Clinical Cancer Research Grants Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Clinical Cancer Research 14, 3319, June 1, 2008. doi: 10.1158/1078-0432.CCR-07-4054
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, J.
Right arrow Articles by Li, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, J.
Right arrow Articles by Li, M.

Imaging, Diagnosis, Prognosis

Astrocyte Elevated Gene-1 is a Novel Prognostic Marker for Breast Cancer Progression and Overall Patient Survival

Jun Li1,2, Nu Zhang4, Li-Bing Song5, Wen-Ting Liao5, Li-Li Jiang1,3, Li-Yun Gong1,3, Jueheng Wu1,3, Jie Yuan1,2, Hui-Zhong Zhang6, Mu-Sheng Zeng5 and Mengfeng Li1,3

Authors' Affiliations: 1 Key Laboratory of Tropical Disease Control (Sun Yat-sen University), Ministry of Education, 2 Departments of Biochemistry and 3 Microbiology, Zhongshan School of Medicine, Sun Yat-sen University, 4 Department of Neurosurgery, the First Affiliated Hospital of Sun Yat-sen University, 5 State Key Laboratory of Oncology in Southern China, and 6 Department of Pathology, Sun Yat-sen University Cancer Center, Guangzhou, Guangdong, China

Requests for reprints: Mengfeng Li, Zhongshan School of Medicine, Sun Yat-sen University, 74 Zhongshan Road II, Guangzhou, Guangdong 510080, China. Phone: 86-20-8733-1969; Fax: 86-20-8733-1209; E-mail: limf{at}mail.sysu.edu.cn.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Purpose: The present study was aimed at clarifying the expression of astrocyte elevated gene-1 (AEG-1), one of the target genes of oncogenic Ha-ras, in breast cancer and its correlation with clinicopathologic features, including the survival of patients with breast cancer.

Experimental Design: The expression of AEG-1 in normal breast epithelial cells, breast cancer cell lines, and in four cases of paired primary breast tumor and normal breast tissue was examined using reverse transcription-PCR and Western blot. Real-time reverse transcription-PCR was applied to determine the mRNA level of AEG-1 in the four paired tissues, each from the same subject. Furthermore, AEG-1 protein expression was analyzed in 225 clinicopathologically characterized breast cancer cases using immunohistochemistry. Statistical analyses were applied to test for the prognostic and diagnostic associations.

Results: Western blot and reverse transcription-PCR showed that the expression level of AEG-1 was markedly higher in breast cancer cell lines than that in the normal breast epithelial cells at both mRNA and protein levels. AEG-1 expression levels were significantly up-regulated by up to 35-fold in primary breast tumors in comparison to the paired normal breast tissue from the same patient. Immunohistochemical analysis revealed high expression of AEG-1 in 100 of 225 (44.4%) paraffin-embedded archival breast cancer biopsies. Statistical analysis showed a significant correlation of AEG-1 expression with the clinical staging of the patients with breast cancer (P = 0.001), as well as with the tumor classification (P = 0.004), node classification (P = 0.026), and metastasis classification (P = 0.001). Patients with higher AEG-1 expression had shorter overall survival time, whereas patients with lower AEG-1 expression had better survival. Multivariate analysis suggested that AEG-1 expression might be an independent prognostic indicator for the survival of patients with breast cancer.

Conclusions: Our results suggest that AEG-1 protein is a valuable marker of breast cancer progression. High AEG-1 expression is associated with poor overall survival in patients with breast cancer.


Breast cancer is the second most frequent cancer in the world and is by far the most common malignant disease in women, with an incidence of 1.05 million new cases per year, accounting for 22% of all new cancer cases (1). Although it is widely accepted that the etiology of breast cancer includes both genetic and environmental factors, the molecular mechanism of its development and progression remains poorly understood, and thus far, no specific signature of breast cancer gene expression has been reported to allow for patient-tailored therapy strategies. Furthermore, prediction of clinical prognosis of breast cancer is still reliant on conventional pathologic variables such as tumor size, tumor grade, lymph node, and distal metastasis status (25). Hence, it is of great clinical value to further understand the molecular mechanisms underlying the progression of breast cancer and to identify effective early markers for the diagnosis and prognosis of the disease as well as novel therapeutic targets.

Astrocyte elevated gene-1 (AEG-1), also known as metadherin, was originally identified as a protein induced in primary human fetal astrocytes infected with HIV-1 or treated with HIV gp120 or tumor necrosis factor-{alpha} (69). Tumor necrosis factor-{alpha} treatment was found to result in translocation of both AEG-1 and nuclear factor {kappa}B (NF-{kappa}B) to the nucleus, wherein these two proteins physically interacted with each other and ectopic expression of AEG-1 in HeLa cells markedly increased the DNA-binding activity of the transcriptional activator p50/p65 complex of NF-{kappa}B, due to degradation of I{kappa}B-{alpha} and nuclear translocation of NF-{kappa}B caused by AEG-1 (10). Additional studies have shown that the oncogenic Ha-ras could up-regulate AEG-1 expression by inducing the binding of c-Myc to the AEG-1 promoter, thereby promoting AEG-1 transcription. It was also shown that AEG-1 synergized with Ha-ras to enhance the colony-forming ability of nontumorigenic immortalized melanocytes in soft agar (11). Recently, Kikuno et al. reported that knockdown of AEG-1 inhibited prostate cancer progression through up-regulation of FOXO3a activity, and that such an alteration of FOXO3a activity was dependent on the reduction of Akt activity (12). Moreover, the above studies also implicated that AEG-1 might play a role in cancer metastasis because the AKT pathway and the NF-{kappa}B pathway had been suggested to increase tumor invasiveness. Indeed, overexpressing AEG-1 resulted in increased Matrigel invasion of HeLa cells, and knocked-down expression of AEG-1 inhibited the invasive ability of PC-3 and DU145 cells (11, 12). In addition, Brown and Ruoslahti showed that AEG-1 could act as a cell surface protein in breast tumors and mediate lung metastasis (6). Although published studies have suggested that AEG-1 expression is up-regulated in subsets of breast cancer, multiform glioblastoma, melanoma, and prostate cancer (6, 9, 12, 13), implicating the possibility of using AEG-1 as an indicator of cancer development or progression, thus far, there has been no report on whether the expression of AEG-1 is correlated with clinical staging as well as cancer patient survival.

In this study, we report for the first time the characterization of AEG-1 expression in breast cancer of various clinicopathologic grades. We found that the expression of AEG-1 was correlated with the clinical staging and tumor-node-metastasis (TNM) classification of the disease. Using multivariate analysis, the effectiveness of AEG-1 as a prognostic factor was assessed. Our results strongly suggest that AEG-1 might be an independent biomarker for the prediction of prognosis of breast cancer.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines. Primary normal breast epithelial cells (NBEC) were collected from the mammoplasty material of a 30-year-old woman at the Department of Plastic Surgery, the First Affiliated Hospital of Sun Yat-sen University (P.R. China), in accordance with rules and regulations concerning ethical issues on research use of human subjects in China, and cultured in the keratinocyte serum-free medium (Invitrogen) supplemented with epithelial growth factor, bovine pituitary extract, and antibiotics (120 µg/mL streptomycin and 120 µg/mL penicillin), as previously described by Liao et al. (14). Breast cancer cell lines, including MDA-MB-435, MDA-MB-453, MDA-MB-231, MCF-7, ZR-75-30, SK-BR-3, and Bcap-37 were grown in DMEM medium (Invitrogen) supplemented with 10% fetal bovine serum (HyClone).

Vectors and retroviral infection. GST-AEG-1 (199-400 amino acids) construct was generated by subcloning the PCR-amplified human AEG-1 coding sequence into pGEX4T1. The preparation of pure recombinant AEG-1 polypeptide was done according to a previously described protocol (15), and the details are available upon request. To introduce short hairpin RNAs to MCF-7 cells, we used the pSuper-retroviral vector and the following oligonucleotides for AEG-1: no. 1, AACAGAAGAAGAAGAACCGGA; and no. 2, GAAATCAAAGTCAGATGCTA (synthesized through Invitrogen). Recombinant retroviral vectors were produced by transient cotransfection, as described previously (16). Viral infections were done serially, and stable cell lines expressing AEG-1 RNAi(s) were selected with 0.5 µg/mL of puromycin 48 h after infection. After 10-day selections, the MCF-7 cell lysates prepared from the pooled population of cells in the sample buffer were fractionated on SDS-PAGE for the detection of AEG-1 protein level.

Patient information and tissue specimens. This study was conducted on a total of 225 paraffin-embedded breast cancer samples, which were histopathologically and clinically diagnosed at the Sun Yat-sen University Cancer Center from 2000 to 2002. Clinical and clinicopathologic classification and staging were determined according to the American Joint Committee on Cancer criteria (17). For the use of these clinical materials for research purposes, prior patients' consents and approval from the Institutional Research Ethics Committee were obtained. Clinical information on the samples is summarized in Table 1 . The percentages of tumor purity in sections adjacent to the regions used for RNA extraction were estimated during routine histopathologic analysis.


View this table:
[in this window]
[in a new window]

 
Table 1. Clinicopathologic characteristics of patient samples and expression of AEG-1 in breast cancer

 
RNA extraction, reverse transcription, and real-time PCR. Total RNA from cells and primary tumor materials was extracted using the Trizol reagent (Invitrogen) according to the manufacturer's instruction. The extracted RNA was pretreated with RNase-free DNase, and 2 µg of RNA from each sample was used for cDNA synthesis primed with random hexamers. For PCR amplification of AEG-1 cDNA, an initial amplification using AEG-1–specific primers was done with a denaturation step at 95°C for 10 min, followed by 28 cycles of denaturation at 95°C for 60 s, primer annealing at 58°C for 30 s, and primer extension at 72°C for 30 s. Upon completion of the cycling steps, a final extension at 72°C for 5 min was done before the reaction was stored at 4°C. Real-time PCR was then employed to determine the fold of increase of AEG-1 mRNA in each of the primary breast tumors relative to the paired normal breast tissue taken from the same patient. Expression data were normalized to the geometric mean of housekeeping gene GAPDH to control the variability in expression levels. Reverse transcription-PCR and real-time PCR primers were designed using the Primer Express v 2.0 software (Applied Biosystems) and the primer sequences are provided in Table 2 .


View this table:
[in this window]
[in a new window]

 
Table 2. Primer sequences used reverse transcription-PCR and real-time quantitative reverse transcription-PCR (5'-3')

 
Western blotting. Cells were harvested in sampling buffer [62.5 mmol/L Tris-HCl (pH 6.8), 10% glycerol, 2% SDS] and heated for 5 min at 100°C. Protein concentration was determined by the Bradford assay using a commercial kit purchased from the Bio-Rad Laboratories. Equal quantities of protein were separated electrophoretically on 10% SDS/polyacrylamide gels and transferred onto polyvinylidene difluoride membranes (Roche). The membrane was probed with a 1:500-diluted anti–AEG-1 rabbit antibody (Zymed). Expression of AEG-1 was determined with horseradish peroxidase–conjugated anti-rabbit IgG (1:3,000) and enhanced chemiluminescence (Pierce) according to the manufacturer's suggested protocols. The membranes were stripped and reprobed with an anti–{alpha}-tubulin mouse monoclonal antibody (1:1,000; Sigma) as a loading control.

Immunohistochemistry. Immunohistochemical analysis was done to study altered protein expression in 225 human breast cancer tissues. In brief, paraffin-embedded specimens were cut into 4-µm sections and baked at 65°C for 30 min. The sections were deparaffinized with xylenes and rehydrated. Sections were submerged into EDTA antigenic retrieval buffer and microwaved for antigenic retrieval. The sections were treated with 3% hydrogen peroxide in methanol to quench the endogenous peroxidase activity, followed by incubation with 1% bovine serum albumin to block nonspecific binding. Rabbit anti–AEG-1 (1:500; Zymed) was incubated with the sections overnight at 4°C. For negative controls, the rabbit anti–AEG-1 antibody was replaced with normal goat serum, or the rabbit anti–AEG-1 antibody was blocked with a recombinant AEG-1 polypeptide by coincubation at 4°C overnight preceding the immunohistochemical staining procedure. After washing, the tissue sections were treated with biotinylated anti-rabbit secondary antibody (Zymed), followed by further incubation with streptavidin-horseradish peroxidase complex (Zymed). The tissue sections were immersed in 3-amino-9-ethyl carbazole and counterstained with 10% Mayer's hematoxylin, dehydrated, and mounted in Crystal Mount.

The degree of immunostaining of formalin-fixed, paraffin-embedded sections was reviewed and scored independently by two observers, based on both the proportion of positively stained tumor cells and the intensity of staining (1820). The proportion of tumor cells was scored as follows: 0 (no positive tumor cells), 1 (<10% positive tumor cells), 2 (10-50% positive tumor cells), and 3 (>50% positive tumor cells). The intensity of staining was graded according to the following criteria: 0 (no staining); 1 (weak staining = light yellow), 2 (moderate staining = yellow brown), and 3 (strong staining = brown). The staining index was calculated as staining intensity score x proportion of positive tumor cells. Using this method of assessment, we evaluated the expression of AEG-1 in benign breast epithelium and malignant lesions by determining the staining index, which scores as 0, 1, 2, 3, 4, 6, and 9. Cutoff values for AEG-1 were chosen on the basis of a measure of heterogeneity with the log-rank test statistical analysis with respect to overall survival. An optimal cutoff value was identified: the staining index score of ≥4 was used to define tumors as high AEG-1 expression and ≤3 as low expression of AEG-1.

Statistical analysis. All statistical analyses were carried out using the SPSS 10.0 statistical software package. Mann-Whitney U test was used to analyze the correlation between AEG-1 expression and the clinicopathologic characteristics. Survival curves were plotted using the Kaplan-Meier method and compared with the log-rank test. The significance of various variables for survival was analyzed by the Cox proportional hazards model in the multivariate analysis. P < 0.05 in all cases was considered statistically significant.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Up-regulation of AEG-1 in breast cancer cells. Western blot analysis showed that AEG-1 protein was highly expressed in all breast cancer cell lines, whereas it was weakly detected in the NBEC breast epithelial cells (Fig. 1A ). To see if the AEG-1 up-regulation was also apparent at the mRNA level, reverse transcription-PCR and real-time reverse transcription-PCR were done. As shown in Fig. 1B and C, in parallel with up-regulation of the AEG-1 protein, the seven breast cancer cell lines unexceptionally showed significantly higher levels of AEG-1 mRNA in comparison with the NBEC cells, increasing by up to 29-fold.


Figure 1
View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Expression analysis of AEG-1 protein and mRNA in NBEC and breast cancer cell lines by Western blotting (A), reverse transcription-PCR (B), and real-time reverse transcription-PCR (C). A, expression of AEG-1 protein in NBEC, cultured breast cancer cell lines (MDA-MB-435, MDA-MB-231, MCF-7, Bcap-37, ZR-75-30, SK-BR-3, and MDA-MB-453), and the MCF-7 breast cancer cell line stably transduced with retroviral vectors expressing AEG-1 RNAi(s) (AEG-1-RNAi#1 and AEG-1-RNAi#2, respectively) or with control vector virus (Vector). B, expression of AEG-1 mRNA in the NBEC and cultured breast cancer cell lines. C, the average ratios of AEG-1 expression quantified by real-time reverse transcription-PCR in the NBEC and breast cancer cell lines. Expression levels were normalized for GAPDH. Columns, mean from three parallel experiments; bars, SD.

 
To validate the specificity of the AEG-1 antibody that we used in Western blot and following immunohistochemical staining experiments, we tested the antibody on MCF-7 cell lines stably transduced with retroviral vectors expressing AEG-1 RNAi(s). Western blotting showed that the antibody detected decreased expression of AEG-1 protein in these cells (Fig. 1A, right). Furthermore, a recombinant AEG-1 polypeptide could completely block the immunohistochemical staining by the AEG-1 antibody, as shown in Fig. 3B. All these results indicate that the AEG-1 antibody used in our study specifically recognizes the AEG-1 protein.


Figure 3
View larger version (90K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. AEG-1 protein is overexpressed in breast cancer histopathologic sections as examined by immunohistochemistry. A, representative images from immunohistochemical assays of 225 archived breast cancer cases, among which 210 cases were detected as positive for AEG-1. AEG-1 staining was mainly localized in the cytoplasm of primary cancer cells. a and b, expression of AEG-1 in normal epithelial cells was only marginally detectable [arrows: original magnification, x200 (a); x400 (b)]. c and d, expression of AEG-1 in the primary lesions of breast cancer [arrows: original magnification, x200 (c); x400 (d)]. e and f, expression of AEG-1 in hepatic metastases of breast cancer [original magnification, x200 (e); x400 (f); arrows, AEG-1 staining in the nucleus of metastatic cancer cells]. B, a validation for the specificity of the antibody against AEG-1. Breast cancer sections were immunostained with the AEG-1 antibody alone (a) or previously coincubated and thereby blocked with a recombinant AEG-1 polypeptide.

 
Overexpression of AEG-1 in primary breast tumors. In order to determine whether the up-regulation of AEG-1 in breast cancer cell lines is clinically correlated with breast cancer progression, we did Western blotting analysis on four pairs of matched normal breast tissue and breast tumor samples. As shown in Fig. 2A , AEG-1 was found to be differentially overexpressed in all four examined human primary breast cancer samples paired with normal breast tissues from the same patients. This finding is consistent with the results obtained in our immunohistochemical analysis (Fig. 2C). Reverse transcription-PCR (Fig. 2B) and real-time reverse transcription-PCR (Fig. 2D) revealed the degrees of AEG-1 mRNA up-regulation in tumor samples. The tumor/normal ratio of AEG-1 message signals in presented Fig. 2B and D varied from approximately 3-fold to 35-fold in the four tissue pairs. These results obtained from clinical samples confirm that higher levels of AEG-1 are expressed in cancer lesions than that in surrounding tumor-adjacent regions.


Figure 2
View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. The expression of AEG-1 is elevated in primary breast tumors as compared with that in human normal breast tissues. A, expression of AEG-1 protein in each of the primary breast tumors (T) and normal breast tissues (N) paired from the same patient by Western blotting. B, reverse transcription-PCR analysis of AEG-1 message expression in each of the primary breast tumors (T) and normal breast tissues (N) paired from the same patient. β-Actin was probed as a loading control. C, AEG-1 expression levels were up-regulated in primary breast tumors (T) in comparison to the paired normal breast tissue (N) from the same patient as examined by immunohistochemistry. D, the average tumor/normal (T/N) ratios of AEG-1 expression quantified by real-time reverse transcription-PCR. Expression levels were normalized for GAPDH. Columns, mean from three parallel experiments; bars, SD.

 
Overexpression of AEG-1 in archived breast tissues. In order to further examine whether AEG-1 protein is overexpressed in clinical samples of breast cancer, we examined 225 paraffin-embedded, archived breast cancer tissues, including 28 cases of stage I, 98 cases of stage II, 66 cases of stage III, and 33 cases of stage IV tumors, as well as 9 cases of matched lung or hepatic metastases derived mostly from patients with relapses of their breast cancers using immunohistochemical staining with an antibody against human AEG-1. As shown in Fig. 3 , AEG-1 protein was detected in 210 of 225 (93.3%) cases. High levels of AEG-1 were present in areas containing cancer cells of the primary breast tumors and metastatic tumors. In contrast, AEG-1 was only marginally detectable in normal breast tissue and in the adjacent noncancerous tissues in all tumor sections. Furthermore, more intense AEG-1 staining was seen in the hepatic metastases derived from patients with late relapses than that in the paired breast primary tumors (Fig. 3A, a). Taken together, these observations show that high levels of AEG-1 expression were associated with the clinical development of primary as well as metastasized breast tumors.

It is of note that although AEG-1 staining was mostly found in the cytoplasm of primary cancer cells, with only a minority of primary cancer cells also stained in the nucleus, metastatic tumors showed a high percentage of AEG-1 staining in the nucleus (Fig. 3A, a and f).

Statistical analyses were done to examine the correlation between AEG-1 expression, as detected by immunohistochemical staining, and the clinicopathologic characteristics of breast cancer. As shown in Table 3 , no correlation was found between the expression level of AEG-1 protein and patient age or expression levels of estrogen receptor, progesterone receptor, and ErbB-2 in patients with breast cancer. In contrast, the expression of AEG-1 is strongly correlated with the clinical staging of patients with breast cancer (P = 0.001). Furthermore, we also found that there were significant differences in AEG-1 expression in patients categorized according to T classification (P = 0.004), N classification (P = 0.026), and M classification (P = 0.001), indicating that advanced clinical stages and T classification were correlated with higher AEG-1 expression. These data were further confirmed by employing the Spearman correlation analysis to test the correlation between AEG-1 expression and the clinicopathologic features. As shown in Table 4 , Spearman correlations of AEG-1 expression level to clinical stage, T classification, N classification, and distal metastasis were 0.229 (P = 0.001), 0.189 (P = 0.004). 0.153 (P = 0.021), and 0.218 (P = 0.001), respectively. Taken as a whole, the expression of AEG-1 protein was positively correlated with clinical staging and TNM classifications.


View this table:
[in this window]
[in a new window]

 
Table 3. Correlation between AEG-1 expression and the clinicopathologic characteristics of the breast cancer patients

 

View this table:
[in this window]
[in a new window]

 
Table 4. Spearman correlation analysis between AEG-1 and clinical pathologic factors

 
Survival analysis. The expression level of AEG-1 protein in breast cancer was significantly correlated with patients' survival time (P < 0.001), with a correlation coefficient of –0.304, clearly indicating that higher levels of AEG-1 expression were associated with shorter survival time (Table 5 ). Kaplan-Meier analysis and the log-rank test were used to calculate the effect of AEG-1 expression and classic clinicopathologic characteristics (including age, clinical staging, T classification, N classification, and distant metastasis) on survival. The log-rank test showed that survival time was significantly different between the low and high AEG-1 expression groups (P < 0.001). As shown in Fig. 4 , the cumulative 5-year survival rate was 75.7% in the low AEG-1 expression group (95% confidence interval, 0.773-0.857), whereas it was only 45.1% in the high AEG-1 expression group (95% confidence interval, 0.377-0.581).


View this table:
[in this window]
[in a new window]

 
Table 5. Univariate and multivariate analyses of various prognostic variables in patients with breast cancer Cox-regression analysis

 

Figure 4
View larger version (10K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Kaplan-Meier curves with univariate analyses (log-rank) for patients with low AEG-1 expression versus high AEG-1 expression tumors. The cumulative 5-y survival rate was 75.7% in the low AEG-1 protein expression group (n = 125; thick line), but it was only 45.1% in the high-expression group (n = 100; dotted line).

 
In addition, we did multivariate survival analysis, which tested AEG-1 expression level, T classification, and N classification to determine whether AEG-1 expression level was an independent prognostic factor of patient outcomes. In this analysis, T classification, N classification, and AEG-1 expression were each recognized as independent prognostic factors (Table 5). Thus, our findings indicate that AEG-1 protein expression level has a significant correlation with the prognosis of breast cancer.


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Our data presented in this report provide, for the first time, evidence that elevated expression of AEG-1 protein is correlated with poor prognosis and reduced survival of patients with breast cancer. In this study, we show that AEG-1 is up-regulated at both mRNA and protein levels, in breast cancer cell lines as compared with NBECs. Paired breast cancer lesions and adjacent noncancer tissues have been found to express AEG-1 differentially, with the cancer lesions displaying significantly higher expression of AEG-1. Furthermore, immunostaining studies indicates that the expression level of AEG-1 protein in histologic sections is significantly correlated with the clinical staging of the disease and reduced survival time of patients with breast cancer. Taken together, our study suggests that AEG-1 might represent a novel indicator for the prognosis of breast cancer.

Previous studies have shown that AEG-1 is a Ha-ras–regulated gene (11). As supported by a large body of evidence, oncogenic Ha-ras modulates signaling pathways that control a variety of cellular responses key to cancer development, including cell proliferation, survival and differentiation, and deregulation of the Ha-ras gene has been found to be involved in the formation and progression of various human cancers (21, 22). Such oncogenic activities of Ha-ras are believed to be mediated by the activation of one or more of several signaling pathways, such as the phosphatidylinositol-3-kinase/Akt pathway, the Raf/mitogen-activated protein kinase pathway, the Rac/Rho pathway, the Rac/c-Jun-NH2-kinase, and Rac/p38 pathways, which subsequently activate effector genes or proteins (23, 24). It is of note that whereas some of these effector molecules have been found and intensively studied, many remain unknown and yet to be identified. In this context, Lee et al. reported that AEG-1 expression was inducible by Ha-ras, possibly through activation of the phosphatidylinositol-3-kinase pathway that causes c-Myc to bind to the E-box elements of the AEG-1 promoter and consequently up-regulates AEG-1 transcription (11). These studies have provided new insights into the potential role of AEG-1 in the development and progression of human cancers. Nonetheless, whether the expression of AEG-1 is in parallel with the course of carcinogenesis and cancer progression, and thereby could be used as an indicator of cancer progression, remains to be clarified. Although a number of recent reports found AEG-1 up-regulation in solid tumors, including melanoma, breast cancer, brain tumor, and prostate cancer, the relatively small sample size (20-51 cases) used in these studies limited an effective evaluation of AEG-1 expression as a prognosis biomarker (6, 12).

In this study, we have shown that both the mRNA and protein levels of AEG-1 were markedly higher in breast cancer cell lines than in NBECs. Reverse transcription-PCR and real-time PCR analysis have shown 3-fold to 35-fold increase of the AEG-1 message in primary breast tumors (T), as compared with the paired normal breast tissues (N) taken from the same patients. Moreover, we examined the status of AEG-1 expression in a larger number of breast cancer tissue specimens. As determined by immunohistochemical analysis, 210 of 225 (93.3%) paraffin-embedded archival breast cancer biopsies displayed moderate to strong cytoplasmic staining of AEG-1 in tumor cells, whereas no significant staining of AEG-1 was detected in the adjacent noncancerous epithelial cells, supporting the notion that AEG-1 might play a role in the development and progression of breast cancer. Further analysis of the relationship between AEG-1 staining and the clinical characteristics of patients has shown a significant correlation of AEG-1 expression with the clinical staging as well as T, N, and M classification, although it is not correlated with the age and status of estrogen receptor, progesterone receptor, or ErbB-2 expression in patients with breast cancer, strongly suggesting that AEG-1 might be useful as an independent marker to identify subsets of breast cancer patients with more aggressive disease. Moreover, patients in an AEG-1–high expression group revealed a 45.1% cumulative 5-year survival rate, which was significantly lower than that in AEG-1–low expression patients (75.7%), suggesting the possibility of using AEG-1 as a predictor for patient prognosis and survival.

It is particularly noteworthy that AEG-1 has been found, in our study, to be mainly localized in the cytoplasm of cancer cells. Meanwhile, we have also found that nuclear staining of AEG-1 tends to become more common in lesions from patients with more advanced disease stages. Although occasional nuclear staining of AEG-1 was detected in clinical stage II samples, and stage III sections displayed noticeably increased AEG-1 nuclear localization, a large proportion of cancer cells in liver metastases revealed AEG-1 translocation to the nucleus. This observation coincides with the previous reports that overexpression of AEG-1 resulted in the localization of the protein both in the cytoplasm and in the nucleus (10, 13). AEG-1 has been found to interact with the NF-{kappa}B complex, corresponding with the nuclear translocation of p65 (10). Moreover, it was recently reported that knockdown of AEG-1 attenuated the constitutive activity of NF-{kappa}B in parallel with a depletion in NF-{kappa}B–regulated genes (12). It has also been suspected that the activation of NF-{kappa}B by AEG-1 is possibly via the degradation of I{kappa}B{alpha} (10). Consistent with these findings, our data further support that the dysfunction of AEG-1 may play an important role in promoting carcinogenesis and progression of breast cancer. Apparently, further studies are needed to verify these findings to establish AEG-1 as a prognostic marker in breast cancer and to clarify its role in carcinogenesis and progression by functional analysis.

In conclusion, this is the first study aimed at evaluating the possibility of using AEG-1 as a clinically relevant indicator for disease progression and as a prognostic marker for patient survival in breast cancer. In combination with other biomarkers of breast cancer, in addition, AEG-1 expression status may be useful for evaluating the effectiveness of novel therapeutic strategies against breast cancer and for developing rational criteria for the selection of treatments. Toward this end, further investigation on the mechanism by which AEG-1 is involved in the development and progression of breast cancer and prospective studies on the prognostic significance of AEG-1 are needed.


    Footnotes
 
Grant support: Ministry of Science and Technology of China grants (973)2005CB724605 and 30771110, Ministry of Science and Technology of Guangdong Province, China grants 07001503 and 2006Z3-E4081, Guangdong Nature Science Foundation (group), and a key grant from the 985-II Project.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: J. Li, N. Zhang, and L-B. Song contributed equally to this work.

Received 8/28/07; revised 12/16/07; accepted 12/26/07.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Parkin DM. Global cancer statistics in the year 2000. Lancet Oncol 2001;2:532–42.
  2. Robbins P, Pinder S, de Klerk N, et al. Histological grading of breast carcinomas: a study of interobserver agreement. Hum Pathol 1995;26:873–9.[CrossRef][Medline]
  3. Elston CW, Ellis IO. Pathological prognostic factors in breast cancer. I. The value of histological grade in breast cancer: experience from a large study with long-term follow-up. Histopathology 1991;19:403–10.[Medline]
  4. Galea MH, Blamey RW, Elston CE, et al. The Nottingham Prognostic Index in primary breast cancer. Breast Cancer Res Treat 1992;22:207–19.[CrossRef][Medline]
  5. Fitzgibbons PL, Page DL, Weaver D, et al. Prognostic factors in breast cancer. College of American Pathologists Consensus Statement 1999. Arch Pathol Lab Med 2000;124:966–78.[Medline]
  6. Brown DM, Ruoslahti E. Metadherin. a cell surface protein in breast tumors that mediates lung metastasis. Cancer Cell 2004;5:365–74.[CrossRef][Medline]
  7. Su ZZ, Kang DC, Chen Y, et al. Identification and cloning of human astrocyte genes displaying elevated expression after infection with HIV-1 or exposure to HIV-1 envelope glycoprotein by rapid subtraction hybridization, RasH. Oncogene 2002;21:3592–602.[CrossRef][Medline]
  8. Su ZZ, Chen Y, Kang DC, et al. Customized rapid subtraction hybridization (RasH) gene microarrays identify overlapping expression changes in human fetal astrocytes resulting from human immunodeficiency virus-1 infection or tumor necrosis factor—a treatment. Gene 2003;306:67–78.[CrossRef][Medline]
  9. Kang DC, Su ZZ, Sarkar D, et al. Cloning and characterization of HIV-1-inducible astrocyte elevated gene-1, AEG-1. Gene 2005;353:8–15.[CrossRef][Medline]
  10. Emdad L, Sarkar D, Su ZZ, et al. Activation of the nuclear factor {kappa}B pathway by astrocyte elevated gene-1: implications for tumor progression and metastasis. Cancer Res 2006;66:1509–16.[Abstract/Free Full Text]
  11. Lee SG, Su ZZ, Emdad L, et al. Astrocyte elevated gene-1 (AEG-1) is a target gene of oncogenic Ha-ras requiring phosphatidylinositol 3-kinase and c-Myc. Proc Natl Acad Sci U S A 2006;103:17390–5.[Abstract/Free Full Text]
  12. Kikuno N, Shiina H, Urakami S, et al. Knockdown of astrocyte-elevated gene-1 inhibits prostate cancer progression through upregulation of FOXO3a activity. Oncogene 2007;[Epub ahead of print].
  13. Emdad L, Sarkar D, Su ZZ, et al. Astrocyte elevated gene-1: recent insights into a novel gene involved in tumor progression, metastasis and neurodegeneration. Pharmacol Ther 2007;114:155–70.[CrossRef][Medline]
  14. Liao WT, Wang HM, Li MZ, et al. Establishment of three-dimensional culture models related to different stages of nasopharyngeal carcinogenesis. Ai Zheng 2005;24:1317–21.[Medline]
  15. Corsaro A, Thellung S, Russo C, et al. Expression in E. coli and purification of recombinant fragments of wild type and mutant human prion protein. Neurochem Int 2002;41:55–63.[CrossRef][Medline]
  16. Hahn WC, Dessain SK, Brooks MW, et al. Enumeration of the simian virus 40 early region elements necessary for human cell transformation. Mol Cell Biol 2002;22:2111–23.[Abstract/Free Full Text]
  17. Greene FL, Page DL, Fleming ID, et al. Breast cancer. in AJCC cancer staging handbook. TNM classification of malignant tumors. 6th ed. New York: Springer Verlag; 2002. pp. 255–81.
  18. Song LB, Liao WT, Mai HQ, et al. The clinical significance of twist expression in nasopharyngeal carcinoma. Cancer Lett 2006;242:257–64.[CrossRef]
  19. Geisler SA, Olshan AF, Weissler MC, et al. p16 and p53 protein expression as prognostic indicators of survival and disease recurrence from head and neck cancer. Clin Cancer Res 2000;8:3445–53.
  20. Fukuoka J, Fuji T, Shih JH, et al. Chromatin remodeling factors and BRM/BRG1 expression as prognostic indicators in non-small cell lung cancer. Clin Cancer Res 2004;10:4314–24.[Abstract/Free Full Text]
  21. Schubbert S, Shannon K, Bollag G. Hyperactive Ras in developmental disorders and cancer. Nat Rev Cancer 2007;7:295–308.[CrossRef][Medline]
  22. Graham K, Olson MF. The ras signalling pathway as a target in cancer therapy. Recent Results Cancer Res 2007;172:125–53.[Medline]
  23. Rodriguez-Viciana P, Tetsu O, Oda K, et al. Cancer targets in the Ras pathway. Cold Spring Harb Symp Quant Biol 2005;70:461–7.[CrossRef][Medline]
  24. Schubbert S, Bollag G, Shannon K. Deregulated Ras signaling in developmental disorders: new tricks for an old dog. Curr Opin Genet Dev 2007;17:15–22.[CrossRef][Medline]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
C. Yu, K. Chen, H. Zheng, X. Guo, W. Jia, M. Li, M. Zeng, J. Li, and L. Song
Overexpression of astrocyte elevated gene-1 (AEG-1) is associated with esophageal squamous cell carcinoma (ESCC) progression and pathogenesis
Carcinogenesis, May 1, 2009; 30(5): 894 - 901.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. J. Thirkettle, J. Girling, A. Y. Warren, I. G. Mills, K. Sahadevan, H. Leung, F. Hamdy, H. C. Whitaker, and D. E. Neal
LYRIC/AEG-1 Is Targeted to Different Subcellular Compartments by Ubiquitinylation and Intrinsic Nuclear Localization Signals
Clin. Cancer Res., May 1, 2009; 15(9): 3003 - 3013.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Li, H.-Y. Guan, L.-Y. Gong, L.-B. Song, N. Zhang, J. Wu, J. Yuan, Y.-J. Zheng, Z.-S. Huang, and M. Li
Clinical Significance of Sphingosine Kinase-1 Expression in Human Astrocytomas Progression and Overall Patient Survival
Clin. Cancer Res., November 1, 2008; 14(21): 6996 - 7003.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, J.
Right arrow Articles by Li, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, J.
Right arrow Articles by Li, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online