
 
We thank Drs. Steven Johnson and Kang-Shen Yao (University of Pennsylvania, Philadelphia, PA) for the human ovarian cancer cells; Dr. Michael J. Birrer (National Cancer Institute, Bethesda, MD) for HOSE cells; Dr. Nelly Auersperg (University of British Columbia, Vancouver, BC, Canada) for HOSE cells and access to the Canadian Ovarian Tissue Bank; and Drs. S. Peter Nissley (NIH, Bethesda, MD) and Morris F. White (Harvard University, Cambridge, MA) for PIK3R3 cDNAs.


    Footnotes
 
Grant support: Ovarian Cancer Research Fund (G. Coukos and L. Zhang), National Cancer Institute ovarian Specialized Programs of Research Excellence P01-CA83638 (Career Development Award; L. Zhang), American Cancer Society (L. Zhang) and Mary Kay Ash Charitable Foundation (L. Zhang), and the Italian Association for Cancer Research (D. Katsaros).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: L. Zhang, J. Huang, and N. Yang contributed equally to this work.

Current address for J. Huang: Department of Biomedical Sciences, Scripps Research Institute, Jupiter, FL.

Current address for B.L. Weber: Translational Medicine and Genetics at GlaxoSmithKline, King of Prussia, PA.

8 http://www.oncomine.org/main/index.jsp Back

9 http://genome-www5.stanford.edu/cgi-bin/source/sourceSearch Back

10 http://genome.ucsc.edu Back

Received 11/ 6/06; revised 4/25/07; accepted 7/ 3/07.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jemal A, Tiwari RC, Murray T, et al. Cancer statistics, 2004. CA Cancer J Clin 2004;54:8–29.[Abstract/Free Full Text]
  2. Birrer MJ. Ovarian cancer: not a borderline issue! Cancer Biol Ther 2006;5:786–7.[Medline]
  3. Ozols RF. Management of advanced ovarian cancer consensus summary. Advanced Ovarian Cancer Consensus Faculty. Semin Oncol 2000;27:47–9.[Medline]
  4. Berchuck A, Brewer M, Rodriguez G, Campbell I. Discussion: ovarian cancer prevention. Gynecol Oncol 2003;88:S67–70.[CrossRef]
  5. Ozols RF, Bookman MA, Connolly DC, et al. Focus on epithelial ovarian cancer. Cancer Cell 2004;5:19–24.[CrossRef][Medline]
  6. Agarwal R, Kaye SB. Ovarian cancer: strategies for overcoming resistance to chemotherapy. Nat Rev Cancer 2003;3:502–16.[CrossRef][Medline]
  7. Bandera CA, Ye B, Mok SC. New technologies for the identification of markers for early detection of ovarian cancer. Curr Opin Obstet Gynecol 2003;15:51–5.[CrossRef][Medline]
  8. Wooster R, Weber BL. Breast and ovarian cancer. N Engl J Med 2003;348:2339–47.[Free Full Text]
  9. Gray JW, Suzuki S, Kuo WL, et al. Specific keynote: genome copy number abnormalities in ovarian cancer. Gynecol Oncol 2003;88:S16–21; discussion S22–4.[CrossRef][Medline]
  10. Engelman JA, Luo J, Cantley LC. The evolution of phosphatidylinositol 3-kinases as regulators of growth and metabolism. Nat Rev Genet 2006;7:606–19.[CrossRef][Medline]
  11. Bader AG, Kang S, Zhao L, Vogt PK. Oncogenic PI3K deregulates transcription and translation. Nat Rev Cancer 2005;5:921–9.[CrossRef][Medline]
  12. Hennessy BT, Smith DL, Ram PT, Lu Y, Mills GB. Exploiting the PI3K/AKT pathway for cancer drug discovery. Nat Rev Drug Discov 2005;4:988–1004.[CrossRef][Medline]
  13. Parsons R. Phosphatidylinositol 3-kinase inhibitors are a triple threat to ovarian cancer. Clin Cancer Res 2005;11:7965–6.[Free Full Text]
  14. Vivanco I, Sawyers CL. The phosphatidylinositol 3-kinase AKT pathway in human cancer. Nat Rev Cancer 2002;2:489–501.[CrossRef][Medline]
  15. Katso R, Okkenhaug K, Ahmadi K, White S, Timms J, Waterfield MD. Cellular function of phosphoinositide 3-kinases: implications for development, homeostasis, and cancer. Annu Rev Cell Dev Biol 2001;17:615–75.[CrossRef][Medline]
  16. Luo J, Manning BD, Cantley LC. Targeting the PI3K-Akt pathway in human cancer: rationale and promise. Cancer Cell 2003;4:257–62.[CrossRef][Medline]
  17. Zhang L, Yang N, Katsaros D, et al. The oncogene phosphatidylinositol 3'-kinase catalytic subunit {alpha} promotes angiogenesis via vascular endothelial growth factor in ovarian carcinoma. Cancer Res 2003;63:4225–31.[Abstract/Free Full Text]
  18. Vanhaesebroeck B, Leevers SJ, Ahmadi K, et al. Synthesis and function of 3-phosphorylated inositol lipids. Annu Rev Biochem 2001;70:535–602.[CrossRef][Medline]
  19. Shayesteh L, Lu Y, Kuo WL, et al. PIK3CA is implicated as an oncogene in ovarian cancer. Nat Genet 1999;21:99–102.[CrossRef][Medline]
  20. Nakayama K, Nakayama N, Kurman RJ, et al. Sequence mutations and amplification of PIK3CA and AKT2 genes in purified ovarian serous neoplasms. Cancer Biol Ther 2006;5:779–85.[Medline]
  21. Samuels Y, Wang Z, Bardelli A, et al. High frequency of mutations of the PIK3CA gene in human cancers. Science 2004;304:554.[Free Full Text]
  22. Campbell IG, Russell SE, Choong DY, et al. Mutation of the PIK3CA gene in ovarian and breast cancer. Cancer Res 2004;64:7678–81.[Abstract/Free Full Text]
  23. Levine DA, Bogomolniy F, Yee CJ, et al. Frequent mutation of the PIK3CA gene in ovarian and breast cancers. Clin Cancer Res 2005;11:2875–8.[Abstract/Free Full Text]
  24. Mayr D, Kanitz V, Anderegg B, et al. Analysis of gene amplification and prognostic markers in ovarian cancer using comparative genomic hybridization for microarrays and immunohistochemical analysis for tissue microarrays. Am J Clin Pathol 2006;126:101–9.[Abstract/Free Full Text]
  25. Wang Y, Helland A, Holm R, Kristensen GB, Borresen-Dale AL. PIK3CA mutations in advanced ovarian carcinomas. Hum Mutat 2005;25:322.[Medline]
  26. Greshock J, Naylor TL, Margolin A, et al. 1-Mb resolution array-based comparative genomic hybridization using a BAC clone set optimized for cancer gene analysis. Genome Res 2004;14:179–87.[Abstract/Free Full Text]
  27. Zhang L, Huang J, Yang N, et al. microRNAs exhibit high frequency genomic alterations in human cancer. Proc Natl Acad Sci U S A 2006;103:9136–41.[Abstract/Free Full Text]
  28. Roberts D, Schick J, Conway S, et al. Identification of genes associated with platinum drug sensitivity and resistance in human ovarian cancer cells. Br J Cancer 2005;92:1149–58.[CrossRef][Medline]
  29. Zhang L, Yang N, Park JW, et al. Tumor-derived vascular endothelial growth factor up-regulates angiopoietin-2 in host endothelium and destabilizes host vasculature, supporting angiogenesis in ovarian cancer. Cancer Res 2003;63:3403–12.[Abstract/Free Full Text]
  30. Zorn KK, Jazaeri AA, Awtrey CS, et al. Choice of normal ovarian control influences determination of differentially expressed genes in ovarian cancer expression profiling studies. Clin Cancer Res 2003;9:4811–8.[Abstract/Free Full Text]
  31. Maines-Bandiera SL, Kruk PA, Auersperg N. Simian virus 40-transformed human ovarian surface epithelial cells escape normal growth controls but retain morphogenetic responses to extracellular matrix. Am J Obstet Gynecol 1992;167:729–35.[Medline]
  32. Tsao SW, Mok SC, Fey EG, et al. Characterization of human ovarian surface epithelial cells immortalized by human papilloma viral oncogenes (HPV-E6E7 ORFs). Exp Cell Res 1995;218:499–507.[CrossRef][Medline]
  33. Zhang L, Huang J, Yang N, et al. Integrative genomic analysis of protein kinase C (PKC) family identifies PKC{iota} as a biomarker and potential oncogene in ovarian carcinoma. Cancer Res 2006;66:4627–35.[Abstract/Free Full Text]
  34. Chen X, Cheung ST, So S, et al. Gene expression patterns in human liver cancers. Mol Biol Cell 2002;13:1929–39.[Abstract/Free Full Text]
  35. Dhanasekaran SM, Barrette TR, Ghosh D, et al. Delineation of prognostic biomarkers in prostate cancer. Nature 2001;412:822–6.[CrossRef][Medline]
  36. Garber ME, Troyanskaya OG, Schluens K, et al. Diversity of gene expression in adenocarcinoma of the lung. Proc Natl Acad Sci U S A 2001;98:13784–9.[Abstract/Free Full Text]
  37. Iacobuzio-Donahue CA, Maitra A, Olsen M, et al. Exploration of global gene expression patterns in pancreatic adenocarcinoma using cDNA microarrays. Am J Pathol 2003;162:1151–62.[Abstract/Free Full Text]
  38. Ramaswamy S, Tamayo P, Rifkin R, et al. Multiclass cancer diagnosis using tumor gene expression signatures. Proc Natl Acad Sci U S A 2001;98:15149–54.[Abstract/Free Full Text]
  39. Ross DT, Scherf U, Eisen MB, et al. O. Systematic variation in gene expression patterns in human cancer cell lines. Nat Genet 2000;24:227–35.[CrossRef][Medline]
  40. Sorlie T, Perou CM, Tibshirani R, et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci U S A 2001;98:10869–74.[Abstract/Free Full Text]
  41. Su AI, Welsh JB, Sapinoso LM, et al. Molecular classification of human carcinomas by use of gene expression signatures. Cancer Res 2001;61:7388–93.[Abstract/Free Full Text]
  42. Welsh JB, Zarrinkar PP, Sapinoso LM, et al. Analysis of gene expression profiles in normal and neoplastic ovarian tissue samples identifies candidate molecular markers of epithelial ovarian cancer. Proc Natl Acad Sci U S A 2001;98:1176–81.[Abstract/Free Full Text]
  43. Kononen J, Bubendorf L, Kallioniemi A, et al. Tissue microarrays for high-throughput molecular profiling of tumor specimens. Nat Med 1998;4:844–7.[CrossRef][Medline]
  44. Lassus H, Leminen A, Lundin J, Lehtovirta P, Butzow R. Distinct subtypes of serous ovarian carcinoma identified by p53 determination. Gynecol Oncol 2003;91:504–12.[CrossRef][Medline]
  45. Rhodes DR, Yu J, Shanker K, et al. ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia 2004;6:1–6.[Medline]
  46. Rhodes DR, Kalyana-Sundaram S, Mahavisno V, Barrette TR, Ghosh D, Chinnaiyan AM. Mining for regulatory programs in the cancer transcriptome. Nat Genet 2005;37:579–83.[CrossRef][Medline]
  47. Rhodes DR, Chinnaiyan AM. Integrative analysis of the cancer transcriptome. Nat Genet 2005;37 Suppl:S31–7.[CrossRef][Medline]
  48. Segal E, Friedman N, Kaminski N, Regev A, Koller D. From signatures to models: understanding cancer using microarrays. Nat Genet 2005;37 Suppl:S38–45.[CrossRef][Medline]
  49. Bonome T, Lee JY, Park DC, et al. Expression profiling of serous low malignant potential, low-grade, and high-grade tumors of the ovary. Cancer Res 2005;65:10602–12.[Abstract/Free Full Text]
  50. Zhang L, Yang N, Liang S, et al. RNA interference: a potential strategy for isoform-specific phosphatidylinositol 3-kinase targeted therapy in ovarian cancer. Cancer Biol Ther 2004;3:1283–9.[Medline]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
J. Hu, X. Xia, A. Cheng, G. Wang, X. Luo, M. F. Reed, T. Fojo, A. Oetting, J. Gong, and P. M. Yen
A peptide inhibitor derived from p55PIK phosphatidylinositol 3-kinase regulatory subunit: a novel cancer therapy
Mol. Cancer Ther., December 1, 2008; 7(12): 3719 - 3728.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
Y. Shang, Y. Mao, J. Batson, S. J. Scales, G. Phillips, M. R. Lackner, K. Totpal, S. Williams, J. Yang, Z. Tang, et al.
Antixenograft tumor activity of a humanized anti-insulin-like growth factor-I receptor monoclonal antibody is associated with decreased AKT activation and glucose uptake
Mol. Cancer Ther., September 1, 2008; 7(9): 2599 - 2608.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Z. Liu, P. Hou, M. Ji, H. Guan, K. Studeman, K. Jensen, V. Vasko, A. K. El-Naggar, and M. Xing
Highly Prevalent Genetic Alterations in Receptor Tyrosine Kinases and Phosphatidylinositol 3-Kinase/Akt and Mitogen-Activated Protein Kinase Pathways in Anaplastic and Follicular Thyroid Cancers
J. Clin. Endocrinol. Metab., August 1, 2008; 93(8): 3106 - 3116.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. C. Palmer, C.-C. Chan, L. Gattinoni, C. Wrzesinski, C. M. Paulos, C. S. Hinrichs, D. J. Powell Jr., C. A. Klebanoff, S. E. Finkelstein, R. N. Fariss, et al.
From the Cover: Effective tumor treatment targeting a melanoma/melanocyte-associated antigen triggers severe ocular autoimmunity
PNAS, June 10, 2008; 105(23): 8061 - 8066.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, L.
Right arrow Articles by Coukos, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, L.
Right arrow Articles by Coukos, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online