Clinical Cancer Research CR Surrogrates AACR Membership
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Clinical Cancer Research 14, 4085, July 1, 2008. doi: 10.1158/1078-0432.CCR-07-4404
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chiou, S.-H.
Right arrow Articles by Lo, J.-F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chiou, S.-H.
Right arrow Articles by Lo, J.-F.

Human Cancer Biology

Positive Correlations of Oct-4 and Nanog in Oral Cancer Stem-Like Cells and High-Grade Oral Squamous Cell Carcinoma

Shih-Hwa Chiou1,4, Cheng-Chia Yu1, Chi-Yang Huang8, Shu-Chun Lin1, Chung-Ji Liu6, Tung-Hu Tsai2,5, Shiu-Huey Chou7, Chian-Shiu Chien4, Hung-Hai Ku3 and Jeng-Fan Lo1,5

Authors' Affiliations: Institutes of 1 Oral Biology, 2 Traditional Medicine, and 3 Anatomy and Cell Biology, National Yang-Ming University; 4 Department of Medical Research and Education, Taipei Veterans General Hospital, Taipei; 5 Department of Education and Research, Taipei City Hospital; 6 Department of Oral and Maxillofacial Surgery, Mackay Memorial Hospital; 7 Department of Life Science, Fu-Jen University, Taipei, Taiwan, Republic of China and 8 Graduate Institute of Chinese Medical Science and Institute of Medical Science, China Medical University, Taichung, Taiwan, Republic of China

Requests for reprints: Jeng-Fan Lo, Institute of Oral Biology, National Yang-Ming University, No. 155, Section 2, Li-Nung Street, Taipei 11217, Taiwan, Republic of China. Phone: 886-2-28267222; Fax: 886-2-28264053; E-mail: jflo{at}ym.edu.tw.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Purpose: Oral squamous cell carcinoma (OSCC), like many solid tumors, contains a heterogeneous population of cancer cells. Recent data suggest that a rare subpopulation of cancer cells, termed cancer stem cells (CSC), is capable of initiating, maintaining, and expanding the growth of tumor. Identification and characterization of CSC from OSCC facilitates the monitoring, therapy, or prevention of OSCC.

Experimental Design: We enriched oral cancer stem-like cells (OC-SLC) through sphere formation by cultivating OSCC cells from established OSCC cell lines or primary cultures of OSCC patients within defined serum-free medium. Differential expression profile of stemness genes between enriched OC-SLC and parental OSCC was elucidated. Furthermore, immunohistochemical staining of stemness markers on OSCC patient tissues was examined to evaluate the association between stemness genes and prognosis of OSCC.

Results: Enriched OC-SLC highly expressed the stem/progenitor cell markers and ABC transporter gene (Oct-4, Nanog, CD117, Nestin, CD133, and ABCG2) and also displayed induced differentiation abilities and enhanced migration/invasion/malignancy capabilities in vitro and in vivo. Elevated expression of CD133 was shown in the enriched OC-SLC from OSCC patients' tumors. Positive correlations of Oct-4, Nanog, or CD133 expression on tumor stage were shown on 52 OSCC patient tissues. Kaplan-Meier analyses exhibited that Nanog/Oct-4/CD133 triple-positive patients predicted the worst survival prognosis of OSCC patients.

Conclusion: We enriched a subpopulation of cancer stem-like cell from OSCC by sphere formation. The enriched OC-SLC possesses the characteristics of both stem cells and malignant tumors. Additionally, expression of stemness markers (Nanog/Oct-4/CD133) contradicts the survival prognosis of OSCC patients.


Head and neck squamous cell carcinoma, including oral squamous cell carcinoma (OSCC), is the sixth most prevalent malignancy worldwide and the third most common cancer in developing nations (1, 2). The prognosis of OSCC remains dismal because more than 50% of patients die of this disease or complications within 5 years under current therapies (3).

Recent data show that cancer cells are functionally heterogeneous that undergo not only proliferation but also differentiation and maturation to a certain degree (46). In addition, each tumor contains a small subpopulation of cells that exhibit self-renewal capacity—the purported cancer stem cells (CSC; refs. 46). Heterogeneity of OSCC has been reported (7, 8). However, the putative CSC from OSCC has not been well characterized (7, 8). Thus, to uncover the existence of CSC and identify the CSC markers of OSCC, the monitoring, therapy, prevention of tumor metastasis, or relapse of OSCC should be facilitated.

Isolation of CSC from solid tumors has been successfully done through three distinct methodologies based on the properties of CSC (46). First, isolation of CSC is made possible by flow cytometry according to CSC-specific cell surface markers such as CD44 or CD133 (911). For instance, the CSC of colon cancer are isolated by cell sorting with CD133+ cells (11), despite CD133 is first identified from hematopoietic stem cells (12), and the function of CD133 has not been uncovered thus far (13). Second, the side populations of tumor tissues or cancer cells, which may cause chemoresistance, also display intracellular Hoechst 33342 exclusion in vitro and is isolated and characterized as CSC (1417). Expression of ABCG2, an ATPase transporter, is found closely associated with the side population phenotype (15). Nevertheless, the ABCG2+ and ABCG2- cancer cells are similarly tumorigenic (18). Third, the sphere body formation of CSC is enriched under the cultivation of defined serum-free medium with growth factors from individual solid tumors or cancer cells (1921) where the serum-free culture condition helps maintain the CSC undifferentiated (19).

CSC derived from glioblastomas cultured in basic fibroblast growth factor (bFGF) and epidermal growth factor (EGF) mirror the phenotype and genotype of primary tumors more closely than do serum-cultured cell lines (19). Others have reported that CSC-like cells can be isolated from the established cancer cell lines by culturing these cells in defined serum-free medium with selected growth factors such as platelet-derived growth factor, bFGF, and EGF (14, 21). Further studies evaluating the relatedness of these established cell line–derived "stem-like" cells to their parental tumors and a thorough phenotypic/genotypic characterization of these cells would ultimately be required to truly understand how closely they fulfill the criteria of CSC.

Oct-4, a member of the family of POU domain transcription factors, is expressed in pluripotent embryonic stem and germ cells (2224). Oct-4 mRNA is normally found in the inner cell mass of the blastocyst (25). Afterward, the expression of Oct-4 is down-regulated during differentiation, suggesting that Oct-4 plays a pivotal role in the mammalian development (26). Knocking out the Oct-4 gene in mice causes early lethality due to the lack of inner cell mass formation, indicating the critical function of Oct-4 for self-renewal of embryonic stem cells (27). Nanog, another transcriptional factor, also plays a critical role in regulating the cell fate of the pluripotent inner cell mass during embryonic development (28). In vitro, Nanog mRNA is enriched in pluripotent cell lines such as embryonic stem, embryonic germ, and embryonic carcinoma cells but not in adult tissues (28). On differentiation of these pluripotent cells, Nanog expression is down-regulated. In Oct-4-deficient embryos, Nanog expression can be readily detected by mRNA in situ hybridization, suggesting that Nanog can be maintained without Oct-4 (28). These findings indicate that other pluripotent factors may contribute to the regulation of Nanog expression.

To further investigate the role of these two stemness/self-renewal genes Oct-4 and Nanog in stem-like cells derived from OSCC, we firstly showed significant phenotypic differences between parental OSCC and derived oral cancer stem-like cells (OC-SLC) being cultured under defined serum-free medium containing bFGF and EGF. Secondly, the isolated OC-SLC highly expressed the stem cell markers [Oct-4, Nestin, Nanog, CD117 (c-Kit), and CD133] and also up-regulated anticancer drug transporter, ABCG2. Thirdly, the capabilities of migration/invasion/malignancy in enriched OC-SLC were significantly increased in vitro and in vivo. Finally, immunohistochemical staining of Oct-4, Nanog, and CD133 on oral cancer patients' tissues further suggests that Nanog may be a better survival prognosis marker in OSCC patients.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Cell lines and isolation of OC-SLC from OSCC. Two oral cancer cell lines, SAS and OECM1, were derived from OSCC. Primary culture of normal human oral keratinocytes (NHOK) was as described (29). Originally, SAS was grown in DMEM, and OECM1 was grown in RPMI supplemented with 10% fetal bovine serum. The two cell lines were then cultured in tumor sphere medium consisting of serum-free DMEM/F-12, N2 supplement, 10 ng/mL human recombinant bFGF, and 10 ng/mL EGF. Cells were plated at a density of 7.5 x 105 live cells/10 mm dish, and the medium was changed every other day until the sphere formation was observed in about 4 weeks.

Real-time reverse transcription-PCR. Total RNA of parental oral cancer cells or derived OC-SLC was purified. Briefly, the total RNA (1 µg) of each sample was reversely transcribed by SuperScript II RT (Invitrogen). Then, the amplification was carried out in a total volume of 20 µL containing 0.5 µmol/L of each primer, 4 mmol/L MgCl2, 2 µL LightCycler-FastStart DNA Master SYBR Green I (Roche Molecular Systems), and 2 µL of 1:10 diluted cDNA. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) housekeeping gene was amplified as a reference standard. GAPDH primers were designed: GAPDH (forward): GGGCCAAAAGGGTCATCATC (nucleotides 414-434; GenBank accession no. BC059110.1) and GAPDH (reverse): ATGACCTTGCCCACAGCCTT (nucleotides 713-733). PCR was prepared in duplicate and heated to 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 55°C for 5 s, and extension at 72°C for 20 s.

Immunofluorescence staining for stem cell markers. In brief, cells plated onto poly-L-ornithine-coated glass coverslips or frozen sections of OSCC tumor tissues were fixed with 4% paraformaldehyde and then washed with PBS. Cells were permeabilized with 0.1% Triton X-100/PBS for 10 min. Consequently, the cells were incubated with primary antibodies (Nestin, Oct-4, Nanog, or CD133; Chemicon). The immunoreactive signals were detected with a mixture of biotinylated rabbit anti-mouse IgG and Fluoesave (Calbiochem). Cells were further probed with FITC- or phycoerythrin-tagged secondary antibodies. The fluorescence intensity was recorded by inverted fluorescence microscope equipped with CCD camera and the percentage of fluorescence signal per photographed field was analyzed by Image process software (Image Pro-Plus).

Fluorescence-activated cell sorting analysis. For OC-SLC surface marker identification, single-cell suspension from trypsinized spheres was stained with anti-CD133, CD117 (c-Kit), or ABCG2 and secondary FITC- or phycoerythrin-coupled antibodies (DAKO) and analyzed by FACSCalibur apparatus (Becton Dickinson).

Radiation treatment for cell viability analysis. The {gamma}-radiation (ionizing irradiation) was delivered by Theratronic cobalt unit T-1000 (Theratronic International) at a dose rate of 1.1 Gy/min (SSD = 57.5 cm). Cells were seeded on 24-well plates at a density of 2 x 104 per well in medium, after ionizing irradiation for 24 h, and analyzed by the MTT assay (Sigma-Aldrich).

Conditions for in vitro keratinocyte-lineage differentiation. Sphere cells of OC-SLC enriched from defined serum-free medium after 10 weeks were cultivated with regular laboratory 10% serum-containing medium. Consequently, the morphologically changed cells of spheres after 3 weeks of culture were stained for keratinocytes marker CK18 by immunofluorescent staining.

In vitro cell invasion analysis. The 24-well plate Transwell system with a polycarbonate filter membrane of 8 µm pore size (Corning) was employed to evaluate the invasion ability of the parental OSCC and derived OC-SLC. The membrane was coated with Matrigel. The cancer cell suspensions were seeded to the upper compartment of the Transwell chamber at the cell density of 1x105 in 100 µL serum-free medium. The lower chamber was filled with serum-free medium. After 24 h of incubation, the medium was removed and the filter membrane was fixed with 4% formalin for 1 h. Subsequently, the remaining cells of the filter membrane faced the lower chamber was stained with Hoechst 33342. The migrated cancer cells were then visualized and counted from five different visual areas of 100-fold magnification under an inverted microscope.

Soft-agar assay. Each well (35 mm) of a six-well culture dish was coated with 2 mL bottom agar mixture [DMEM, 10% (v/v) FCS, 0.6% (w/v) agar]. After the bottom layer was solidified, 2 mL top agar-medium mixture [DMEM, 10% (v/v) FCS, 0.3% (w/v) agar] containing 2 x 104 cells was added, and the dishes were incubated at 37°C for 4 weeks. Plates were stained with 0.005% crystal violet, and the colonies were counted. Statistical analysis was done by Student's t test.

In vivo tumorigenic assay. All the animal practices in this study were in accordance with the institutional animal welfare guideline of Taipei Veterans General Hospital. To investigate the tumor growth and dissemination effect of oral CSC, the parental and OC-SLC of SAS cell line (1 x 104-2 x 105) or OSCC primary cultures were injected into the oral mucosa of BALB/c nude mice (8 weeks). The tumor volume was calculated according to the formula: (length x width2) / 2.

Primary tumor sphere culture. OSCC tumor samples were obtained from consenting patients. After washed, tumors were dissociated as described previously (30). Tumor cells were then resuspended in defined serum-free medium consisting of serum-free DMEM/F-12, N2 supplement, 10 ng/mL human recombinant bFGF, and 10 ng/mL EGF.

Immunohistochemistry. Between 1994 and 1997, 52 consecutive patients with operable oral cancer underwent surgery at the Department of Oral and Maxillofacial Surgery, Mackay Memorial Hospital. This research follows the tenets of the Declaration of Helsinki and all samples were obtained after informed consent from the patients. None of the subjects received radiation therapy or chemotherapy before surgery. The tissue samples with different stages of oral cancer from 52 patients were spotted on glass slides for immunohistochemical stainings. After deparaffinization and rehydration, the tissue sections were processed with antigen retrieval by boiling the slides in sodium citrate buffer (10 mmol/L, pH 6.0). The slides were immersed in 3% H2O2 for 10 min and washed with PBS three times. The tissue sections were then blocked with serum (Vestastain Elite ABC kit; Vector Laboratories) for 30 min followed by incubating with the primary antibody, anti-Oct-4, or anti-Nanog antibodies (Chemicon) in PBS solution at room temperature for 2 h in a container. Tissue slides were washed with PBS and incubated with biotin-labeled secondary antibody for 30 min and then incubated with streptavidin-horseradish peroxidase conjugates for 30 min and washed with PBS three times. Afterwards, the tissue sections were immersed with chromogen 3,3'-diaminobenzidine plus H2O2 substrate solution (Vector DBA/Ni substrate kit, SK-4100; Vector Laboratories) for 10 min. Hematoxylin was applied for counterstaining. Finally, the tumor sections were mounted with a cover slide with Gurr (BDH Laboratory Supplies) and examined under a microscope. Two pathologists scoring the immunohistochemistry were blinded to the clinical data. The interpretation was done in five high-power views for each slide, and 100 cells per view were counted for analysis.

Statistical analysis. Statistical Package of Social Sciences software (version 13.0) was used for statistical analysis. The independent Student's t test or ANOVA was used to compare the continuous variables between groups, whereas the {chi}2 test was applied for the comparison of dichotomous variable. The Kaplan-Meier estimate was used for survival analysis, and the log-rank test was selected to compare the cumulative survival durations in different patient groups. The level of statistical significance was set at 0.05 for all tests.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Isolation and cultivation of OC-SLC from OSCC cells. To investigate the existence of OC-SLC in different stages of oral cancers cells, two oral cancer cell lines, SAS (high malignancy and metastasis) and OECM1 (less malignancy), and primary culture of NHOK were used and cultured in defined serum-free medium with bFGF and EGF. After being cultured for 2 weeks, cancer cells gradually detached from culture dishes, aggregated, and formed sphere-like bodies (data not shown). Significant sphere-like bodies were observed after 3 weeks of serum-free medium culture [Fig. 1A , SAS (top) and OECM1 (middle)]. In contrast to OSCC, less and smaller sphere-like bodies were enriched from NHOK cells under the serum-free medium culture. In addition, the sphere-like bodies enriched from NHOK cells started dying after the second week [Fig. 1A, NHOK (bottom)]. The self-proliferation potential and the ability of primary spheroid body formation of OC-SLC from SAS and OECM1 were measured weekly. The results showed that proliferation activity and the formation number of new sphere-like bodies in OC-SLC of SAS were higher than those in OC-SLC of OECM1 (Supplementary Fig. S1A and S1B).


Figure 1
View larger version (60K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Enhanced expression of progenitor/stem cell genes in cultivated and enriched OC-SLC from OSCC. A, two oral cancer cell lines, SAS (top) and OECM1 (middle), and primary culture NHOK cells (bottom) were used and cultured in DMEM/F-12 serum-free medium with bFGF and EGF. After being in culture for 3 wk, cancer cells gradually detached from culture dishes, aggregated, and formed sphere-like bodies (SB). Increase of the volume of sphere-like body from the two OC-SLC was observed with longer cultivation (4 wk). The sphere-like bodies enriched from NHOK cells started dying after the second week. Bottom right, magnification. B, total RNA was purified from parental OSCC [SAS, OECM1, and OC3 (a less tumorigenic OSCC cells than SAS or OECM1)] or derived OC-SLC, and the elevated expression of Oct-4, Nanog, and Nestin genes in derived OC-SLC was detected by real-time reverse transcription-PCR analysis, respectively. Folds are the ratio of gene expression in OC-SLC/parental (S/P). Mean ± SD of triplicate samples from one representative experiment. C, total proteins were prepared from parental OSCC or sphere-like body cells and analyzed by immunoblotting with anti-Oct-4, anti-Nanog, anti-Nestin, or anti-GAPDH antibodies as indicated. The amount of GAPDH protein of different crude cell extracts was referred as loading control. D, for immunofluorescence analysis, parental and enriched OC-SLC from SAS cells were stained with anti-Oct-4 (top), anti-Nestin (middle), or anti-Nanog, respectively, to detect the intracellular level of Oct-4, Nestin, and Nanog proteins. P, parental; S, OC-SLC. Magnification, x200.

 
Elevated expression of progenitor/stem cell genes in OC-SLC. Expression of progenitor/stem cell genes such as Oct-4, Nanog, and Nestin was examined transcriptionally and translationally. Total RNA of parental cells or sphere-like body cells enriched with 1 week of serum-free medium culture from SAS, OECM1, and NHOK were purified. The amounts of Oct-4, Nanog, and Nestin transcripts of enriched OC-SLC were significantly increased compared with that of the parental OSCC cells by reverse transcription-PCR analysis, respectively (Supplementary Fig. S1C). Real-time reverse transcription-PCR analysis further confirmed the increase of Oct-4, Nanog, and Nestin transcripts in our enriched OC-SLC (Fig. 1B). Additionally, OC-SLC enriched from the third OSCC, OC3 (the least malignancy of the three OSCC), also showed enhanced expression of Oct-4, Nanog, and Nestin genes by real-time reverse transcription-PCR (Fig. 1B). In accordance with the real-time reverse transcription-PCR results, the Western blotting data showed that the protein levels of Oct-4, Nanog, and Nestin in enriched OC-SLC were also up-regulated compared with those of parental cancer cell lines [Fig. 1C, SAS (left) and OECM1 (middle)]. Furthermore, immunofluorescent staining displayed that the intracellular levels of Oct-4 (Fig. 1D, top), Nestin (Fig. 1D, middle), and Nanog (Fig. 1D, bottom) in the OC-SLC derived from SAS cells were dramatically increased compared with those in the parental cells. Stained fluorescence intensity quantitated from Fig. 1D showed significant elevation of Oct-4, Nanog, and Nestin genes in enriched OSCC OC-SLC (Supplementary Fig. S1D). The Nestin protein was detectable in both parental and sphere-like bodies of NHOK cells that could be caused by the contamination of basal cells (progenitor cells of skin tissue) during the primary culture processing. However, the sphere-like bodies of NHOK cells did not show elevated expression of above stemness genes (Fig. 1C, right).

Characterization of progenitor/stem cell properties in isolated OC-SLC. To further characterize the progenitor/stem cells properties of our enriched OC-SLC, we used flow cytometry to detect the expression profile of progenitor/stem cell surface markers. As shown in Fig. 2A , for SAS (top) and OECM1 (bottom) cells, respectively, we detected that the majority of isolated OC-SLC (after 3 months of serum-free culture) were positively stained with CD133 and CD117 (c-Kit), both being the specific cell surface markers of normal/tumor stem cells. Interestingly, we also detected most of the enriched OC-SLC from SAS and OECM1 were ABCG2 positive [Fig. 2A, SAS (top right) and OECM1 (bottom right)]. Around 60% of OC-SLC derived from both SAS and OECM1 cells stained positively with CD133, CD117, and ABCG2, respectively, whereas enriched OC-SLC were kept long-term within defined serum-free medium (Fig. 2B; P < 0.05). To assess the radiation susceptibility of parental cells and derived OC-SLC, we treated SAS and SAS OC-SLC with up to 10 Gy radiation doses to evaluate the cell viability. The SAS OC-SLC were more radioresistant compared with the parental SAS cells (Fig. 2C; P < 0.05). Next, the sphere-like bodies of OC-SLC were grown by replacing the defined serum-free medium with 10% serum-containing medium. We observed that the sphere-like bodies of SAS OC-SLC gradually became flattened as the parental SAS cells (Fig. 2D). OC-SLC maintained within the regular 10% serum-containing medium displayed enhanced expression of keratinocyte-specific marker, CK18 (Fig. 2E). These results confirmed that our enriched OC-SLC contain stem cell surface markers, are more radioresistant, and have the abilities for proliferation, self-renewal, and potential to differentiate keratinocyte-lineage cells.


Figure 2
View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Expression profile of progenitor/stem cell–specific surface markers, radioresistant property, and keratinocyte-lineage differentiation ability of enriched OC-SLC. A, expression profiles of progenitor/stem cell–specific surface markers including CD133, CD117, and ABCG2 in parental cells or derived OC-SLC (top, SAS; bottom, OECM1) were analyzed by flow cytometry. Single-cell suspension from parental cells or derived OC-SLC was either stained with control IgG antibody or experimental antibodies including anti-CD133 (left), CD117 (middle), and anti-ABCG2 (right). Solid line, parental cell stained with control anti-IgG; dashed line, parental cells stained with experimental antibodies; gray filled (SAS; top) or black filled (OECM1; bottom), parental derived OC-SLC stained with experimental antibodies. B, percentages of positive staining signals of CD133, CD117, and ABCG2 in parental SAS cells (solid columns) and the SAS OC-SLC (open columns) or OECM1 cells (gray columns) and the OECM1 OC-SLC (patched columns) were compared, respectively. Mean ± SD of triplicate samples from one representative experiment. *, P < 0.05. C, susceptibility of SAS parental cells and SAS derived OC-SLC to {gamma}-radiation was evaluated. For the evaluation of cell proliferation rate, cells were treated with {gamma}-radiation up to 10 Gy, and after 24 h, the survived cells were measured by MTT assay as described in Materials and Methods. Mean ± SD of triplicate samples from one representative experiment. *, P < 0.05. D, sphere-like bodies of SAS OC-SLC were grown by replacing the defined serum-free medium with 10% serum medium. The sphere-like bodies of SAS OC-SLC became flattened as the parental SAS cells with longer cultivation. E, original sphere-like body cells from D and the flattened cells cultured within the 10% serum-containing medium after 3 weeks were stained with keratinocyte-specific marker, CK18. Bottom, magnification.

 
Enhanced tumorigenicity of isolated OC-SLC by in vitro invasion and soft-agar foci formation assay. To evaluate the enhancement of tumorigenicity of isolated OC-SLC, in vitro Matrigel combined Transwell invasion and soft-agar colony formation assays were examined. Substantially, the isolated OC-SLC from both SAS and OECM1 cells showed higher invasion activity through Matrigel Transwell invasion assay (Fig. 3A ; P < 0.05). Similarly, the foci formation ability of the two OC-SLC from both OSCC was enhanced when compared with that of the parental cells (Fig. 3B; P < 0.01). Interestingly, while being plated with the same cell number during the foci formation assay, the parental SAS cells showed similar colony formation ability to the OC-SLC enriched from OECM1 cells (Fig. 3B).


Figure 3
View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Elevation of the tumorigenicity of OC-SLC in vitro and in vivo. To elucidate the capabilities of invasion/foci formation of parental OSCC and derived OC-SLC, single-cell suspension of OSCC or OC-SLC were plated onto Matrigel coated Transwell (A) or soft agar (B) and analyzed as described in Materials and Methods. Mean ± SD of triplicate samples from one representative experiment. *, P < 0.05; **, P < 0.01. C, in vivo tumorigenicity of parental SAS and derived OC-SLC was examined by xenotransplantation analysis as described in Materials and Methods. D, histologic examination of the oral cavity and survival analysis of tumor-bearing nude mice. Tumor or normal tissue (control group) were sectioned and stained with H&E dye. Bottom right, cell number injected into the nude mice. Histologic confirmation of metastatic foci in oral cavity. Black arrows, tumors; white arrowheads, formation of neovascularization. Top right, magnification. E, total tumor volume in nude mice injected with the parental SAS cells (solid column) or OC-SLC (open column) was compared. *, P < 0.05. F, survival curves of mice injected with the parental SAS cells (solid circle with solid line) or derived OC-SLC (open circle with dashed line) were examined as described in Materials and Methods. **, P < 0.01.

 
Elevated in vivo tumorigenicity of OC-SLC. To further confirm the enriched tumor-initiating abilities of OC-SLC in vivo, the parental SAS cells and OC-SLC derived from SAS cells were injected into the oral cavity of nude mice for transplanted tumorigenicity analysis. As shown in Fig. 3C, SAS parental cells gave rise to a new tumor at 1 x 105 in only one of three mice. However, SAS OC-SLC generated tumor when only 1 x 104 cells (two of three mice) were injected into mice, suggesting that SAS OC-SLC were enriched for tumor-initiating cells by at least 10-fold. The histologic studies also showed that the proliferation ability of OC-SLC was significantly higher than that of parental cells (Fig. 3D). In addition, massive neovascularization formation and aggressive invasion ability were observed in the multiple tumor foci of the OC-SLC group (Fig. 3D). The tumor foci formation, size, and volume of OC-SLC were significantly higher than those of parental cells (Fig. 3D and E; P < 0.05). Furthermore, infiltration of OC-SLC from the oral mucosa to tongue was also observed (data not shown). Moreover, the mean survival rate of OC-SLC group was significantly lower than that of the parental SAS cells by survival curve analysis (Fig. 3F; P < 0.01).

Isolation and characterization of OC-SLC enriched from OSCC patients' tumors. Cultivated within defined serum-free medium, the primary culture cells isolated from OSCC patients' tumors formed sphere-like bodies (OC-SLC) in 1 week of culture (Fig. 4A ). The sphere formation rate of OC-SLC from OSCC patients' tumor is faster than that of OC-SLC from established OSCC cancer cells (comparing the data from Figs. 1A and 4A). In addition, enhanced expression of CD133 was showed in OC-SLC enriched from the five OSCC primary culture cells by flow cytometry analysis (Fig. 4B). To further determine the in vivo tumorigenic activity of the enriched OC-SLC and parental tumor cells of each patient, we injected respective amounts of 1,000, 3,000, and 104 cells of each pair into the backs of severe combined immunodeficient mice. The results showed that 104 parental tumor cells from four of the five OSCC patients did not induce tumor formation, but 3,000 OC-SLC from the oral cancer tissues of five patients in xenotransplanted mice all generated visible tumors 4 weeks after injection (Fig. 4B).


Figure 4
View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Isolation and characterization of OC-SLC enriched from OSCC patients' tumors. A, representative results of sphere-like bodies (OC-SLC) formation by cultivating primary culture cells isolated from OSCC patients' tumors with defined serum-free medium. B, characterization of enhanced stem cell properties of OC-SLC from OSCC patients by xenotransplantation assay or flow cytometry analysis.

 
Oct-4, Nanog, and CD133 immunohistochemistry study in OSCC patients. To further investigate the expression of Oct-4, Nanog, and CD133 in the patients with different grades of oral cancers, we established the ontogeny of Oct-4, Nanog, and CD133 expression by immunohistochemical staining with a panel of specimens array of 52 oral cancer patients [Fig. 5A , Oct-4 (top), Nanog (middle), and CD133 (bottom)]. The results showed that increased occurrence of Oct-4 expression was positively correlated with the advanced stages and medium to poor differentiation of oral cancers but not lymph node metastasis (Fig. 5A; Supplementary Table S1). Additionally, more nuclear staining of Oct-4 was also observed in grades III and IV oral cancer tissues than in grades I and II tissues (Supplementary Fig. S2A; P < 0.05). Similarly, elevated expression of Nanog or CD133 was also positively associated with high-grade oral and medium to poor differentiated cancer patients (Fig. 5A; Supplementary Fig. S2B; P < 0.05, Supplementary Fig. S2C; P < 0.05, Supplementary Tables S2 and S3).


Figure 5
View larger version (71K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Correlation of Oct-4 or Nanog expression to the clinical grading or predicted survival rate of the oral cancers patients. A, representative results of immunohistochemistry staining of Oct-4 (top), Nanog (middle), and CD133 (bottom) in 52 oral cancer patients with different stages (left, high grade; right, low grade) were shown. Arrows, positive staining of nuclear Oct-4 or Nanog (top and middle) or cytosolic CD133 (bottom) in different oral cancer tissues. Top right, magnification. Kaplan-Meier analysis of overall survival in 52 oral cancer patients according to clinical stages (B; P = 0.06), single Oct-4+ expression (C; *, P < 0.05), single Nanog+ expression (D; **, P < 0.01), single CD133+ expression (E; *, P < 0.05), combined expression of Oct-4+/Nanog+ (F; ***, P < 0.0001), and combined expression of Oct-4+/Nanog+/CD133+ (G; ***, P < 0.0001). Inset boxes, groups [Oct-4-/Nanog- (F) and Oct-4-/Nanog-/CD133- (G)] used as reference group for comparison.

 
Poor overall survival rate of oral cancer patients was positively associated with Oct-4, Nanog, and CD133 expression. To determine the prognostic significance of Oct-4, Nanog, and CD133 expression in patients with oral cancer, Kaplan-Meier survival analysis was done. Firstly, we did not find significant difference for the 5-year survival prognosis between high-grade and low-grade oral cancer patients according to the histologic analysis (Fig. 5B; P = 0.06). Secondly, the results of Kaplan-Meier survival analysis showed that the Oct-4 immunohistochemistry-positive cases were associated with a considerably worse overall survival rate compared with the negative ones (Fig. 5C; P < 0.05). Thirdly, with regard to Nanog expression, our results showed that patients with less Nanog expression favored better survival prognosis compared with the Nanog highly expressed patients (Fig. 5D; P < 0.01). Fourthly, CD133+ patients predicted a worse survival prognosis (Fig. 5E; P < 0.05). Taken together, these results supported that elevated expression of Oct-4, Nanog, and CD133 was strongly associated with advanced stage of oral cancer and worse prognosis (Fig. 5C-E). Significantly, patients with single-positive staining of Nanog (P < 0.01) predicted the worst survival compared with the other patients with either Oct-4 (P < 0.05) or CD133 (P < 0.05) single-positive staining (Fig. 5C-E). Considering the expression of Oct-4 or Nanog for oral cancer patients survival prognosis analysis, we found that Oct-4-/Nanog+ patients showed the worse survival rate compared with the Oct-4+/Nanog- patients (Fig. 5E; P < 0.05). Patients with double-positive Oct-4 and Nanog expressions were associated with a worse survival rate compared with other oral cancer patients (Fig. 5E; Oct-4+/Nanog+ group versus Oct-4-/Nanog- group; P < 0.0001). In addition, patients with triple-positive (Oct-4/Nanog/CD133) predicted the worst survival rate compared with other oral cancer patients (Fig. 5G; Oct-4+/Nanog+/CD133+ versus other groups). Overall, these data indicated that Nanog expression in the oral cancer patients could be a more critical factor in predicting the disease progression and clinical outcomes.

Intracellular localization of Oct-4, Nanog, and CD133 in OSCC patients' tumors. To examine the subcellular localization of Oct-4, Nanog, and CD133 in OSCC patients' tumor, immunofluorescent staining of Oct-4, Nanog, and CD133 was done. Both Oct-4 and Nanog proteins were positively stained within the nucleus of the OSCC tumors, and CD133 was positively stained mainly in the cytosol or membrane (Fig. 6 ). Dual staining of Oct-4/Nanog (Fig. 6, top), CD133/Oct-4 (Fig. 6, middle), and D133/Nanog (Fig. 6, bottom) indicated that Oct-4 and Nanog proteins were colocalized within the nucleus of OSCC tumor; however, not every CD133+ stained cell was costained with either Oct-4 or Nanog (Fig. 6, middle and bottom).


Figure 6
View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Intracellular localization of Oct-4, Nanog, and CD133 in OSCC patients' tumors. The subcellular localization of Oct-4, Nanog, and CD133 in OSCC patients' tumor were examined by immunofluorescence staining. Frozen sections of OSCC tumor tissues were first incubated with primary antibodies (Nestin, Oct-4, Nanog, or CD133) and then further probed with FITC- or phycoerythrin-tagged secondary antibodies. DAPI staining located the nuclei of tissues. Dual staining of Oct-4/Nanog (top), CD133/Oct-4 (middle), or D133/Nanog (bottom) was done to evaluate the colocalization among Oct-4, Nanog, and CD133.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Self-renewal plus undifferentiated status, and capability to differentiate into heterogeneous mature cell types, are the hallmarks of stem/progenitor cells (46). Oct-4 and Nanog has been suggested as two of four major factors that render the reprogramming capability of adult cells into germ-line-competent induced pluripotent stem cells (3133). Recently, the expression of Oct-4 and Nanog has been shown in human breast cancer stem-like cells, suggesting that its expression may be implicated in self-renewal and tumorigenesis via activating its downstream target genes (34). Consistent with these findings, ectopic expression of Oct-4 in a heterologous cell system transforms nontumorigenic cells and endows tumorigenicity in nude mice, suggesting the possibility that aberrant expression of Oct-4 may contribute to the neoplastic process in cells (35). Functionally, Nanog blocks differentiation; inversely, dedifferentiation is one of the characteristics during tumorigenesis (36). In addition, the clinical survey showed that elevated expression of Nanog has been related to retinoblastoma, prostate cancer, embryonal carcinoma, metastatic germ cell tumor, and ovarian cancer (3741). Taken together, these findings indicated that the abnormal expression of Oct-4 and/or Nanog in stem cell and tumor tissues might play a vital role in tumor transformation, tumorigenicity, and tumor metastasis (4244).

In the present study, we successfully enriched OC-SLC, a subpopulation of CSC from OSCC through serum-free cultivation (Figs. 1A and 4). Our OSCC-derived cells (OC-SLC) displayed stem/progenitor cell properties. For example, the enriched OC-SLC were stained positively for stem cell markers (Oct-4, Nanog, CD133, and CD117) and ATPase transporter (ABCG2) by immunofluorescent staining or fluorescence-activated cell sorting analysis (Figs. 1B-D, 2A and B, and 4B). The individual percentage (~60%) of the three cell surface markers was similarly consistent with fluorescence-activated cell sorting analysis, suggesting that our enriched OC-SLC mirrored the similarity of CSC isolated from other solid tumor cells (46). Prince et al. have purified the CSC from head and neck squamous cell carcinoma by selecting the CD44+ cells (45). The expression of CD44 is elevated in metastatic cells (46), and the CD44+ cells represent the CSC population of breast cancer (9). However, our enriched OC-SLC down-regulated the expression of CD44 as evidenced by flow cytometry analysis (data not shown). Wright et al. have shown that Brca1 breast tumors contain distinct CD44+/CD24- and CD133+ cells with CSC characteristics (47). The reasonable explanation for enhanced expression of CD133 and down-regulation of CD44 in our enriched OC-SLC is that both CD133 and CD44 could be the distinct markers of CSC in HNSCC. However, the serum-free cultivation mainly enriched the CD133+ CSC. It is interesting that although we could enrich the OC-SLC to form almost 95% of sphere-like bodies after long-term culture of OSCC up to 3 months in serum-free medium, the expression of CD133 of enriched OC-SLC was still around 60% instead of 90%. We believe that the long-term cultured sphere-like bodies are still composed of heterogeneous population of cells.

Following the above observations, we did the immunohistochemistry analysis of Oct-4, Nanog, and CD133 to elucidate the relationship between the expressions of the above stemness genes and oral cancer patients. Importantly, there were significant associations between expression of Oct-4, Nanog, and CD133 genes and stages or patients' survival in our cases (Fig. 5A; Supplementary Tables S1 and S2). All these results indicated that elevated expression of Oct-4, Nanog, or CD133 was positively associated with late-stage progression and worse prognosis of the oral cancer patients (Fig. 5A; Supplementary Tables S1 and S2). These data confirmed that both the expression of Oct-4 and Nanog can be important prognosis markers for oral cancer. Furthermore, Kaplan-Meier analyses showed that enhanced expression of Nanog predicted a worse prognosis of OSCC patients when compared with that of Oct-4 expression. Taken together, the up-regulation of Oct-4 and Nanog in our enriched OC-SLC implicates that activation of Oct-4 and Nanog might play an important role in maintaining the self-renewal property of CSC. Further research to explore how OC-SLC activates Nanog pathway is essential.

In conclusion, our data showed that OC-SLC possess both the characteristics of stem cells and malignant tumors, and these CSC-like properties in OSCC and other cancers should be warranted in the future translational oncology with the ultimate objective of improving anticancer therapy. In addition, expression of Nanog should be a better survival prognosis marker in OSCC patients.


    Disclosure of Potential Conflicts of Interest
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
No potential conflicts of interest were disclosed.


    Acknowledgments
 
We thank Dr. K.W. Chang (Institute of Oral Biology, National Yang-Ming University) for providing critical comment.


    Footnotes
 
Grant support: National Science Council grants NSC95N444, NSC963111B075001, and 962628B010006MY3; Taipei Veterans General Hospital grants V95E2007, V95B2013, V96ER2016, and V97ER2018; Joint Projects of UTVGH grant VGHUST95P105; Yen-Tjing-Ling Medical Foundation; Taipei City Hospital grants 9600162014, 9600162018, and 9600262092; and National Yang-Ming University (Ministry of Education, Aim for the Top University Plan; 96ADD122; Taiwan).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/).

S-H. Chiou and C-C. Yu contributed equally to this work.

Received 9/20/07; revised 2/17/08; accepted 3/19/08.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Chen YJ, Lin SC, Kao T, et al. Genome-wide profiling of oral squamous cell carcinoma. J Pathol 2004;204:326–32.[CrossRef][Medline]
  2. Pentenero M, Gandolfo S, Carrozzo M. Importance of tumor thickness and depth of invasion in nodal involvement and prognosis of oral squamous cell carcinoma: a review of the literature. Head Neck 2005;27:1080–91.[CrossRef][Medline]
  3. Lo WL, Kao SY, Chi LY, et al. Outcomes of oral squamous cell carcinoma in Taiwan after surgical therapy: factors affecting survival. J Oral Maxillofac Surg 2003;61:751–8.[CrossRef][Medline]
  4. Jordan CT, Guzman ML, Noble M. Cancer stem cells. N Engl J Med 2006;355:1253–61.[Free Full Text]
  5. Dalerba P, Cho RW, Clarke MF. Cancer stem cells: models and concepts. Annu Rev Med 2007;58:267–84.[CrossRef][Medline]
  6. Clarke MF, Dick JE, Dirks PB, et al. Cancer stem cells—perspectives on current status and future directions: AACR workshop on cancer stem cells. Cancer Res 2006;66:9339–44.[Free Full Text]
  7. Costea DE, Tsinkalovsky O, Vintermyr OK, et al. Cancer stem cells—new and potentially important targets for the therapy of oral squamous cell carcinoma [review]. Oral Dis 2006;12:443–54. Erratum in: Oral Dis 2006;12:584.[CrossRef][Medline]
  8. Locke M, Heywood M, Fawell S, et al. Retention of intrinsic stem cell hierarchies in carcinoma-derived cell lines. Cancer Res 2005;65:8944–50.[Abstract/Free Full Text]
  9. Al-Hajj M, Wicha MS, Benito-Hernandez A, et al. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 2003;100:3983–8.[Abstract/Free Full Text]
  10. Singh SK, Hawkins C, Clarke ID, et al. Identification of human brain tumour initiating cells. Nature 2004;432:396–401.[CrossRef][Medline]
  11. Ricci-Vitiani L, Lombardi DG, Pilozzi E, et al. Identification and expansion of human colon-cancer-initiating cells. Nature 2007;445:111–5.[CrossRef][Medline]
  12. Miraglia S, Godfrey W, Yin AH, et al. A novel five-transmembrane hematopoietic stem cell antigen: isolation, characterization, and molecular cloning. Blood 1997;90:5013–21.[Abstract/Free Full Text]
  13. Neuzil J, Stantic M, Zobalova R, et al. Tumour-initiating cells vs. cancer "stem" cells and CD133: what’s in the name? Biochem Biophys Res Commun 2007;355:855–9.[CrossRef][Medline]
  14. Kondo T, Setoguchi T, Taga T. Persistence of a small subpopulation of cancer stem-like cells in the C6 glioma cell line. Proc Natl Acad Sci U S A 2004;101:781–6.[Abstract/Free Full Text]
  15. Dean M, Fojo T, Bates S. Tumor stem cells and drug resistance. Nat Rev Cancer 2005;5:275–84.[CrossRef][Medline]
  16. Chiba T, Kita K, Zheng YW, et al. Side population purified from hepatocellular carcinoma cells harbors cancer stem cell-like properties. Hepatology 2006;44:240–51.[CrossRef][Medline]
  17. Szotek PP, Pieretti-Vanmarcke R, Masiakos PT, et al. Ovarian cancer side population defines cells with stem cell-like characteristics and Mullerian inhibiting substance responsiveness. Proc Natl Acad Sci U S A 2006;103:11154–9.[Abstract/Free Full Text]
  18. Patrawala L, Calhoun T, Schneider-Broussard R, et al. Side population is enriched in tumorigenic, stem-like cancer cells, whereas ABCG2+ and ABCG2- cancer cells are similarly tumorigenic. Cancer Res 2005;65:6207–19.[Abstract/Free Full Text]
  19. Lee J, Kotliarova S, Kotliarov Y, et al. Tumor stem cells derived from glioblastomas cultured in bFGF and EGF more closely mirror the phenotype and genotype of primary tumors than do serum-cultured cell lines. Cancer Cell 2006;9:391–403.[CrossRef][Medline]
  20. Singh SK, Clarke ID, Terasaki M, et al. Identification of a cancer stem cell in human brain tumors. Cancer Res 2003;63:5821–8.[Abstract/Free Full Text]
  21. Bao S, Wu Q, McLendon RE, et al. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature 2006;444:756–60.[CrossRef][Medline]
  22. Okamoto K, Okazawa H, Okuda A, et al. A novel octamer binding transcription factor is differentially expressed in mouse embryonic cells. Cell 1990;60:461–72.[CrossRef][Medline]
  23. Rosner MH, Vigano MA, Ozato K, et al. A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 1990;345:686–92.[CrossRef][Medline]
  24. Burdon T, Smith A, Savatier P. Signalling, cell cycle and pluripotency in embryonic stem cells. Trends Cell Biol 2002;12:432–8.[CrossRef][Medline]
  25. Boiani M, Scholer HR. Regulatory networks in embryo-derived pluripotent stem cells. Nat Rev Mol Cell Biol 2005;6:872–84.[CrossRef][Medline]
  26. Pesce M, Wang X, Wolgemuth DJ, et al. Differential expression of the Oct-4 transcription factor during mouse germ cell differentiation. Mech Dev 1998;71:89–98.[CrossRef][Medline]
  27. Nichols J, Zevnik B, Anastassiadis K, et al. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 1998;95:379–91.[CrossRef][Medline]
  28. Chambers I, Colby D, Robertson M, et al. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003;113:643–55.[CrossRef][Medline]
  29. Lu SY, Chang KW, Liu CJ, et al. Ripe areca nut extract induces G1 phase arrests and senescence-associated phenotypes in normal human oral keratinocyte. Carcinogenesis 2006;27:1273–84.[Abstract/Free Full Text]
  30. Lin SC, Liu CJ, Chiu CP, et al. Establishment of OC3 oral carcinoma cell line and identification of NF-{kappa}B activation responses to areca nut extract. J Oral Pathol Med 2004;33:79–86.[CrossRef][Medline]
  31. Okita K, Ichisaka T, Yamanaka S. Generation of germline-competent induced pluripotent stem cells. Nature 2007;448:313–7.[CrossRef][Medline]
  32. Yu J, Vodyanik MA, Smuga-Otto K, et al. Induced pluripotent stem cell lines derived from human somatic cells. Science 2007;318:1917–20.[Abstract/Free Full Text]
  33. Park IH, Zhao R, West JA, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008;451:141–6.[CrossRef][Medline]
  34. Ezeh UI, Turek PJ, Reijo RA, et al. Human embryonic stem cell genes OCT4, NANOG, STELLAR, GDF3 are expressed in both seminoma and breast carcinoma. Cancer 2005;104:2255–65.[CrossRef][Medline]
  35. Gidekel S, Pizov G, Bergman Y, et al. Oct-3/4 is a dose-dependent oncogenic fate determinant. Cancer Cell 2003;4:361–70.[CrossRef][Medline]
  36. Abelev GI, Lazarevich NL. Control of differentiation in progression of epithelial tumors. Adv Cancer Res 2006;95:61–113.[CrossRef][Medline]
  37. Seigel GM, Hackam AS, Ganguly A, Mandell LM, Gonzalez-Fernandez F. Human embryonic and neuronal stem cell markers in retinoblastoma. Mol Vis 2007;13:823–32.[Medline]
  38. Santagata S, Ligon KL, Hornick JL. Embryonic stem cell transcription factor signatures in the diagnosis of primary and metastatic germ cell tumors. Am J Surg Pathol 2007;31:836–45.[CrossRef][Medline]
  39. Gu G, Yuan J, Wills M, Kasper S. Prostate cancer cells with stem cell characteristics reconstitute the original human tumor in vivo. Cancer Res 2007;67:4807–15.[Abstract/Free Full Text]
  40. Freberg CT, Dahl JA, Timoskainen S, Collas P. Epigenetic reprogramming of OCT4 and NANOG regulatory regions by embryonal carcinoma cell extract. Mol Biol Cell 2007;18:1543–53.[Abstract/Free Full Text]
  41. Hoei-Hansen CE, Kraggerud SM, Abeler VM, Kaern J, Rajpert-De Meyts E, Lothe RA. Ovarian dysgerminomas are characterised by frequent KIT mutations and abundant expression of pluripotency markers. Mol Cancer 2007;2:6–12.
  42. Trosko JE. From adult stem cells to cancer stem cells: Oct-4 Gene, cell-cell communication, and hormones during tumor promotion. Ann N Y Acad Sci 2006;1089:36–58.[CrossRef][Medline]
  43. Pan G, Thomson JA. Nanog and transcriptional networks in embryonic stem cell pluripotency. Cell Res 2007;17:42–9.[CrossRef][Medline]
  44. Ratajczak MZ, Machalinski B, Wojakowski W, Ratajczak J, Kucia M. A hypothesis for an embryonic origin of pluripotent Oct-4(+) stem cells in adult bone marrow and other tissues. Leukemia 2007;21:860–7.[Medline]
  45. Prince ME, Sivanandan R, Kaczorowski A, et al. Identification of a subpopulation of cells with cancer stem cell properties in head and neck squamous cell carcinoma. Proc Natl Acad Sci U S A 2007;104:973–8.[Abstract/Free Full Text]
  46. Hill A, McFarlane S, Johnston PG, et al. The emerging role of CD44 in regulating skeletal micrometastasis. Cancer Lett 2006;237:1–9.[CrossRef][Medline]
  47. Wright MH, Calcagno AM, Salcido CD, et al. Brca1 breast tumors contain distinct CD44+/CD24- and CD133+ cells with cancer stem cell characteristics. Breast Cancer Res 2008;10:R10. Epub ahead of print.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Stem CellsHome page
C. R. Jeter, M. Badeaux, G. Choy, D. Chandra, L. Patrawala, C. Liu, T. Calhoun-Davis, H. Zaehres, G. Q. Daley, and D. G. Tang
Functional Evidence that the Self-Renewal Gene NANOG Regulates Human Tumor Development
Stem Cells, May 1, 2009; 27(5): 993 - 1005.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
P. S. Knoepfler
Deconstructing Stem Cell Tumorigenicity: A Roadmap to Safe Regenerative Medicine
Stem Cells, May 1, 2009; 27(5): 1050 - 1056.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chiou, S.-H.
Right arrow Articles by Lo, J.-F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chiou, S.-H.
Right arrow Articles by Lo, J.-F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online