
Clinical Cancer Research 14, 3149, May 15, 2008. doi: 10.1158/1078-0432.CCR-07-4358
© 2008 American Association for Cancer Research
Cancer Therapy: Preclinical |
A BTB/POZ Gene, NAC-1, a Tumor Recurrence–Associated Gene, as a Potential Target for Taxol Resistance in Ovarian Cancer
Masako Ishibashi1,
Kentaro Nakayama1,
Shamima Yeasmin1,
Atsuko Katagiri1,
Kouji Iida1,
Naomi Nakayama1,
Manabu Fukumoto2 and
Kohji Miyazaki1
Authors' Affiliations: 1 Departments of Obstetrics and Gynecology, Shimane University School of Medicine, and 2 Departments of Pathology, Institute of Development, Aging and Cancer, Tohoku University, Sendai, Japan
Requests for reprints: Kentaro Nakayama, Shimane University School of Medicine, Enyacho 89-1, Izumo, Shimane, Japan 6938501. Phone: 81-853-20-2268; Fax: 81-853-20-2264; E-mail: kn88{at}med.shimane-u.ac.jp.
 |
Abstract
|
|---|
Purpose: We previously determined that NAC-1, a transcription factor and member of the BTB/POZ gene family, is associated with recurrent ovarian carcinomas. In the current study, we investigated further the relationship between NAC-1 expression and ovarian cancer.
Experimental Design: NAC-1 expression was assessed by immunohistochemistry, and clinical variables were collected by retrospective chart review. SiRNA system and NAC-1 gene transfection were used to asses NAC-1 function in Taxol resistance in vivo.
Results: Overexpression of NAC-1 correlated with shorter relapse-free survival in patients with advanced stage (stage III/IV) ovarian carcinoma treated with platinum and taxane chemotherapy. Furthermore, overexpression of NAC-1 in primary tumors predicted recurrence within 6 months after primary cytoreductive surgery followed by standard platinum and taxane chemotherapy. NAC-1 expression levels were measured and compared among the human ovarian cancer cell line (KF28), cisplatin-resistant cell line (KFr13) induced from KF28, and paclitaxel-resistant cell lines (KF28TX and KFr13TX) induced by exposing KF28 and KFr13 to dose-escalating paclitaxel. Overexpression of NAC-1 was observed in only the Taxol-resistant KF28TX and KFr13 TX cells but not in KF28 or cisplatin-resistant KFr13 cells. To confirm that NAC-1 expression was related to Taxol resistance, we used two independent but complementary approaches. NAC-1 gene knockdown in both KF28TX and KFr13TX rescued paclitaxel sensitivity. Additionally, engineered expression of NAC-1 in RK3E cells induced paclitaxel resistance.
Conclusions: These results suggest that NAC-1 regulates Taxol resistance in ovarian cancer and may provide an effective target for chemotherapeutic intervention in Taxol-resistant tumors.
Ovarian cancer is the most lethal gynecologic malignancy in the world (1). In >70% of cases, the tumor has disseminated beyond the ovaries at the time of diagnosis. In these cases, combined treatment with surgery and chemotherapy is necessary. First-line chemotherapy with platinum drugs and taxanes yields a response rate of >80%; however, nearly all patients relapse. At the time of relapse, ovarian tumors can be rechallenged with platinum drugs and taxanes, with response rates proportional to the disease-free interval after the first treatment. Regardless of the initial response, the long term survival of ovarian cancer patients is still poor, particularly when the cancer is diagnosed at an advanced stage. Patients who relapse, and those who do not initially respond to chemotherapy, are thought to carry hidden drug-resistant cells, which are the cause of tumor relapse and lethality. In ovarian cancer, resistance to chemotherapeutics has been thoroughly studied. A number of mechanisms have been proposed that might be targets of novel chemotherapeutic agents. Many chemotherapeutic drugs induce apoptosis in tumor cells. Therefore, pharmacologic research could be directed at enhancing this process, either by directly activating apoptosis or by lowering the threshold for its initiation by cytotoxic drugs (2).
The genes of the BTB/POZ family participate in several cellular functions including proliferation, apoptosis, transcription control, and cell morphology maintenance (3). By serial analysis of gene expression levels in all 130 deduced human BTB/POZ genes, we identified NAC-1 as a carcinoma-associated BTB/POZ gene (4), is a transcription repressor, and is involved in self renewal and maintenance of pluripotency in embryonic stem cells (5). NAC-1 is significantly overexpressed in several types of human carcinomas including ovarian serous carcinoma (4). The levels of NAC-1 expression correlate with tumor recurrence in ovarian serous carcinomas and, intense NAC-1 immunoreactivity in primary ovarian tumors predicts early recurrence (4). Additionally, NAC-1 expression is higher in specimens obtained after administration of chemotherapy (6). Finally, overexpression of full-length NAC-1 is sufficient to increase tumorigenecity of ovarian surface epithelial cells and NIH3T3 cells in athymic nu/nu mice. Taken together, our previous studies suggest that NAC-1 is a tumor recurrence–associated gene with oncogenic potential. The molecular mechanisms underlying these observations are unknown, and how NAC-1 expression contributes to chemotherapy resistance in ovarian cancer is yet to be studied.
The current study examined the role of NAC-1 in ovarian cancer recurrence, investigated the relationship between NAC-1 expression and tumor recurrence, and finally assessed whether NAC-1 is a useful prognostic factor in patients with ovarian cancer.
 |
Materials and Methods
|
|---|
Tissue samples and immunohistochemistry. Paraffin-embedded tumor tissues were obtained from the Department of Obstetrics and Gynecology at the Shimane University Hospital. These included 43 advanced stage (stage III/IV) ovarian carcinomas. Diagnosis was based on conventional morphologic examination of sections stained with H&E staining. Tumors were classified according to the WHO classification. Tumor staging was done according to the International Federation of Gynecology and Obstetrics classification. The clinicopathologic characteristics of the patients included in this study are summarized in Table 1
. All patients were primarily treated with cytoreductive surgery, and adjuvant conventional platinum and taxane chemotherapy (Carboplatin AUC5, Paclitaxel 175 mg/m2, or Docetaxel 70 mg/m2). All of the cases received at least six cycles of chemotherapy. Acquisition of tissue specimens and clinical information was approved by an institutional review board (Shimane University). The Paraffin tissues were organized into tissue microarrays, which were made by removing 3-mm diameter cores of tumor from each block. The selection of the area to core was made by a surgical pathologist (M. F) and based on review of the H&E slides. NAC-1 mouse monoclonal antibody was a kind gift from Dr. Ie-Ming Shih (Johns Hopkins Medical Institutions, Baltimore, MD). Immunohistochemistry was done on deparaffinized sections using the NAC-1 antibody at a dilution of 1:100 and an EnVision+System peroxidase kit (DAKO). Immunoreactivity was scored by two investigators as follows: 0, undetectable; 1+, weakly positive; 2+, moderately positive; and 3+, intensely positive. NAC-1 immunoreactivity was not detectable (immunointensity score, 0) in normal ovarian epithelium.
Reagent preparation. Paclitaxel and carboplatin were obtained from Bristol-Myers Squib. They were stored at 4°C and were added to the culture medium at several final concentrations.
Quantitative PCR analysis. Of the 43 ovarian cancer samples we examined, 18 were available for gene expression analysis. A total of 24 frozen tissues including 18 cases of ovarian cancer and 6 samples of normal ovary were analyzed for NAC-1 transcript expression by quantitative real-time PCR using an ABI 7000 (Applied Biosystems) with the SYBR Green dye (Molecular Probes). Detailed procedure of quantitative PCR was described previously (4).
Cell culture and Western blot analysis. The human ovarian carcinoma cell lines KF28, KF28TX, KFr13, and KFr13TX were a kind gift of Dr. Yoshihiro Kikuchi (Ohki Memorial Kikuchi Cancer Clinic for Women, Saitama, Japan; ref. 7). KF28 was the original human ovarian carcinoma–derived cell line, and KF28TX and KFr13 were the Taxol- and cisplatin-resistant lines that were established by repeated exposure of the parent KF28 cells to Taxol and cisplatin, respectively. KFr13TX was the cell line derived from KFr13 cells through exposure to Taxol. All of the cell lines were maintained in DMEM (Life Technologies) supplemented with 10% fetal bovine serum, 100 units/mL of penicillin, and 100 µg/mL of streptomycin. Western blot analysis was done using the same antibody (1:100) on 4 ovarian carcinoma cell lines including KF28, KF28TX, KFr13, and KFr13TX. Detailed procedure of Western blot was described previously (4). Selection of PCMV/NAC-1 stable clones was done through limiting dilution in selection medium containing 3 ug/mL of Blasticidine (Sigma).
Cell growth inhibition assay. Cytotoxity of Taxol or carboplatin was measured using an 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric assay (Sigma Co.). Cells were seeded in 96-well plates at a density of 3,000 cells per well. The cell number was determined indirectly by MTT assay (8). Data were expressed as mean ± 1 SD from triplicates.
siRNA knockdown of NAC-1 gene expression. Two siRNAs that targeted NAC-1 were designed with the following sense sequences: UGAUGUACACGUUGGUGCCUGUCACCA and GAGGAAGAACUCGGUGCCCUUCUCCAU. Control siRNA (luciferase siRNA) was purchased from IDT. Cells were seeded onto 96-well plates and transfected with siRNAs using oligofectamine (Invitrogen). The cell number was determined indirectly by an MTT assay.
Statistical methods for clinical correlation. Relapse-free and overall survivals were calculated from the date of diagnosis to the date of first relapse or last follow up. Age and performance status distributions were similar between patients expressing NAC-1 and those not expressing it. The data were plotted as Kaplan-Meier curves, and the statistical significance was determined by the Log-rank test. Data were censored when patients were lost to follow-up. A Student's t test was used to examine the statistical significance in the difference of growth assay data.
 |
Results
|
|---|
Overexpression NAC-1 in advanced stage ovarian carcinoma. In this study, we focused on advanced stage (stage III/IV) ovarian carcinomas because they were the most common. Forty-three stage III or IV primary ovarian carcinoma patients underwent primary cytoreductive surgery that was followed by a standard platinum and taxane chemotherapy regimen. Cytoreduction was optimal in 8 patients (residual tumor, <1 cm) and suboptimal in 35 (residual tumor,
1 cm). All of the cases were judged to be in clinical remission after adjuvant conventional chemotherapy. Primary surgical tissues were used for NAC-1 protein immunohistochemistry. Nuclear staining of NAC-1 was observed in some ovarian carcinoma cells (Fig. 1A and B
). The immunohistochemistry results are summarized in Table 1. Overexpression of NAC-1 (NAC-1 immunointensity, 2+ and 3+) was observed in 56% (24 of 43) of the analyzed tumors.

View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Immunoreactivity of NAC-1 in ovarian cancer tissues. A, intense immunoreactivity is present in the nuclei of ovarian carcinoma cells. B, a case with negative staining of NAC-1. C, NAC-1 protein expression correlates with the NAC-1 gene expression in ovarian cancer. Tumors with high NAC-1 gene expression levels express high levels of NAC-1 protein (2+ and 3+). Tumors that lack of NAC-1 gene expression show none to weak NAC-1 immunoreactivity (0 and 1+).
|
|
Relationship between clinicopathologic findings and NAC-1 expression. Table 1 summarizes the relationship between clinicopathologic findings and overexpression of NAC-1 in ovarian carcinomas. No significant associations were found between NAC-1 overexpression and age, histologic subtype, grade, or status of the residual tumor (Table 1A).
NAC-1 overexpression correlated with shorter relapse-free survival in patients with stage III and IV ovarian carcinoma patients treated with platinum and taxane chemotherapy. Overexpression of NAC-1 correlated with shorter relapse-free survival in patients with advanced stage (stage III/IV) ovarian carcinoma treated with platinum and taxane chemotherapy. A total of 43 patients were diagnosed at stage III/IV. Among them, the 24 patients with NAC-1 overexpression had a shorter relapse-free survival compared with those without NAC-1 expression (P < 0.001; Log-rank test; Fig. 2A
). Univariate analysis showed that both residual tumor (
1 cm; P = 0.0039; Log-rank test) and overexpression of NAC-1 (P < 0.001; Log-rank test) were correlated with shorter relapse-free survival. The other clinicopathologic factors including age, histologic subtype, and grade did not influence relapse-free and overall survival (data not shown). A marginally significant correlation between overexpression of NAC-1 and overall survival was found in patients with stage III/IV ovarian carcinomas (P < 0.026; Log-rank test; Fig. 2B).

View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. NAC-1 overexpression correlates with shorter relapse-free survival in patients with stage III/IV ovarian carcinoma who received primary cytoreductive surgery, followed by a standard platinum and taxane chemotherapy regimen. A, Kaplan-Meier survival analysis showing that NAC-1 overexpression (solid line; n = 24) is associated with a shorter relapse-free survival than weak or absent NAC-1 expression in stage III or IV ovarian cancers (dashed line; n = 19; P < 0.001; Log-rank test). B, Kaplan-Meier survival analysis showing that NAC-1 overexpression (solid line; n = 24) is associated with a shorter overall survival than weak or absent NAC-1 expression in stage III or IV ovarian cancers (dashed line; n = 19; P = 0.026; Log-rank test). B, Kaplan-Meier survival analysis showing that NAC-1 overexpression (solid line; n = 22) is associated with a shorter relapse-free survival than weak or absent of NAC-1 expression in stage III or IV ovarian cancer patients who underwent suboptimal primary cytoreduction followed by a standard platinum and taxane chemotherapy regimen (dashed line; n = 14; P = 0.024; Log-rank test).
|
|
Next, we focused on only the cases with positive residual tumor in advanced stage ovarian carcinoma and evaluated whether overexpression of NAC-1 was still a marker for relapse-free survival in this series of patients. A total of 36 patients with stage III/IV ovarian carcinomas, who underwent suboptimal primary cytoreduction followed by a standard platinum and taxane chemotherapy regimen, were included in the analysis. Among them, the 22 patients with NAC-1 overexpression had a shorter relapse-free survival compared with those without NAC-1 expression (P = 0.0006; Log-rank test; Fig. 2C). These findings prompted us to investigate whether NAC-1 overexpression in primary tumors was predictive of the relapse-free interval (the period between when the first-line adjuvant chemotherapy was completed and tumor recurrence) in the 36 patients who underwent suboptimal surgery. We found that overexpression of NAC-1 (immunointensity, 2 and 3+) predicted recurrence within 6 months of completing first-line chemotherapy (P = 0.0079; Table 1B).
Correlation of NAC-1 protein expression and NAC-1 gene expression. To validate the immunohistochemistry results, we did quantitative real-time PCR to assess the correlation between NAC-1 gene expression level and NAC-1 immunointensity. NAC-1 gene expression levels were significantly correlated with higher immunointensity in ovarian carcinomas (Fig. 1C).
NAC-1 expression is higher in Taxol-resistant KF28TX and KFr13TX cells than in parental KF28 and cisplatin-resistant KFr13 cells. To test whether NAC-1 expression was involved in platinum or taxane resistance, we analyzed NAC-1 expression level using platinum or taxane-resistant ovarian cancer cell lines. As previously reported (7), KF28TX and KFr13 cells were derived from KF28 cells based on their resistance to Taxol and cisplatin, respectively. KFr13TX cells were established from KFr13 cells based on their resistance to Taxol. The IC50 of Taxol for KF28, KF28TX, KFr13, and KFr13TX were 4.65, 53.30, 2.61, and 12.70 µmol/L, respectively. This indicates that the relative resistances of KF28TX and KFr13TX cells to Taxol are 11.5- and 5.0-fold, respectively, when compared with those of the original KF28 or KFr13 cells. Also, the IC50 of cisplatin for KF28, KF28TX, KFr13, and KFr13TX cells were 0.18, 0.14, 0.85, and 0.53 µmol/L, respectively, indicating that the relative resistances of KFr13 and KFr13TX cells to cisplatin were 4.7 and 2.9 times higher, respectively when compared with those of the original KF28 cells.
Interestingly, when NAC-1 protein levels were examined by Western blotting, expression of NAC-1 was characteristically observed in Taxol-resistant KF28TX and KFr13 TX cells supporting its involvement in Taxol resistance (Fig. 3
). In contrast, NAC-1 was not expressed in KFr13 cells derived from KF28 cells through exposure to cisplatin (Fig. 3). NAC-1 protein expression level in KF28TX cells was 1.4-fold higher than that in KFr13TX cells.

View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Western blot analysis of NAC-1 in ovarian cancer cell lines including KF28, KF28TX, KFr13, and KFr13TX. NAC-1 expression is higher in Taxol-resistant KF28TX and KFr13TX cells than in parental KF28 and cisplatin resistant KFr13.
|
|
Suppression of NAC-1 in Taxol-resistant cell lines KF28TX and KFr13TX and drug resistance to Taxol. NAC-1 siRNA was transfected into KF28TX and KFr13TX cells, followed by assessment of NAC-1 expression 48 hours later by Western blotting. siRNA treatment significantly reduced NAC-1 protein expression compared with control siRNA treatment (Fig. 4A and B
). KF28TX and KFr13TX cells were then transfected with NAC-1 siRNA or luciferase siRNA as a control and treated with 5 or 1 µmol/L Taxol 48 hours later. Cell growth was then determined with an MTT colorimetric assay 48 hours later. We found that there were significantly fewer KF28TX and KFr13TX cells after transfection with NAC-1 siRNA than after transfection with luciferase siRNA (P < 0.05; Fig. 4C and D).

View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. A and B, effects of NAC-1 knockdown on Taxol resistance in paclitaxel-resistant KF28TX cells. A, Western blot analysis showing a significant reduction of NAC-1 protein in NAC-1 siRNA–treated cells compared with control SiRNA–treated cells. B, KF28TX cells were subsequently transfected with NAC-1 siRNA or luciferase siRNA as a control and treated with DMSO or 5 µmol/L Taxol 48 h later. Cell growth was then determined with an MTT colorimetric assay after 48 h. There were significantly fewer KF28TX cells after transfection with NAC-1 siRNA than after transfection with luciferase siRNA (P < 0.05). C and D, effects of NAC-1 knockdown on Taxol resistance in paclitaxel-resistant KFr13TX cells. C, Western blot analysis showing a significant reduction of NAC-1 protein in NAC-1 siRNA–treated cells compared with control SiRNA–treated cells. D, KFr13TX cells were transfected with NAC-1 siRNA or luciferase siRNA as a control and treated with DMSO or 1 µmol/L Taxol 48 h later. Cell growth was then determined with an MTT colorimetric assay after 48 h. There were significantly fewer KFr13TX cells after transfection with NAC-1 siRNA than after transfection with luciferase siRNA (P < 0.05).
|
|
Functional analysis of NAC-1 expression. To confirm that NAC-1 expression was essential for Taxol resistance in cell lines not expressing NAC-1, we used a gene transfection system. We stably expressed the NAC-1 gene in the normal epithelial cell line RK3E to assess whether expression induced Taxol resistance. Using quantitative real-time PCR, we found that RK3E cells not expressing NAC-1 were sensitive to Taxol. The RK3E cells were then transfected with a vector expressing NAC-1, and three independent clones were randomly selected for functional analysis. Western blot analysis confirmed NAC-1 expression in these clones (Fig. 5A
). All of the NAC-1 expressing clones were resistant to Taxol compared with vector-transfected cells (Fig. 5B). There was no difference in sensitivity to carboplatin between vector-transfected cells and the NAC-1-expressing clones (Fig. 5C).

View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Functional analysis of NAC-1 expression. A, Western blot analysis showing that NAC-1–transfected RK3E clones (C1, C2, and C3) express V5-NAC-1 protein. B, all of the NAC-1–expressing clones were resistance to Taxol compared with vector-transfected cells. C, there was no difference in sensitivity to carboplatin between vector-transfected cells and the NAC-1–expressing clones.
|
|
 |
Discussion
|
|---|
The BTB/POZ gene family members have assumed a more central role in human cancer in recent years (9–14). Recently, we reported that NAC-1, a gene with oncogenic potential was associated with recurrence in ovarian cancer (4). The mechanism by which NAC-1 affects recurrence is, however, unknown.
Our most notable finding was that overexpression of NAC-1 in primary ovarian cancer was highly predictive of a shorter relapse-free interval. To date, there is no molecular marker that predicts the risk of early tumor recurrence. Therefore, NAC-1 expression may have the potential to be used alone or in combination with other markers as a new diagnostic tool to identify ovarian cancer patients with a greater susceptibility to recurrence within 6 months. This is important because at least 60% of advanced-stage ovarian cancer patients who are without clinical evidence of disease after completing primary therapy ultimately develop recurrent disease (15). Recently, Davidoson et al. (6) reported findings similar to ours, showing that NAC-1 expression intensity correlated with shorter progression-free survival in 62 patients with postchemotherapy effusions. Taken together, these observations may have an effect on clinical management. Patients with recurrent ovarian cancer derive the most benefit from secondary cytoreduction if recurrent tumors are small and localized (15–19). Therefore, patients with NAC-1–positive ovarian cancer can be followed more frequently to detect recurrences early enough to benefit from either secondary cytoreductive surgery or second-line chemotherapy.
Next, to elucidate the mechanisms underlying the effects of NAC-1 in ovarian cancer recurrence, we analyzed NAC-1 expression levels in cisplatin or paclitaxel resistance ovarian cancer cell lines (7). Interestingly, overexpression of NAC-1 was characteristically observed in only paclitaxel-resistant KF28TX and KFr13 TX but not in parental KF28 or KFr13 cisplatin–resistant cells.
Because NAC-1 expression was up-regulated in paclitaxel-resistant ovarian cancer cells, we tested the hypothesis that NAC-1 might confer paclitaxel resistance. The NAC-1 siRNA transfection experiments showed that both KF28TX and KF13rTX paclitaxel–resistant cells became more sensitive to paclitaxel after NAC-1 silencing. This finding suggests that NAC-1 antagonizes the antitumor activity of paclitaxel. Although NAC-1 silencing by NAC-1 siRNA rescued paclitaxel sensitivity, it was insufficient to completely restore paclitaxel sensitivity. This is because alterations in genes other than NAC-1, including P-glycoprotein, RhoGDI, and IGFBP-3 mediate paclitaxel resistance in these cell lines (7, 20). A molecular comparison between paclitaxel-sensitive and paclitaxel-resistant human ovarian cancer cell lines identified expression differences in TRAG-3, β-tubulin, interleukin 6, interleukin 8, and Raf-1 kinase (21–24). However, alteration in the expression of these genes has not been described in either KF28 or KFr13TX cells (20).
Next, to address whether NAC-1 expression was essential for paclitaxel resistance in cell lines not expressing NCA-1, we used a gene transfection system. All stable RK3E, NAC-1–expressing clones were resistant to paclitaxel but not to carboplatin.
Our studies with siRNA knockdown and gene overexpression established an important role of NAC-1 in Taxol resistance. However, the mechanism for this was unclear. Recently, we reported that NAC-1 controls cell growth and survival by repressing Gadd45GIP1 expression (25). Cross-talk between NAC-1/Gadd45GIP1 pathway and nuclear factor-
B pathway might suppress GADD45 death signals (25). Indeed, inhibition of nuclear factor-
B sensitizes ovarian cancer cells to paclitaxel-induced apoptosis (26, 27). Upon activation, nuclear factor-
B translocates to the nucleus and is associated with c-myc up-regulation. This in turn down-regulates Gadd45 proteins (28–30). Gadd45 interacts with Gadd45GIP1 and up-regulates MKK4 through MEKK4/MTK1 activation (31). In this manner, Gadd45 functions as a tumor suppressor (26). The enhanced MKK4 activity activates the proapoptotic c-Jun-NH2-kinase/p38 signaling, which results in growth arrest and apoptosis (27, 29, 32). Therefore, during tumor development, turning off the Gadd45 pathway seems to be critical for cancer cells to survive in the face of cellular stressors such as paclitaxel. Consequently, NAC-1 may regulate paclitaxel resistance in ovarian cancer by inhibiting Gadd45 cell death signals.
Paclitaxel stabilizes microtubules, causing mitotic arrest, and activates the spindle assembly checkpoint. A key question is how NAC-1 contributes to microtubule-related paclitaxel resistance. We recently reported that knockdown of NAC-1 with a deletion mutant N130-NAC1 dominant-negative protein results in mitotic arrest and leads to apoptosis. This suggests that NAC-1 may interact with β-tubulin or regulate mitotic checkpoint genes (4). These observations raise the hypothesis that NAC-1 regulates paclitaxel-related checkpoint genes including Mad2 and BubR1 (33).
In summary, we showed that NAC-1, a transcriptional repressor, was associated with tumor recurrence in advanced ovarian cancer. NAC-1 may be a useful marker for predicting recurrence within 6 months of cytoreductive surgery and first-line platinum and taxane-based chemotherapy. Using complementary gene knockdown and gene overexpressing systems, we also showed that overexpression of NAC-1 was essential for paclitaxel resistance. Its role in Taxol resistance makes NAC-1 an attractive target for designing chemotherapeutic agents for patients resistant to conventional taxane-based regimens.
 |
Disclosure of Potential Conflicts of Interest
|
|---|
No potential conflicts of interest were disclosed.
 |
Footnotes
|
|---|
Grant support: Ministry of Education, Culture, Sports, Science, and Technology in Japan and the Japan Society of Gynecologic Oncology.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 9/17/07;
revised 1/ 1/08;
accepted 1/13/08.
 |
References
|
|---|
- Wingo PA, Tong T, Bolden S, et al. Cancer statistics. CA Cancer J Clin 1995;45:8–30.[Abstract/Free Full Text]
- Agarwal R, Linch M, Kaye SB, et al. Novel therapeutic agents in ovarian cancer. Eur J Surg Oncol 2006;32:875–86.[CrossRef][Medline]
- Stogios PJ, Downs, GS, Jauhal JJ, Nandra SK, Prive GG. Sequence and structural analysis of BTB domain proteins. Genome Biol 2005;6:R82.[CrossRef][Medline]
- Nakayama K, Nakayama N, Davidson B, et al. A BTB/POZ protein, NAC-1, is related to tumor recurrence and is essential for tumor growth and survival. Proc Natl Acad Sci U S A 2006;103:18739–44.[Abstract/Free Full Text]
- Wang J, Rao S, Chu J, et al. A protein interaction network for pluripotency of embryonic stem cells. Nature 2006;444:364–8.[CrossRef][Medline]
- Davidson B, Berner A, Trope CG,Wang TL, Shih Ie M. Expression and clinical role of the bric-a-brac tramtrack broad complex/poxvirus and zinc protein NAC-1 in ovarian carcinoma effusions. Hum Pathol 2007;38:1030–6.[CrossRef][Medline]
- Yamamoto K, Kikuchi Y, Kudo K, Nagata I. Modulation of cisplatin sensitivity by taxol in cisplatin-sensitive and -resistant human ovarian carcinoma cell lines. J Cancer Res Clin Oncol 2000;126:168–72.[CrossRef][Medline]
- Nakayama K, Miyazaki K, Kanzaki A, Fukumoto M, Takebayashi Y. Expression and cisplatin sensitivity of copper-transporting P-type adenosine triphosphatase (ATP7B) in human solid carcinoma cell lines. Oncol Rep 2001;8:1285–7.[Medline]
- Albagli-Curiel O. Ambivalent role of BCL6 in cell survival and transformation. Oncogene 2003;22:507–16.[CrossRef][Medline]
- Puccetti E, Zheng X, Brambilla D, et al. The integrity of the charged pocket in the BTB/POZ domain is essential for the phenotype induced by the leukemia-associated t(11;17) fusion protein PLZF/RAR
. Cancer Res 2005;65:6080–8.[Abstract/Free Full Text] - Liang XQ, Avraham HK, Jiang S, Avraham S. Genetic alterations of the NRP/B gene are associated with human brain tumors. Oncogene 2004;23:5890–900.[CrossRef][Medline]
- Reuter S, Bartelmann M, Vogt M, et al. APM-1, a novel human gene, identified by aberrant co-transcription with papillomavirus oncogenes in a cervical carcinoma cell line, encodes a BTB/POZ-zinc finger protein with growth inhibitory activity. EMBO J 1998;17:215–22.[CrossRef][Medline]
- van Roy FM, McCrea PD. A role for Kaiso-p120ctn complexes in cancer? Nat Rev Cancer 2005;5:956–64.[CrossRef][Medline]
- Valenta T, Lukas J, Doubravska L, Fafilek B, Korinek V. HIC1 attenuates Wnt signaling by recruitment of TCF-4 and β-catenin to the nuclear bodies. EMBO J 2006;25:2326–37.[CrossRef][Medline]
- Diaz-Montes TP, Bristow RE. Secondary cytoreduction for patients with recurrent ovarian cancer. Curr Oncol Rep 2005;7:451–8.[Medline]
- Harter P, du Bois A. The role of surgery in ovarian cancer with special emphasis on cytoreductive surgery for recurrence. Curr Opin Oncol 2005;17:505–14.[CrossRef][Medline]
- Gadducci A, Iacconi P, Cosio S, Fanucchi A, Cristofani R, Riccardo Genazzani A. Complete salvage surgical cytoreduction improves further survival of patients with late recurrent ovarian cancer. Gynecol Oncol 2000;79:344–9.[CrossRef][Medline]
- Gadducci A, Iacconi P, Fanucchi A, Cosio S, Teti G, Genazzani AR. Surgical cytoreduction during second-look laparotomy in patients with advanced ovarian cancer. Anticancer Res 2000;20:1959–64.[Medline]
- Zang RY, Li ZT, Tang J, et al. Secondary cytoreductive surgery for patients with relapsed epithelial ovarian carcinoma: who benefits? Cancer 2004;100:1152–61.[CrossRef][Medline]
- Goto T, Takano M, Sakamoto M, et al. Gene expression profiles with cDNA microarray reveal RhoGDI as a predictive marker for paclitaxel resistance in ovarian cancers. Oncol Rep 2006;15:1265–71.[Medline]
- Britten RA, Perdue S, Eshpeter A, Merriam D. Raf-1 kinase activity predicts for paclitaxel resistance in TP53mut, but not TP53wt human ovarian cancer cells. Oncol Rep 2000;7:821–5.[Medline]
- Duan Z, Feller AJ, Toh HC, Makastorsis T, Seiden MV. TRAG-3, a novel gene, isolated from a taxol-resistant ovarian carcinoma cell line. Gene 1999;229:75–81.[CrossRef][Medline]
- Kavallaris M, Kuo DY, Burkhart CA, et al. Taxol-resistant epithelial ovarian tumors are associated with altered expression of specific β-tubulin isotypes. J Clin Invest 1997;100:1282–93.[Medline]
- Mozzetti S, Ferlini C, Concolino P, et al. Class III β-tubulin overexpression is a prominent mechanism of paclitaxel resistance in ovarian cancer patients. Clin Cancer Res 2005;11:298–305.[Abstract/Free Full Text]
- Nakayama K, Nakayama N, Wang TL, Shih Ie M. NAC-1 controls cell growth and survival by repressing transcription of Gadd45GIP1, a candidate tumor suppressor. Cancer Res 2007;67:8058–64.[Abstract/Free Full Text]
- Mabuchi S, Ohmichi M, Nishio Y, et al. Inhibition of NF
B increases the efficacy of cisplatin in in vitro and in vivo ovarian cancer models. J Biol Chem 2004;279:23477–85.[Abstract/Free Full Text] - Liu GH, Wang S, Wang B, Kong BH. Inhibition of nuclear factor-
B by an antioxidant enhances paclitaxel sensitivity in ovarian carcinoma cell line. Int J Gynecol Cancer 2006;16:1777–82.[CrossRef][Medline] - Smith ML, Chen IT, Zhan Q, et al. Interaction of the p53-regulated protein Gadd45 with proliferating cell nuclear antigen. Science 1994;266:1376–80.[Abstract/Free Full Text]
- Zhang W, Bae I, Krishnaraju K, et al. CR6: a third member in the MyD118 and Gadd45 gene family which functions in negative growth control. Oncogene 1999;18:4899–907.[CrossRef][Medline]
- Wang XW, Zhan Q, Coursen JD, et al. GADD45 induction of a G2-M cell cycle checkpoint. Proc Natl Acad Sci U S A 1999;96:3706–11.[Abstract/Free Full Text]
- Park KC, Song KH, Chung HK, et al. CR6-interacting factor 1 interacts with orphan nuclear receptor Nur77 and inhibits its transactivation. Mol Endocrinol 2005;19:12–24.[Abstract/Free Full Text]
- Tang G, Minemoto Y, Dibling B, et al. Inhibition of JNK activation through NF-
B target genes. Nature 2001;414:313–7.[CrossRef][Medline] - Sudo T, Nitta M, Saya H, Ueno NT. Dependence of paclitaxel sensitivity on a functional spindle assembly checkpoint. Cancer Res 2004;64:2502–8.[Abstract/Free Full Text]