
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cancer Therapy: Preclinical |
Authors' Affiliations: 1 Department of Pharmaceutical Sciences, St. Jude Children's Research Hospital; 2 University of Tennessee Health Science Center, Memphis, Tennessee; 3 Department of Clinical Oncology, UZ Gasthuisberg, Catholic University of Leuven, Leuven, Belgium; and 4 Department of Medical Oncology, Erasmus Medical Center, Rotterdam, the Netherlands
Requests for reprints: Alex Sparreboom, CCC, Mail Stop 313, Room I5308, Department of Pharmaceutical Sciences, St. Jude Children's Research Hospital, 332 North Lauderdale, Memphis, TN 38105. Phone: 901-495-5346; Fax: 901-495-3125; E-mail: alex.sparreboom{at}stjude.org.
| Abstract |
|---|
|
|
|---|
Experimental Design: IUR of [3H]imatinib was studied in Xenopus laevis oocytes and HEK293 cells expressing OATP1A2, OATP1B1, OATP1B3, OCT1-3, OCTN1-2, or OAT1-3. Gene expression was determined in nine leukemia cell lines using the Affymetrix U133 array.
Results: Imatinib was not found to be a substrate for OCT1 in oocytes (P = 0.21), whereas in HEK293 cells IUR was increased by only 1.20-fold relative to control cells (P = 0.002). Furthermore, in 74 cancer patients, the oral clearance of imatinib was not significantly altered in individuals carrying reduced-function variants in SLC22A1 (P = 0.99). Microarray analysis indicated that SLC22A1 was interrelated with gene expression of various transporters, including ABCB1, ABCC4, ABCG2 (negative), and OATP1A2 (positive). Imatinib was confirmed to be a substrate for the three efflux transporters (P < 0.05) as well as for OATP1A2 (P = 0.0001).
Conclusions: This study suggests that SLC22A1 expression is a composite surrogate for expression of various transporters relevant to imatinib IUR. This observation provides a mechanistic explanation for previous studies that have linked SLC22A1 with the antitumor activity of imatinib. Because of its high expression in the intestine, ciliary body, gliomas, and leukemia cells, OATP1A2 may play a key role in imatinib pharmacokinetics-pharmacodynamics.
/β), and c-KIT receptor tyrosine kinases (1, 2). This agent has been approved for the treatment of Philadelphia chromosome–positive chronic myeloid leukemia (CML) and also for c-KIT–positive metastatic and unresectable gastrointestinal stromal tumors (3, 4). Substantial interindividual differences in the pharmacokinetic profile of imatinib have been observed in patients with CML or gastrointestinal stromal tumor (5). However, the reasons for this variability are not well-understood (6). Whereas imatinib is well-absorbed after p.o. administration and has an average oral bioavailability of higher than 90% (7), it is still extensively metabolized, with up to 80% of the administered dose being recovered in feces as unchanged drug or metabolites (8). The principal metabolite of imatinib, the N-desmethyl derivative CGP74588, is primarily formed in the liver by CYP3A4, whereas a number of other enzymes such as CYP2D6 are involved in the formation of minor metabolites (9). It is increasingly recognized that drug disposition is highly dependent on the complex interplay between hepatic drug–metabolizing enzymes and drug transporters (10). However, most studies to date have not considered affinity for transporters as a determinant of the pharmacokinetic profile of imatinib. Although imatinib is a known substrate of the efflux transporters ABCB1 (MDR1, P-glycoprotein; refs. 11, 12) and ABCG2 (BCRP; ref. 13), the mechanisms by which imatinib is taken up into hepatocytes are still unknown. Previous investigations have indicated that a temperature-dependent, active transport mechanism is involved in the intracellular uptake of imatinib in a variety of leukemia cell lines, including CCRF-CEM (14), HL-60 (15), and K562 (16). On the basis of the ability of certain agents, such as verapamil and prazosin, to decrease the uptake of imatinib in a concentration-dependent manner, one of the transporters involved in this process has been identified as the human organic cation transporter OCT1 (14, 16). Because OCT1 is a highly expressed solute carrier in the basolateral membrane of hepatocytes (17), we hypothesized that this transporter facilitates the hepatocellular accumulation of imatinib before metabolism and biliary secretion and, thus, may play an important role in governing drug disposition. The aims of the current study were to assess the interaction of imatinib with OCT1 and a variety of other human uptake transporters using in vitro models, and to evaluate the pharmacokinetic properties of imatinib in gastrointestinal stromal tumor patients carrying known reduced-function variants of OCT1.
| Materials and Methods |
|---|
|
|
|---|
In vitro transport studies. Generally labeled [3H]imatinib was custom made by Moravek Biochemicals, Inc. In all in vitro experiments, radiolabeled imatinib was mixed with unlabeled drug (Novartis) to the desired concentration. The selection of initial test concentration ranges of imatinib in the various (protein free) model systems was based on an average expected unbound drug concentration at steady-state in patients' plasma of 0.3 µmol/L, assuming a fraction unbound drug of 9.5% and a total drug concentration of 3 µmol/L. Xenopus laevis oocytes injected with transporter cRNA and water-injected controls were obtained from BD Biosciences. After washing the oocytes thrice with 3 mL sodium buffer [BD Biosciences (pH 7.4)], 5 oocytes per test tube were incubated with 100 µL sodium buffer containing [3H]imatinib (0.8 µmol/L). At the end of 60-min or 90-min incubation periods at room temperature, the oocytes were washed four times with 3 mL ice-cold sodium buffer, and then placed in individual scintillation vials (one oocyte per vial) and lysed by the addition of 150 µL sodiumdodecylsulfate buffer (10%). Scintillation fluid (5 mL) was added to the vials, and radioactivity was measured using an LS 6500 scintillation counter (Beckman Coulter). The contribution of a given transporter to the intracellular accumulation of imatinib was established by comparing data obtained in oocytes injected with the transporter cRNA and water injected control oocytes.
Before transport experiments, HEK293 cells were seeded in 6-well plates at a density of 1 x 106 cells per well in 2 mL medium. When cells reached 95% confluence, sodium butyrate (5 µmol/L) was added to the medium for 24 h to induce expression of the respective transporter genes (19). Next, the transport experiment was initiated by adding serum-free medium containing [3H]imatinib (0.2 µmol/L) to OCT- or OAT-expressing cells. For OCTN-expressing cells, a medium was used that contains sodium chloride (125 mmol/L), potassium chloride (4.8 mmol/L), D-glucose (5.6 mmol/L), calcium chloride (1.2 mmol/L), potassium hydrogen phosphate (1.2 mmol/L), magnesium sulfite (1.2 mmol/L), and HEPES (25 mmol/L; refs. 20, 21).
At a predetermined time interval, the experiment was terminated by adding ice-cold PBS after removal of the incubation buffer. After washing with ice-cold PBS, cells were mixed with 900 µL sodium hydroxide (1N) for 20 min. A volume of 25 µL lysate aliquots were used for protein estimation using a bicinchoninic acid protein assay kit (Pierce Biotechnology), and 600 µL lysate were used for analysis of total radioactivity by scintillation counting as described above. The contribution of a given transporter to the intracellular accumulation of imatinib was established by comparing data obtained in HEK293 cells overexpressing the transporter and HEK293 cells transfected with an empty vector.
Transport assays in LLC-PK1 and L-MDR1 cells were carried out as described (22), with minor modifications. Briefly, 2 x 106 cells per well were seeded on a 24.5-mm diameter Transwell plate with a 3.0-µm pore size (Costar). The cells were grown for 3 d in complete medium, with medium changed daily. About 1 to 2 h before start of the experiment, the medium at both the apical and the basal side of the monolayer was replaced with 2 mL fresh medium. The experiment was initiated by replacing the medium at either the apical or basolateral side with 2 mL medium containing [3H]imatinib (1 or 10 µmol/L). The cells were incubated at 37°C, and 50-µL aliquots were taken from each compartment at 1, 2, 3, and 4 h. The appearance of radioactivity in the opposite compartment was measured and presented as the fraction of total radioactivity added at the beginning of the experiment. Calculations were done as described in detail elsewhere (23). In brief, the cumulative amount of imatinib (Q) on the receiver side was initially plotted as a function of time. The steady-state flux J was then estimated from the slope (dQ/dt). The apparent permeability coefficient (Papp) of unidirectional flux for imatinib was estimated by normalizing the flux J (mol/s), against the nominal surface area A (0.33 cm2) and the initial drug concentration in the donor chamber C0 (mol/mL), or Papp = J/(A x C0), expressed in units of centimeter per second. The basolateral/apical ratio equals the Papp value for B-to-A transport divided by the Papp value for A-to-B transport.
For transport studies in Saos-2 cells, cells were seeded in 6-wells plate at density of 5 x 105 per well. At 70% confluence, cells were washed with PBS and replaced with fresh, serum-free medium containing [3H]imatinib (0.1 or 1 µmol/L) for 2 h. At the end of drug incubation, medium was removed and cells were washed twice with ice-cold PBS. The cells were the handled as described above for HEK293 cells.
SLC22A1 expression analysis. Total RNA was extracted from cells with TRIzol (Invitrogen), and cDNA was synthesized by the SuperScript First Strand Synthesis kit (Invitrogen). Amplification of SLC22A1 fragments were done using primers published previously (18). PCR reactions were done by using QantiTect SYBR Green PCR Master Mix. The cycling conditions were as follows: 95°C for 15 min, 45 cycles of 95°C for 15 s, 56°C for 30 s, and 72°C for 30 s. The reaction was run on an ABI 7900HT Fast Real-time PCR System (Applied Biosystems). The expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was simultaneously analyzed as a quality control and was used for normalization.
Patient studies. Patients with c-KIT–positive gastrointestinal stromal tumors were treated with p.o. imatinib, given daily at a dose ranging from 100 to 1,000 mg (median dose, 400 mg). Specific inclusion and exclusion criteria have been described previously (6). The study protocol was approved by the Institutional Review Board at the participating institutions, and written informed consent was obtained from each subject according to the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use/European Union Good Clinical Practice, national, and local regulations. Blood samples were obtained at steady-state at
28 d after the start of drug administration and analyzed by reversed-phase high performance liquid chromatography with tandem-mass spectrometric detection (24). Pharmacokinetic parameters, including the apparent oral clearance were determined by noncompartmental analysis using the software package WinNonlin version 5.0 (Pharsight). Toxicity and efficacy data were not considered as pharmacodynamic end points in this study because different doses were used in the studied population.
Pharmacogenetic analysis. Genomic deoxyribonucleic acid (DNA) was isolated from plasma of each patient using the UltraSens Virus kit (Qiagen). The selection of two nonsynonymous variants in the SLC22A1 gene at the 286C>T and 1498G>A loci was based on considerations provided elsewhere (25, 26), and included the predicted frequency of the variant alleles in our White patient population and the predicted functional phenotypic change. The OCT1-R61C (SLC22A1 286C>T) and OCT1-G465R (SLC22A1 1498G>A) variants are associated with dramatically decreased function compared with the reference OCT1 protein (25). In this study, OCT1-R61C and OCT1-G465R were genotyped by sequencing exon 1 and exon 9, respectively. The REPLI-g mini/midi kit (Qiagen) was used to amplify genomic DNA based on the manufacturer's instructions. Primers were designed by using Primer 5.0 version. Primer sequences (5' to 3') were gcttagaccccactgactcg (forward) and agacacccacgaactgcac (reverse) for OCT1-R61C and tcctcatggttcctcctgac (forward) and ttcccatgaagcaagacaga (reverse) for OCT1-G465R, respectively. PCR reactions were done by using the HotStart Taq Master Mix (Qiagen), following recommended conditions. The efficiency and quality of PCR for all the genes were confirmed by running the PCR products on a 1.5% agarose gel. After clean-up using ExoSAP-IT (USB Corporation), the PCR products were subjected to direct sequencing at the Hartwell Center for Bioinformatics and Biotechnology (St. Jude Children's Research Hospital). Sequence analysis was done with Sequencher Version 4.5 (Gene Codes Corporation). The individuals that carried either one or both of the variants are called the OCT1-variant group, whereas those individuals carrying two copies of the reference sequence are called the OCT1-reference group.
Microarray analysis. Total RNA was extracted from nine acute myeloid leukemia cell lines with TRIzol (Invitrogen), and RNA integrity was assessed as described (27). The Affymetrix U133 plus 2.0 GeneChip array (Affymetrix, Inc.) was used to determine expression data according to the manufacturer's protocol. Microarray analysis was done as described (28). The relative expression signals for each gene were calculated using MicroArray Suite version 5.0 (MAS5.0; Affymetrix). A heat map of interrelationships between the expression of selected solute carriers and ATP-binding cassette (ABC) transporters was generated using the software package Spotfire DecisionSite 7.0 (Spotfire).
Statistical considerations. All data are presented as mean values with SE, unless indicated otherwise. Differences in intracellular uptake and retention in the various cell types were evaluated using a Kruskal-Wallis test. Differences in the pharmacokinetic variables of imatinib as a function of OCT1 variants were evaluated using a Mann-Whitney U test. Two-tailed P values of <0.05 were considered as statistically significant. All statistical calculations were done using the software package NCSS version 2001 (Number Cruncher Statistical System; J. Hintze).
| Results |
|---|
|
|
|---|
7-fold increased in the presence of OCT1 (Fig. 1
). However, the intracellular uptake and retention of [3H]imatinib was only 14.5% higher (P = 0.21) compared with water-injected control cells (Fig. 1). In transfected HEK293 cells, the intracellular uptake and retention of [3H]imatinib was
20% higher in those cells overexpressing OCT1 (Fig. 2A
). Although this value reached statistical significance, the overall contribution of OCT1 to imatinib transport in this model seems limited, in spite of the substantial degree of SLC22A1 overexpression in these cells (Fig. 2B). Interestingly, the mRNA expression was substantially higher in our transfected HEK293 cells relative to that in human K562 cells that were used in a previous study in which imatinib uptake was concluded to be mediated by OCT1 (16). Although the intracellular uptake and retention of [3H]imatinib was found to be time dependent in the HEK293 cells overexpressing OCT1 (Fig. 2C), the transport was not saturable over a wide concentration range spanning 0.5 to 50 µmol/L (Fig. 2D). This is further suggestive of the lack of a strong interaction of imatinib with OCT1 in this model.
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
20% increased compared with control cells. Differences in these two experimental systems may be an explanation for the minor disparities in transport characteristics, and this has been described previously for the comparative transport of a number of other agents in amphibian and mammalian cells (31).
During the course of preparing this manuscript, Wang et al. (32) showed that OCT1 was capable of transporting imatinib to some extent in the human CML cell line KCL22 after transfection of cells with a pcDNA-OCT1 plasmid. In that study, KCL22 cells with high expression level of OCT1 showed a statistically significant increased influx of imatinib compared with cells transfected with pcDNA vector. Unfortunately, the actual difference in intracellular uptake and retention of imatinib between these two cell types was not provided by authors. However, examination of the data presented suggests that transport of imatinib was
50% increased in KCL22-transfected cells compared with control cells. This is not necessarily inconsistent with our current observation but may merely reflect differences in cell context and possible differences between KCL22 cells and HEK293 cells in their respective expression levels of other transporters of relevance to imatinib.
In the current study, we found that patients with gastrointestinal stromal tumor carrying any one of the reduced-function variants OCT1-R61C or OCT1-G465R did not have altered plasma concentrations of imatinib at steady-state compared with patients carrying the reference genotype. In light of the relatively few individuals studied with a variant genotype, however, the currently observed lack of significant relationships between the studied OCT1 variants and the steady-state pharmacokinetics of imatinib has relatively limited statistical power. It is also theoretically possible that additional genetic variants or haplotypes of importance to the pharmacokinetics of imatinib in this population are yet to be discovered. Furthermore, key variants with altered functionality or their frequencies may not be the same in different ethnic populations, as was highlighted recently for studies evaluating the effect of OCT1 variants on the pharmacokinetics of metformin in White (29) and Japanese populations (33). However, it should be pointed out that the predicted confidence intervals of the observed genotype effects were sufficiently narrow to conclude that the studied variants do not cause a substantial interindividual difference in the apparent oral clearance of imatinib. In conjunction with the prior observation that common variants in the ABCB1, ABCG2, CYP2C9, CYP2C19, CYP2D6, CYP3A4, and CYP3A5 genes have only a limited effect on the pharmacokinetics of imatinib (6, 34), the current findings further support the possibility that other intrinsic physiologic and environmental variables may have a more profound influence on the absorption and disposition of imatinib.
In spite of the currently observed lack of a substantial interaction of imatinib with OCT1, a number of recent clinical studies have found that the expression of the OCT1 gene SLC22A1 may be an important determinant for activity in CML after imatinib treatment (16, 32, 35). This paradox might be explained by the fact that the high expression of OCT1 in leukemic target cells could directly control local drug levels, and thereby alter the pharmacodynamic effects of imatinib without affecting measures of systemic exposure. However, this possibility is not supported by the current observation that the normalized expression of SLC22A1 in the transfected HEK293 cells is substantially higher than that in a typical CML cell line. Furthermore, we did not observe statistically significant associations between SLC22A1 expression and the intracellular uptake and retention of imatinib in a panel of leukemia cell lines (data not shown).
An alternative hypothesis that we explored here is that OCT1 might not be by itself causative for the observed relationships of SLC22A1 expression with treatment outcome but, rather, that its expression may be a composite surrogate for expression of various transporters relevant to the intracellular uptake and retention of imatinib. Support for this hypothesis was obtained from a gene expression analysis in leukemia cell lines, in which we found that SLC22A1 is significantly interrelated with various genes previously implicated in imatinib transport, including ABCB1 (12), ABCC3 (30), and ABCG2 (13), as well as with genes encoding transporters that were subsequently shown to interact with imatinib (see below). In this context, it is of particular relevance to point out that a recent study suggested that the average molecular response assessed in a large cohort of patients with CML after the start of treatment with imatinib was significantly associated with a measure describing the difference in intracellular uptake of imatinib ex vivo in the absence and presence of the transporter inhibitor, prazosin (36).
Using an in vitro screen involving expressed Xenopus laevis oocytes and transfected HEK293 cells, we found that imatinib is transported by the human uptake transporter OCTN2 (CT1; refs. 21, 37) and, to a modest extent, by OATP1B3 (LST-2, OATP8; ref. 38). Other transporters localized to the human basolateral membrane of hepatocytes such as OAT2 and OATP1B1 (LST-1, OATP-C, OATP2) were not found to transport this anticancer drug. Human transporters that are predominantly expressed in other organs such as the kidney, including OAT1, OAT3, and OCT2, also did not transport imatinib, which is consistent with the relatively low renal clearance of the drug (5).
In terms of the in vivo relevance and contribution of OCTN2 versus OATP1B3, our in vitro data suggest that OCTN2 might be a more efficient and capable transporter of imatinib, at a concentration (0.2 µmol/L) that is readily attained in humans (5). Moreover, given the recent data that suggest that the expression level of OATP1B3 in the liver is much lower than that of OCTN2 (39), hepatic uptake of imatinib is likely to be mostly affected by OCTN2 expression and function in vivo. To confirm a role of OCTN2 in the hepatic uptake and elimination of imatinib, we are currently evaluating the pharmacokinetics of imatinib in the juvenile visceral steatosis mouse strain, which carries a naturally occurring loss-of-function mutation in the mOctn2 gene, Slc22a5 (20, 40).
This study also provides evidence that the intracellular uptake of imatinib is associated with the organic anion transporting polypeptide OATP1A2 (OATP-A). Interestingly, this particular transporter is highly expressed in a number of tissues pertinent to imatinib disposition and response, such as the intestine (41), ciliary body (42), and gliomas (43) but is absent in hepatocytes (44). In the human intestine, OATP1A2 is expressed on the apical brush-border membrane of human enterocytes along the entire crypt-villus axis, where it is colocalized with ABCB1 (41). Because under the mild acidic conditions in the duodenum imatinib is predicted to be >90% in a cationic form (45), it is tempting to speculate that OATP1A2 is an important transporter that facilitates the intestinal absorption of imatinib (Fig. 7 ).
|
| Disclosure of Potential Conflicts of Interest |
|---|
|
|
|---|
| Acknowledgments |
|---|
| Footnotes |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
5 Hu S, Niu H, Minkin P, Orwick S, Shimada A, Inaba H, Dahl GVH, Rubnitz J, Baker SD. Comparison of antitumor effects of multitargeted tyrosine kinase inhibitors in acute myelogenous leukemia, Mol Cancer Ther.In press. ![]()
Received 11/15/07; revised 1/17/08; accepted 1/29/08.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Baccarani, G. Rosti, F. Castagnetti, I. Haznedaroglu, K. Porkka, E. Abruzzese, G. Alimena, H. Ehrencrona, H. Hjorth-Hansen, V. Kairisto, et al. Comparison of imatinib 400 mg and 800 mg daily in the front-line treatment of high-risk, Philadelphia-positive chronic myeloid leukemia: a European LeukemiaNet Study Blood, May 7, 2009; 113(19): 4497 - 4504. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Franke and A. Sparreboom Inhibition of Imatinib Transport by Uremic Toxins During Renal Failure J. Clin. Oncol., September 1, 2008; 26(25): 4226 - 4227. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |