
Clinical Cancer Research 13, 1532-1539, March 1, 2007. doi: 10.1158/1078-0432.CCR-06-1595
© 2007 American Association for Cancer Research
Cancer Therapy: Preclinical |
Combined Treatment with Temozolomide and Methoxyamine: Blocking Apurininc/Pyrimidinic Site Repair Coupled with Targeting Topoisomerase II
Ling Yan,
Alina Bulgar,
Yanling Miao,
Varun Mahajan,
Jon R. Donze,
Stanton L. Gerson and
Lili Liu
Authors' Affiliation: Department of Medicine, Division of Hematology/Oncology, Case Comprehensive Cancer Center, Case Western Reserve University, Cleveland, Ohio
Requests for reprints: Lili Liu, Department of Medicine, Division of Hematology/Oncology, Case Comprehensive Cancer Center, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106. Phone: 216-368-5696; Fax: 216-368-1166; E-mail: lxl32{at}case.edu.
 |
Abstract
|
|---|
Purpose: Methoxyamine has been shown to potentiate the cytotoxic effect of temozolomide both in vitro and in human tumor xenograft models. We postulate that the enhanced cytotoxicity is mediated by methoxyamine-bound apurininc/pyrimidinic (MX-AP) site, a key lesion formed by the combination of temozolomide and methoxyamine. When located within topoisomerase II
(topo II) cleavage sites in DNA, MX-AP sites act as dual lethal targets, not only functionally disrupting the base excision repair (BER) pathway but also potentially poisoning topo II.
Experimental Design: Using oligonucleotide substrates, in which a position-specific MX-AP site is located within topo II cleavage sites, we examined the effect of MX-AP site on both AP endonuclease and topo IImediated DNA cleavage in vitro.
Results: MX-AP sites were refractory to the catalytic activity of AP endonuclease, indicating their ability to block BER. However, they were cleaved by either purified topo II or nuclear extracts from tumor cells expressing high levels of topo II, suggesting that MX-AP sites stimulate topo IImediated DNA cleavages. In cells, treatment with temozolomide and methoxyamine increased the expression of topo II and enriched the formation of
H2AX foci, which were colocalized with up-regulated topo II, confirming that DNA double-strand breaks marked by
H2AX foci are associated with topo II in cells.
Conclusions: Our findings identify a molecular mechanism of cell death whereby MX-AP sites that cumulated in cells due to resistance to BER potentially convert topo II into biotoxins, resulting in enzyme-mediated DNA scission and cell death.
Topoisomerase II
(topo II) is an essential enzyme that plays a critical role in many DNA processes, including DNA replication/recombination and chromosome segregation. To carry out its important physiologic functions, topo II alters DNA topology by passing an intact double helix through a transient double-stranded break in the genetic material. Thus, whereas the enzyme is necessary for cell survival, it also has the capacity to fragment the genome (13). During the double-stranded DNA passage reaction, topo II has preferential cleavage sites in the DNA. Its two active sites (tyrosyl residues) covalently bind to a 5'-phosphoryl group on each DNA strand, forming a topo IIcleavable DNA complex (4). Normally, these cleavage complexes are present at low levels and can be tolerated by cells. However, conditions that significantly increase the physiologic concentration of this cleavage complex, such as the action of topo II poisons, will convert this physiologic process to a lethal toxicity (5, 6). Therefore, topo II has been identified as the molecular target for a variety of toxic agents that have proved lethal by enhancing topo IImediated DNA strand breaks (7, 8). Recent evidence indicates that many DNA lesions, such as abasic sites [apurininc/pyrimidinic (AP) sites], nicks, or smaller adducts, also act as topo II poisons. Of the lesions examined to date, AP sites seem to be the most active (913). When AP sites are located within topo II cleavage sites, they remarkably stimulate topo IImediated DNA fragmentation (9, 13). Therefore, AP sites are potentially lethal.
AP sites are the most common damage induced by alkylating therapeutic agents and formed as a consequence of removal of modified bases by DNA N-glycosylases. For instance, temozolomide, a therapeutic methylating agent, forms O6-methylguanine, 7-methylguanine, and 3-methyladenine DNA adducts. These DNA lesions are repaired by at least two mechanisms. The O6-methylguanine DNA adduct, a cytotoxic and genotoxic lesion, is repaired by O6-methylguanine DNA-methyltransferase. Thus, O6-methylguanine DNA-methyltransferase is a major mechanism of resistance to methylating agents. Cell death caused by O6-methylguanine adducts is promoted by the mismatch repair system, such that the activity of mismatch repair is an important determinant of cell sensitivity to methylating agents (14). 7-Methylguanine and 3-methyladenine DNA adducts are repaired by base excision repair (BER). These inappropriate bases are removed by DNA glycosylases, generating AP sites in double-stranded DNA. AP sites, the toxic intermediates of BER, are subsequently recognized by AP endonucleases that incise the phosphodiester backbone immediately 5' to the lesion, leaving behind a strand break with a normal 3'-hydroxyl group and an abnormal 5'-abasic terminus. "Short-patch" BER proceeds with DNA polymerase ß removing the 5'-abasic residue via its 5'-deoxyribose-phosphodiesterase activity and filling in the single nucleotide gap. To complete the process, DNA ligase I or a complex of XRCC1 and ligase III seals the nick (15). The cellular BER pathway is rapid and efficient, thus contributing to resistance to the therapeutic killing effect of temozolomide.
We have previously shown that blockage of BER by methoxyamine improves the therapeutic efficacy of alkylating agents (1620). Methoxyamine covalently binds to AP sites (2123) to form methoxyamine-bound AP (MX-AP) sites, which are structurally modified AP sites. These MX-AP sites are resistant to the recognition and repair by AP endonuclease, and the persistence of the lesions leads to cell death. In xenograft studies, methoxyamine efficiently enhanced antitumor effect of temozolomide in several colon cancer cell lines regardless of genetic status such as O6-methylguanine DNA-methyltransferase, mismatch repair, and p53 (19, 20). Compared with temozolomide alone, the combination of temozolomide and methoxyamine had no demonstrable additive toxicity in nude mice carrying human tumor xenografts. The inhibition of tumor growth was associated with remarkable apoptotic death and severe chromosome aberrations in xenograft tumors after mice received the treatments with temozolomide and methoxyamine (19). Importantly, the extremely high frequencies of chromosome breakages were visible at metaphase (19), indicating that DNA cleavages occur during DNA replication or transcription, an effect of topo II poison. Because MX-AP sites are considered to be the major lesions produced by the combination of temozolomide and methoxyamine, they are probably responsible for inducing DNA breakages through poisoning of topo II. To test this hypothesis, we studied the correlation of the formation of MX-AP sites and topo IImediated cleavages to characterize the nature of cell death induced by the combined treatment with temozolomide and methoxyamine. Our results show that MX-AP sites target topo II, acting as topo II poison, and stimulate topo IImediated DNA double-strand breaks, leading to cell death. The specificity of such a detrimental action on topo II by MX-AP sites may be valuable in selectively targeting and destroying tumor cells, thus efficiently improving the therapeutic index of temozolomide.
 |
Materials and Methods
|
|---|
Preparation of oligonucleotides. A HEX-labeled 40-base nucleotide containing a deoxyuridine residue at the +2 position of topo II cleavage sites (underline) and its complement labeled with Cy5 were synthesized by Operon Biotechnologies (Huntsville, AL). The sequences of the top and bottom strands were (24) [5HEX]ACGGTGCCGAGGATGACGATG
AUCGCATTGTTAGATTTCA-3' (top) and [5Cy5]TGAAATCTAACAATG
CGCTCATCGTCATCCTCGGCACCGT-3' (bottom). The arrows denote the points of topo IImediated DNA cleavage.
Preparation of oligonucleotide substrates containing AP sites and MX-AP sites. To generate AP sites, double-stranded oligonucleotides containing uracil bases (10 pmol) were reacted with 2 units of uracil-DNA glycosylase at 37°C for 30 min in a reaction volume of 20 µL containing 70 mmol/L HEPES-HCl (pH 7.4), 0.5 mmol/L EDTA, 0.2 mmol/L DTT, and 8.75% glycerol. The resulting AP sites were then incubated with 50 mmol/L methoxyamine in a buffer containing 50 mmol/L KPO4 (pH 7.0) at 37°C for 30 min to generate MX-AP sites. The produced AP sites and MX-AP sites through this procedure represent the typical types of DNA lesions induced by temozolomide alone and temozolomide plus methoxyamine, respectively (diagram of substrate preparation is shown in Fig. 1B
). The oligonucleotide substrates were recovered by ethanol precipitation in presence of 0.1 µg/mL tRNA, lyophilized, and resuspended in H2O for either AP endonuclease or topo II cleavage assay.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 1. MX-AP sites block AP endonuclease repair but stimulate topo IImediated cleavage. A, colon cancer cells (SW480) were treated with temozolomide alone (TMZ; 0-750 µmol/L) or temozolomide plus methoxyamine (TMZ + MX; 25 mmol/L) for 2 h. DNA was extracted and AP sites were measured with aldehyde reactive probe reagent. B, schematic diagram indicates the preparation of a position-specific oligonucleotide substrate containing an AP site or an MX-AP site. C, a, cleavage of AP sites or MX-AP sites by purified AP endonuclease (APE). b, cleavage of MX-AP sites by nuclear extracts from tumor cells. The cleaved products were obtained after nucleotide substrates containing MX-AP sites that were located within topo II cleavage sites were incubated with nuclear extracts (0-50 µg; lanes 4-7). c, cleavage of AP sites by nuclear extracts from tumor cells. The cleaved products were obtained after nucleotide substrates containing AP sites that were located within topo II cleavage sites were incubated with nuclear extracts (0-5 µg; lanes 2-6). Representative of at least three independent experiments.
|
|
The measurement of cleavage activity of topo II or AP endonuclease. The reaction of DNA cleavage mediated by topo II (U.S. Biochemical Corp., Cleveland, OH) was done with 10 units of topo II and 10 pmol of oligonucleotides containing either AP sites or MX-AP sites that are specifically located within topo II cleavage sites. Reactions were done in 20 µL of reaction buffer [10 mmol/L Tris-HCl (pH 7.9), 50 mmol/L NaCl, 50 mmol/L MgCl2, 1 mmol/L EDTA, 15 µg/mL bovine serum albumin, 1 mmol/L ATP] at 37°C for 30 min and were stopped by the addition of 2 µL of 250 mmol/L EDTA. Proteinase K (2 µL of a 1 mg/mL solution) was added and topo II was digested for 45 min at 45°C. Ten microliters of loading buffer (300 mmol/L NaOH, 97% formamide, and 0.2% bromophenol blue) were added and reaction mixtures were heated to 95°C for 5 min and then cooled at 4°C. Alternatively, an equal amount of oligonucleotide substrates (10 pmol) was incubated with AP endonuclease (2 units) or nuclear extracts at 37°C for 30 min. Cleavage products were resolved by 20% polyacrylamide gel containing 8 mol/L urea in 89 mmol/L boric acid and 2 mmol/L EDTA (pH 8.8). Following electrophoresis, the fluorescent reaction products were visualized and scanned with fluorescence imager Typhoon 9200 (Amersham BioScience, Piscataway, NJ).
AP sites measured by aldehyde reactive probe. AP site assay was done with aldehyde reactive probe reagent (Dojindo Molecular Technologies, Inc., Gaithersburg, MD) as previously described (20). Briefly, DNA (15 µg) extracted from cells with or without drug treatment was incubated with 1 mmol/L aldehyde reactive probe at 37°C for 10 min. After precipitation with 100% ethanol, DNA was washed and resuspended in Tris-EDTA buffer [10 mmol/L Tris-HCl, 1 mmol/L EDTA (pH 7.2)]. DNA was heat denatured at 100°C for 5 min, quickly chilled on ice, and mixed with an equal amount of ammonium acetate (2 mol/L). The ssDNA was then immobilized on a BAS-85 NC membrane (Schleicher & Schuell, Dassel, Germany) using a vacuum filter device (Schleicher & Schuell). The NC membrane was incubated with streptavidin-conjugated horseradish peroxidase (BioGenix, San Ramon, CA) at room temperature for 30 min. After NC membrane was rinsed with washing buffer containing NaCl (0.26 M), EDTA (1 mmol/L), Tris-HCl (20 mmol/L), and Tween 20 (1%), aldehyde reactive probe-AP sites were visualized with enhanced chemiluminescence reagents (Amersham).
Topo II
small interfering RNA. Both topo II and control small interfering RNAs (siRNA) were purchased from Dharmacon, Inc. (Chicago, IL). The sense strand of the siRNA duplex used to target topo II was 5'-CAAAGAUAUUGUUGCACUA-3'. Transfection of topo II siRNA to SW480 and DLD1 cells was done using Oligofectamine. In brief, cells were plated on a 24-well dish. The siRNA mixtures containing 225-µL Opti-MEM medium (Life Technologies, Gaithersburg, MD), 5-µL Oligofectamine (Invitrogen, Carlsbad, CA), and 20-µL siRNA (0.8-2.0 nmol) were incubated for 10 min at room temperature and then added to cells. Five hours after addition of the siRNA mixtures, cell culture medium (500 µL) was added to the cells. Cells were incubated and harvested for 3 consecutive days and topo II protein levels were checked by Western blotting assay.
Western blot analysis. The cells were lysed in lysis buffer (25 mmol/L HEPES, 1.5% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.5 mol/L NaCl, 5 mmol/L NaF, 0.1 mmol/L sodium vanadate, 1 mmol/L phenylmethylsulfonyl fluoride, and 0.1 mg/mL leupeptin) at 4°C with sonication. The proteins in lysates were separated by electrophoresis on a SDS-polyacrylamide gel. Proteins were transferred to Immobilon-P transfer membrane (Millipore Corp., Billerica, MA) and immunoblotted with appropriate antibodies under conditions recommended by the manufacturer. Detection was done with the enhanced chemiluminescence reagent (NEN life Science Products, Boston, MA). The antibodies against topo I or topo II for immunoblotting were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
Annexin V staining. The presence of apoptotic cells was evaluated by Annexin V staining. At 24 h after exposure to the drugs, the cells were harvested by incubation with trypsin/EDTA [0.025%/0.01% (w/v)]. After two washes with PBS, the cells were resuspended in 1x binding buffer at a concentration of 1 x 106/mL. Cells (1 x 105/100 µL) were exposed at room temperature for 15 min to 5-µL Annexin V-phycoerythrin and 5-µL 7-amino-actinomycin D (BD Biosciences, San Jose, CA) following the instructions of the manufacturer. Analysis was carried out with FACSort (Becton Dickinson & Co., Mountain View, CA).
Immunofluorescence microscopy. Cells were grown on coverslips and treated with methoxyamine plus temozolomide or each drug alone for 24, 48, and 72 h. Both treated and untreated cells were fixed in 2% paraformaldehyde and permeabilized with 0.2% Triton X-100. Cells were incubated with primary antibodies
H2AX (Upstate Biotechnology, Charlottesville, VA) or topo II (Santa Cruz Biotechnology), followed by secondary antibodies conjugated to Alexa 488 (green) or Alexa 633 (red), respectively (Molecular Probes, Carlsbad, CA). Images were digitally captured using an Olympus microscope equipped with a digital camera.
Clonogenic survival assay. Cells (2,000 per dish) were plated and treated with different drugs according to experimental protocol. After treatment, cells were washed and cultured with fresh medium for 10 to 12 days. The survived colonies were stained with methylene blue for determination of colonies containing >50 cells.
 |
Results
|
|---|
MX-AP sites stimulate topo IImediated DNA cleavage in vitro when located within topo II cleavage sites. Given the reaction of methoxyamine with AP sites (i.e., the binding of methoxyamine to the aldehyde group of the AP site; refs. 19, 21, 22), we measured AP sites produced by temozolomide and reduced by methoxyamine using an aldehyde reactive probe reagent. Because the aldehyde reactive probe and methoxyamine have a similar reactivity with aldehyde group in AP sites (25, 26), they competitively bind to AP sites in DNA. Therefore, aldehyde reactive probe only detects free AP sites but not MX-AP sites. As shown in Fig. 1A, AP sites in DNA increased proportionally to the concentrations of temozolomide used in SW480 colon cancer cells. Cotreatment with methoxyamine (25 mmol/L) reduced the numbers of AP sites, indicating that the binding of methoxyamine to the AP sites makes them unavailable for aldehyde reactive probe. Thus, based on the values of AP sites generated by temozolomide, the numbers of MX-AP sites could be estimated at each concentration point by the following equation: MX-AP sites (arbitrary units) = (AP sites detected in cells treated with temozolomide only) (AP sites detected in cells treated with temozolomide + methoxyamine). The numbers of MX-AP sites displayed a linear relationship (r = 0.995) with temozolomide concentrations (Fig. 1A). We then examined in vitro the cleavage activity of both purified human AP endonuclease and topo II using the oligonucleotide substrates containing either AP or MX-AP sites that were located within the topo II cleavage sites (shown in Fig. 1B). As shown in Fig. 1C(a), the incubation of AP sites with AP endonuclease resulted in a 20-mer fragment. In contrast, the MX-AP sites were refractory to the AP endonuclease incision. However, both AP and MX-AP sites were cleaved by purified human topo II protein and nuclear extractions from SW480 cells that express high levels of topo II protein. The levels of cleaved products were quantitated with Typhoon 9200 fluorescent imager, showing a proportional increase (r = 0.877) with the concentrations of nuclear extraction [Fig. 1C(b)]. The image of cleaved fragments was apparently diminished when etoposide (200 µmol/L) was used to inhibit topo II before the reaction, indicating that the cleavage activity is directly related to the levels of topo II. In contrast, AP sites were much more efficiently cleaved by the nuclear extracts from the same cells [Fig. 1C(c)] because AP sites are cleaved by AP endonuclease as well. These results confirmed our hypotheses that (a) MX-AP sites are refractory to the repair by AP endonuclease, thus they have the ability to block the BER pathway; and (b) MX-AP sites located within topo II cleavage sites have the potential to induce topo IImediated DNA scission.
Induction of topo II is associated with increase in
H2AX, a marker of DNA double-strand breaks, in tumor cells treated with methoxyamine and temozolomide. The drug-related induction of topo II was detected by Western blotting analysis (Fig. 2A
). Prolonged induction of topo II was seen in all three tested colon cancer cell lines over a period of 72 h after a 2-h treatment with temozolomide plus methoxyamine, compared with a transient induction of topo II by temozolomide alone. In contrast, topo I levels remained consistent in cells before and after treatments, suggesting that the combination of temozolomide and methoxyamine specifically targets topo II, presumably by MX-AP sites, which are the major lesions produced by the combination. We then examined the relationship of induced topo II with the production of DNA double-strand breaks marked by
H2AX in cells with or without drug treatments. To do this experiment, nuclear extracts from DLD1 cells treated either with temozolomide or methoxyamine alone or the combination of two drugs were incubated with oligonucleotide substrates containing MX-AP sites. As shown in Fig. 2B, the equal amounts of nuclear extracts (20 µg) were incubated with MX-AP substrates (10 pmol), resulting in variable levels of cleaved products. The fluorescent density of cleaved fragments in untreated cells was determined as arbitrary unit 1, which was used to compare with the cleavages detected in cells treated with either temozolomide alone (with IC50 of 1,500 µmol/L for 2 h) or the combination of temozolomide and methoxyamine (12.5 mmol/L). Results showed that the increase in cleavages was 1.9 ± 0.3-fold and 3.2 ± 0.9-fold higher in cells treated with temozolomide alone or in combination with methoxyamine, respectively. The same cell lysates were then subjected to Western blotting assay (Fig. 2C), showing that protein levels of topo II and
H2AX were concomitantly up-regulated in cells treated with either temozolomide or temozolomide plus methoxyamine. Because
H2AX is well known as a marker of DNA double-strand breaks, increased level of
H2AX represents the augmentation of DNA double-strand breaks. Similarly, immunofluorescence staining revealed that the combination of temozolomide and methoxyamine induced the expression of topo II and highly enriched the formation of
H2AX foci. They were colocalized with each other in SW480 cells (Fig. 2D). This suggests that the induced DNA double-strand breaks and topo II are related to MX-AP sites produced by the combined treatment. It was noted that temozolomide alone also induced up-regulation of topo II and increased the levels of
H2AX in in vitro assay and in cells. This indicates that AP sites formed by temozolomide also induce topo IImediated DNA double-strand breaks, but with less potency compared with MX-AP sites.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 2. Induction of topo II results in an increase in DNA cleavage in cells treated with temozolomide and methoxyamine. A, comparison of topo II and topo I protein levels in cells after treatments. Each cell line was treated with temozolomide plus methoxyamine or drug alone: methoxyamine 12 mmol/L, temozolomide at IC50 concentrations of each cell line: 375 µmol/L (SW480 cells), 750 µmol/L (HCT116 cells), and 1,500 µmol/L (DLD1 cells). Cells were treated with drugs for 2 h and collected at 24, 48, and 72 h after treatment. B, topo II cleavage activity. Using oligonucleotide substrates containing MX-AP sites located within topo II cleavage sites, topo IImediated cleavages were determined in cell extracts from cells treated with different drugs for 2 h and collected 48 h after treatment. Lane 1, oligosubstrates only (10 pmol); lanes 2 to 5, nuclear extracts (20 µg) from untreated cells (C), cells treated with temozolomide alone, cells treated with temozolomide and methoxyamine (T + M), and cells treated with methoxyamine alone. Representative of five independent experiments. C, elevated levels of both topo II and H2AX protein in cells treated with temozolomide alone or the combination of temozolomide and methoxyamine (the aliquots of the samples used in B). D, colocalization of H2AX foci and topo II in cells treated with temozolomide alone or temozolomide plus methoxyamine. SW480 cells were treated with temozolomide 375 µmol/L (IC50 concentrations) or temozolomide plus methoxyamine (12 mmol/L) for 2 h. Cells were stained with antibodies H2AX (green) and topo II (red), respectively, 24 h after treatment.
|
|
To further determine whether the cytotoxic effect induced by the combination of temozolomide and methoxyamine was a topo II poison-like effect, experiments with etoposide, a topo II inhibitor, were next performed. It was evident that cellular topo II proteins were significantly elevated 24 h after etoposide (2-h treatment with 10 µmol/L) and remained high up to 72 h (Fig. 3A
). At 24 h after the treatment, formation of
H2AX foci was observed in 53 ± 23% of the cells (Fig. 3B) and was colocalized with topo II. To define the relation between the levels of topo II and the cell killing effect, targeted knockdown by siRNA of topo II expression was done in SW480 and confirmed that at least 70% of the protein was reduced (Fig. 4A
). Clonogenic survival formation assay showed that, compared with cells transfected with control siRNA (Fig. 4B), topo II siRNA cells displayed an increased resistance to etoposide, with 2-fold higher IC50 values (5.1 ± 1.3 µmol/L in topo II siRNA cell versus 2.5 ± 0.7 in control siRNA cells). We additionally examined whether the down-regulation of topo II would also influence the cytotoxicity induced by the combination of temozolomide and methoxyamine in these cells. As shown in Fig. 4C, after treatment with 350 µmol/L temozolomide alone (the IC50 concentrations) or temozolomide plus methoxyamine (12.5 mmol/L) for 2 h, topo II siRNA cells showed a moderate resistance to temozolomide alone but a significant reduction of the potentiation of temozolomide by methoxyamine (P < 0.05). To further determine the correlation of the cellular levels of topo II and cell death induced by the combination of temozolomide and methoxyamine, a similar experiment was done using DLD1 colon cancer cell line. DLD1 cells are defective in mismatch repair and p53 and are highly resistant to temozolomide. Annexin V staining (Fig. 5B
), an assay used to detect apoptotic cells, showed that, compared with parental DLD1 cells, the suppression of topo II by topo II siRNA (Fig. 5A) resulted in a remarkable reduction of apoptotic cells induced by temozolomide plus methoxyamine. In contrast, the treatment with temozolomide only produced similar levels of apoptotic cells in parental and topo II siRNA DLD1 cells (Fig. 5B). Although a relatively higher percentage of Annexin Vpositive cells was seen in cells transfected with control siRNA both with and without treatment, which is probably related to the effect of nucleotide transfection, much higher apoptotic cell populations were observed in cells treated with the combination of temozolomide and methoxyamine. Taken together, increased drug resistance in topo II siRNA cells is indicative of the fact that the levels of topo II determine the potential of cell killing by this combined treatment.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 4. Increased resistance to etoposide or temozolomide plus methoxyamine is observed in SW480 topo II siRNA cells. A, SW480 topo II siRNA cells showed that 70% of topo II proteins were knocked down compared with cells without or with control siRNA. B, topo II siRNA cells were more resistant to etoposide (*, P < 0.05). C, reduced sensitivity to the combination of temozolomide and methoxyamine was observed in topo II siRNA cells in comparison with cells transfected with control siRNA (*, P < 0.05).
|
|

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 5. Topo II is required for the induction of apoptotic death induced by the treatment with temozolomide plus methoxyamine. A, decrease in topo II protein levels by topo II siRNA in DLD1 cells. B, comparison of the production of Annexin Vpositive cells by temozolomide and methoxyamine in DLD1 with different levels of topo II. Representative of three independent experiments.
|
|
Topo IImediated cytotoxicity selectively kills highly proliferating tumor cells. We previously reported that in xenograft models, treatment with temozolomide plus methoxyamine enhanced antitumor effects without additive systemic toxicity, compared with the temozolomide alone (19). To examine whether the differential expression of topo II between tumor cells and normal bone marrow cells leads to selective toxicity toward tumor cells or relatively protects normal bone marrow cells from the killing effect, the levels of topo II protein were compared between tumor and bone marrow cells. Results showed that topo II proteins in both mouse and human bone marrow cells were hardly detectable,
20-fold lower than that detected in human tumor cells (Fig. 6A
). Clonogenic survival assay revealed that tumor cells were sensitive to the combination of temozolomide and methoxyamine. Methoxyamine enhanced temozolomide cytotoxicity by 4-fold in SW480 cells (IC50 values were reduced from 350 ± 17.9 to 84 ± 7.8 µmol/L; P < 0.05; Fig. 6B). However, it failed to potentiate temozolomide in both mouse and human bone marrow cells (Fig. 6C and D). Thus, these data indicate that low levels of topo II relatively protect bone marrow cells from the potentiated cytotoxicity. Thus, topo II is one of factors required for the manifestation of the cytotoxicity induced by the combination of temozolomide and methoxyamine.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 6. The sensitivity to the combined treatment with temozolomide and methoxyamine in bone marrow cells. A, comparison of the levels of topo II between human tumor cells and bone marrow cells. B to D, comparison of the cytotoxicities induced by temozolomide alone and the combination of temozolomide and methoxyamine in tumor or bone marrow cells assayed by clonogenic formation: B, SW480, human colon cancer cells (*, P < 0.05 compared with the treatment with temozolomide alone); C, human bone marrow cells; D, mouse bone marrow cells.
|
|
 |
Discussion
|
|---|
BER is an important drug resistant factor because of the variety of its substrates and its ability to rapidly and efficiently repair DNA lesions (27, 28). Repair of AP sites is the primary defense system. It has been shown that in the BER pathway, the repair of an AP site proceeds much more quickly than the repair of a single base such as a uracil or an 8-oxoguanine base (28). Thus, the effect of AP sites on cell death is minimal in the presence of efficient BER. Although AP sites potentially act as topo II poisons (9, 11), it is apparent that topo II cannot compete successfully against the BER machinery for the processed the DNA lesions. Therefore, only when the BER pathway is interrupted, nonrepaired AP sites become toxic (29, 30).
Methoxyamine has previously been studied as a structural modulator of AP sites that enhances the therapeutic effect of alkylating agents, such as temozolomide, through its ability to block the repair of AP sites formed by temozolomide (19, 20). In present studies, we show that the lethal toxicity induced by temozolomide plus methoxyamine is mediated through the MX-AP site coupled with the poisoning effect of topo II in cells. First, the prolonged induction of topo II but not topo I in cells treated with temozolomide and methoxyamine was predominant, suggesting that topo II is a specific target for this combination. The underlying mechanism of induction of topo II in response to temozolomide and methoxyamine is presently unclear; possible explanations for making this observation relevant include (a) MX-AP sites act as topo II poison to trap topo II in cleavage complex that would decrease functional activities of topo II, resulting in a toxic complementary induction of topo II; (b) topo II plays a major role in DNA replication and chromosome segregation. When MX-AP sites are present, they block DNA replication or interfere with chromosome decatenation (19), leading to a DNA damageinitiated up-regulation of topo II. Second, MX-AP sites promote topo IImediated DNA strand breaks. The use of oligonucleotide substrates containing a position-specific AP site or an MX-AP site within topo II cleavage sites showed in vitro that MX-AP sites were refractory to the accessory activities of human AP endonuclease but cleaved by topo II. In cells, treatments with temozolomide and methoxyamine enriched
-H2AX foci that were colocalized with topo II proteins, suggesting that the topo IImediated DNA double-strand breaks are caused by MX-AP sites coupled to topo II poison that trap and stabilize the enzyme in a DNA cleavable complex. Third, an etoposide-like killing effect is observed in cells treated with the combination of temozolomide and methoxyamine, typically interacting with both DNA and topo II protein to form a stable cleavable complex. In this case, the topo II molecule becomes permanently linked to the DNA molecule and the topo IImediated DNA break is never relegated. The toxic induction of topo II and the enhancement of topo IImediated DNA cleavage were observed in both treatments of etoposide and the combination of temozolomide and methoxyamine, suggesting that they share the same mechanism in cytotoxicity, by which the cell killing effect not just requires but also is correlated with levels of topo II in cells.
It has been suggested that the number of topo II poisons needed to convert the topoisomerase molecule into a DNA damaging agent is a stoichiometric relationship. Each poison molecule has the potential of interaction with one topoisomerase molecule to cause one DNA double-strand break (31). Thus, sensitivity to the topo II poison is dependent on the levels of enzyme. For example, small-cell lung cancers (32) and testicular seminomas (33), known to be sensitive to the topo II drug etoposide, contain high levels of topo II. In contrast, renal cell carcinomas (34) and chronic lymphocytic leukemia (35), generally resistant to topo II targeted drugs, do not contain high amounts of the enzyme. In addition, breast cancer cells, resistant to etoposide, can be made sensitive by the overexpression of human topo II (36). By comparing topo II expression, it seems to be greatest in malignant and aggressive cancers (34, 3740) because such tumors are composed of an abundant population of proliferating cells. Therefore, temozolomide- and methoxyamine-induced topo II targetbased therapy involves quantitative differences between cells expressing different levels of topo II, presumably showing therapeutic selectivity toward tumor cells (4143). In contrast, normal tissues with lower levels of topo II may be relatively protected, as seems to be the case with bone marrow cells.
 |
Footnotes
|
|---|
Grant support: National Cancer Institute grants CA86357, CA82292, and CA43703.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 6/30/06;
revised 11/ 3/06;
accepted 12/22/06.
 |
References
|
|---|
- Wang JC. DNA topoisomerases. Annu Rev Biochem 1985;54:66597.[CrossRef][Medline]
- Watt PM, Hickson ID. Structure and function of type II DNA topoisomerases. Biochem J 1994;303:68195.
- Champoux JJ. DNA topoisomerases: structure, function, and mechanism. Annu Rev Biochem 2001;70:369413.[CrossRef][Medline]
- Zecheidrich EL, Christiansen K, Anni H, Westergaard O, Osheroff N. Double-stranded DNA cleavage/relegation reaction of eukaryotic topoisomerase II: evidence for a nicked DNA intermediate. Biochemistry 1989;28:622936.[CrossRef][Medline]
- Burden DA, Kingma PS, Froelich-Ammon SJ, et al. Topoisomerase II-etoposide interactions direct the formation of drug-induced enzyme-DNA cleavage complexes. J Biol Chem 1996;271:2923844.[Abstract/Free Full Text]
- Wilstermann AM, Osheroff N. Stabilization of eukaryotic topoisomerase II-DNA cleavage complexes. Curr Top Med Chem 2003;3:32138.[CrossRef][Medline]
- Burden DA, Osheroff N. Mechanism of action of eukaryotic topoisomerase II and drugs targeted to the enzyme. Biochim Biophys Acta 1998;1400:13954.[Medline]
- Fortune JM, Osheroff N. Topoisomerase II as a target for anticancer drugs: when enzymes stop being nice. Prog Nucleic Acid Res Mol Biol 2000;64:22153.[Medline]
- Kingma PS, Corbett AH, Burcham PC, Marnett LJ, Osheroff N. Abasic sites stimulate double-stranded DNA cleavage mediated by topoisomerase II: anticancer drugs mimic endogenous DNA lesions. J Biol Chem 1995;270:214414.[Abstract/Free Full Text]
- Bigioni M, Zunino F, Tinelli S, Austin CA, Willmore E, Caparanico G. Position-specific effects of base mismatch on mammalian toposomerase II-DNA cleaving activity. Biochemistry 1996;35:1539.[CrossRef][Medline]
- Kingma PS, Osheroff N. Apurinic sites are position-specific topoisomerase II-poisons. J Biol Chem 1997;272:114855.[Abstract/Free Full Text]
- Kingma PS, Osheroff N. Spontaneous DNA damage stimulates topoisomerase II-mediated DNA cleavage. J Biol Chem 1997;272:748893.[Abstract/Free Full Text]
- Sabourin M, Osheroff N. Sensitivity of human type II toposiomerases to DNA damage: stimulation of enzyme-mediated DNA cleavage by abasic, oxidized and alkylated lesions. Nucleic Acids Res 2000;28:194754.[Abstract/Free Full Text]
- Srivastava DK, Vande Beg BJ, Prasad R, et al. Mammalian abasic site base excision repair. J Biol Chem 1998;273:212039.[Abstract/Free Full Text]
- Liu L, Markowitz S, Gerson SL. Mismatch repair mutator phenotype overrides alkyltransferase in conferring resistance to temozolomide but not to 1,3-bis(2-chloroethyl) nitrosourea. Cancer Res 1996;56:53759.[Abstract/Free Full Text]
- Liu L, Gerson SL. Therapeutic impact of methoxyamine: blocking repair of abasic sites in the base excision repair pathway. Curr Opin Inves Drug 2004;5:62367.
- Liu L, Taverna P, Whitacre CM, Chatterjee S, Gerson SL. Pharmacologic disruption of base excision repair sensitizes mismatch repair deficient and proficient colon cancer cells to methylating agents. Clin Cancer Res 1999;5:290817.[Abstract/Free Full Text]
- Taverna P, Liu L, Hwang H-S, Hanson AJ, Kinsella TJ, Gerson SL. Methoxyamine potentiates DNA single strand breaks and double strand breaks induced by temozolomide in colon cancer cells. Mutat Res 2001;485:26981.[Medline]
- Liu L, Nakatsuru Y, Gerson SL. Base excision repair as a therapeutic target in colon cancer. Clin Cancer Res 2002;8:298599.[Abstract/Free Full Text]
- Liu L, Yan L, Donze JR, Gerson SL. Blockage of abasic site repair enhances antitumor efficacy of BCNU in colon tumor xenografts. Mol Cancer Ther 2003;2:106178.[Abstract/Free Full Text]
- Liuzzi M, Talpeart-Borle M. A new approach to the study of the base-excision repair pathway using methoxyamine. J Biol Chem 1985;260:52528.[Abstract/Free Full Text]
- Rosa S, Fortini P, Bignami M, Dogliotti E. Processing in vitro of an abasic site reacted with methoxyamine: a new assay for the detection of abasic sites formed in vivo. Nucleic Acids Res 1991;19:556974.[Abstract/Free Full Text]
- Horton JK, Prasad R, Hou E, Wilson SH. Protection against methylation-induced cytotoxicity by DNA polymerase ß-dependent long patch base excision repair. J Biol Chem 2000;275:22118.[Abstract/Free Full Text]
- Wilstermann AM, Osheroff N. Base excision repair intermediates as topoisomerase II poisons. J Biol Chem 2001;276:462906.[Abstract/Free Full Text]
- Nakamura J, Walker VE, Upton PB, Chiang S-Y, Kow YW, Swenberg JA. Highly sensitive apurinic/apyrimidinic site assay can detect spontaneous and chemically induced depurination under physiological conditions. Cancer Res 1998;58:2225.[Abstract/Free Full Text]
- Atamna H, Cheung I, Ames BN. A method for detecting abasic sites in living cells: age-dependent changes in base excision repair. Proc Natl Acad Sci U S A 2000;97:68691.[Abstract/Free Full Text]
- Krokan HE, Standal R, Slupphaug G. DNA glycosylases in the base excision repair of DNA. Biochem J 1997;325:116.
- Boiteux S, Guillet M. Abasic sites in DNA: repair and biological consequences in Saccharomyces cerevisiae. DNA Repair 2004;3:112.[CrossRef][Medline]
- Loeb LA. Apurinic sites as mutagenic intermediates. Cell 1985;40:4834.[CrossRef][Medline]
- Zhou W, Doetsch PW. Effects of abasic sites and DNA single-strand breaks on prokaryotic RNA polymerases. Proc Natl Acad Sci U S A 1993;90:66015.[Abstract/Free Full Text]
- Pommier Y, Kerrigan D, Schwartz RE, Swack JA, McCurdy A. Altered DNA topoisomerase II activity in Chinese hamster cells resistant to topoisomerase II inhibitors. Cancer Res 1986;46:307581.[Abstract/Free Full Text]
- Guinee DG, Holden JA, Benfield JR, et al. Comparison of DNA topoisomerase II
expression in small cell and nonsmall cell carcinoma of the lung. In search of a mechanism of chemotherapeutic response. Cancer 1996;78:729.[CrossRef][Medline] - Coleman LW, Perkins SL, Bronstein IB, Holden JA. Expression of DNA toposiomerase I and DNA topoisomerase II-
in testicular seminomas. Hum Pathol 2000;31:728.[CrossRef][Medline] - Gupta D, Bronstein IB, Holden JA. Expression of DNA topoisomerase I in neoplasms of the kidney: correlation with histological grade, proliferation, and patient survival. Hum Pathol 2000;31:214.[CrossRef][Medline]
- Potmesil M, Hsiang Y, Liu LF, et al. Resistance of human leukemic and normal lymphocytes to drug-induced DNA cleavage and low levels of DNA topoisomerase II. Cancer Res 1988;48:353748.[Abstract/Free Full Text]
- Zhou Z, Zwelling LA, Kawakami Y, et al. Adenovirus-mediated human topoisomerase II
gene transfer increases the sensitivity of etoposide-resistant human breast cancer cells. Cancer Res 1999;59:461824.[Abstract/Free Full Text] - Lynch BJ, Holden JA, Buys SS, Neuhausen SL, Gaffney DK. Pathobiologic characteristics of hereditary breast cancer. Hum Pathol 1998;29:1140.[CrossRef][Medline]
- Stathopoulos GP, Kapranos N, Manolopoulos L, Papadimitriou C, Adamopoulos G. Topoisomerase II
expression in squamous cell carcinomas of the head and neck. Anticancer Res 2000;20:177.[Medline] - Holden JA, Perkins SL, Snow GW, Kjeldsberg CR. Immunohistochemical staining for DNA topoisomerase II in non-Hodgkin's lymphomas. Am J Clin Pathol 1995;104:54.[Medline]
- Holden JA, Townsend JJ. DNA topoisomerase II-
as a proliferation marker in astrocytic neoplasms of the central nervous system: correlation with MIB1 expression and patient survival. Mod Pathol 1999;12:1094100.[Medline] - Sullivan DM, Latham MD, Ross WE. Proliferation-dependent topoisomerase II content as a determinant of antineoplastic drug action in human, mouse, and Chinese hamster ovary cells. Cancer Res 1987;47:39739.[Abstract/Free Full Text]
- Hsiang YH, Wu HY, Liu LF. Proliferation-dependent regulation of DNA toposiomerase II in cultured human cells. Cancer Res 1988;48:32305.[Abstract/Free Full Text]
- Sabourin M, Osheroff N. Sensitivity of human type II topoisomerases to DNA damage: stimulation of enzyme-mediated DNA cleavage by abasic, oxidized and alkylated lesions. Nucleic Acids Res 2000;28:194754.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
B. Brooks, T. J. O'Brien, S. Ceryak, J. P. Wise Sr, S. S. Wise, J. P. Wise Jr, E. DeFabo, and S. R. Patierno
Excision repair is required for genotoxin-induced mutagenesis in mammalian cells
Carcinogenesis,
May 1, 2008;
29(5):
1064 - 1069.
[Abstract]
[Full Text]
[PDF]
|
 |
|