Clinical Cancer Research Versailles No Abst Advances in Breast Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Clinical Cancer Research 14, 446, January 15, 2008. doi: 10.1158/1078-0432.CCR-07-1189
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hassan, S.
Right arrow Articles by Basik, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hassan, S.
Right arrow Articles by Basik, M.

Imaging, Diagnosis, Prognosis

Plasma Stromal Cell–Derived Factor-1: Host Derived Marker Predictive of Distant Metastasis in Breast Cancer

Saima Hassan1, Andrea Baccarelli2, Ombretta Salvucci3 and Mark Basik1

Authors' Affiliations: 1 Departments of Oncology and Surgery, Lady Davis Institute, Sir Mortimer B. Davis Jewish General Hospital, McGill University, Montreal, Quebec, Canada; 2 EPOCA Epidemiology Research Center, Center of Molecular and Genetic Epidemiology, University of Milan and IRCCS Maggiore Policlinico Hospital, Mangiagalli and Regina Elena, Milan, Italy; and 3 Laboratory of Cellular Oncology, Center for Cancer Research, National Cancer Institute, Bethesda, Maryland

Requests for reprints: Mark Basik, Department of Oncology, Lady Davis Institute, Sir Mortimer B. Davis Jewish General Hospital, McGill University, 3755 Cote Ste Catherine, Montreal, Quebec, Canada H3T 1E2. Phone: 514-340-8222, ext. 4930; Fax: 514-340-8716; E-mail: mark.basik{at}mcgill.ca.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Purpose: Homing of breast cancer cells to metastatic sites may be regulated by the production of stromal cell–derived factor (SDF)-1 by specific target organs, which attracts CXCR4-expressing breast cancer cells. We investigated the value of SDF-1 as a predictive blood marker of distant metastasis in breast cancer, together with a common polymorphism of SDF-1, SDF-1-3'A.

Experimental Design: Plasma samples were collected prospectively for 270 consecutive primary breast cancer patients with a median follow-up of 3.3 years. Plasma SDF-1 levels were measured using an ELISA, and the polymorphism was identified via PCR-RFLP analysis.

Results: Plasma SDF-1 levels were divided into two groups, low and high, based on the median SDF-1 value of 2,661 pg/mL. Patients with low SDF-1 showed an increased risk of developing distant metastasis (relative risk, 1.94; P = 0.02) and poorer breast cancer–specific survival [adjusted hazard ratio (AHR), 3.92; P = 0.007]. Patients with both low plasma SDF-1 levels and the SDF-1-3'A polymorphism showed a poorer breast cancer–specific survival (AHR, 3.98; P = 0.001) and distant disease-free survival (AHR, 2.88; P = 0.003). In a separate cohort of 22 breast cancer patients, we found no significant difference in SDF-1 levels before and posttumor resection.

Conclusion: We found that low plasma SDF-1 is an independent host-derived predictive marker of distant metastasis in breast cancer. The prognostic value of the combination of a low plasma SDF-1 level and the SDF-1-3'A polymorphism identifies a cohort of patients with an intrinsic susceptibility for poorer survival.


Although the prognosis of patients with breast cancer has improved in recent years due to advancements in adjuvant therapy and earlier diagnosis, ~12% of breast cancer patients die of the disease within the first 5 years.4 Most patients receive adjuvant treatment to eradicate micrometastatic disease, depending on prognostic markers such as tumor size, grade, hormone receptor status, and most importantly, the presence of metastatic disease in axillary lymph nodes (13). Lymphatic metastasis is, in fact, a surrogate marker for distant metastatic disease, the major determinant of long-term survival (4, 5). Currently, there is no direct marker predictive of distant metastatic efficiency for individual breast cancers (6). One of the reasons for this is that the study of the metastatic process in humans has lagged behind advances in knowledge about molecular changes of the tumor cell. Although the process of metastasis has been dissected into various components, little is known about the factors that lead to the selection of the tumor cell of a particular organ for metastasis and less about any host factors that may influence the metastatic process (7).

In 2001, Muller et al. (8) proposed a model for metastasis analogous to the manner in which chemokines attract immune cells to sites of inflammation. It was suggested that specific chemokines, secreted by particular target organs to which breast cancer metastasizes, serve to home in circulating breast cancer cells that express receptors for these chemokines. They identified one such chemokine/receptor pair as stromal cell–derived factor (SDF)-1/CXCR4. Tumor cells, including breast cancers, were found to express high levels of the CXCR4 receptor, whereas human organs targeted by metastatic breast tumor cells, in turn, expressed high levels of SDF-1 (8). Moreover, the level of CXCR4 expression in breast cancer cells is predictive of poor prognosis, suggestive of distant metastatic disease, in breast cancer (9). Thus, it seems plausible that the gradient between SDF-1 in the blood and SDF-1 in the target organs may influence the development of distant metastasis in breast cancer. Indeed, SDF-1 is a powerful chemoattractant secreted in the bone marrow, functioning to retain progenitor stem cells within the bone marrow (10). Analogously, we hypothesized that high plasma SDF-1 levels in the blood will serve to retain tumor cells within the circulation and out of the metastatic organ site, and thus, low plasma SDF-1 levels will serve as a predictive marker for distant metastasis. Moreover, SDF-1 mRNA and protein expression may be regulated by a common polymorphism of SDF-1, a G->A transition at position 801 in the 3' untranslated region of the SDF-1 gene transcript, also known as SDF-1-3'A (11, 12). The SDF-1-3'A polymorphism is associated with an increased susceptibility to develop breast cancer (13, 14), although its functional significance in breast cancer is presently unknown (11, 12, 15). Measurement of plasma SDF-1 in breast cancer has not been reported to date, nor has its predictive potential of distant metastasis been described in cancer. We measured SDF-1 levels in the blood and the SDF-1-3'A polymorphism in lymphocytes from a cohort of consecutive breast cancer patients. We found that SDF-1 plasma levels and the SDF-1-3'A polymorphism are both host-derived markers that can determine an individual's intrinsic susceptibility to develop metastatic disease in breast cancer.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Patients. From 2000 to 2003, blood samples from 270 consecutive patients with primary stage I, II, and III breast tumors were collected prospectively at the Centre Hospitalier de l'Université de Montréal (CHUM) as part of a provincially supported tumor bank (Fonds de la recherche en santé du Québec), in which all patients signed informed consent as part of the approval by the Research Ethics Committee of the CHUM. Baseline characteristics for all patients can be found in Table 1 . A small proportion (13.7%) of patients received neoadjuvant hormonal or chemotherapy. As no postoperative blood collection was done in this cohort, a second cohort of 22 consecutive primary breast cancer patients at the Sir Mortimer B. Davis Jewish General Hospital, McGill University, underwent plasma collection in K-EDTA tubes from 2004 to 2006, approved by the Research Ethics Committee of the Sir Mortimer B. Davis Jewish General Hospital, both before surgery, and at a median follow-up of 7 months after surgical resection.


View this table:
[in this window]
[in a new window]

 
Table 1. Baseline characteristics of patients (N = 270)

 
Plasma SDF-1 measurement and SDF-1-3'A genotyping. Plasma was collected for all patients on the day of surgery in K-EDTA tubes, processed with Ficoll-Paque Plus (Amersham Biosciences) to obtain lymphocytes, and stored at –80°C. Plasma SDF-1 levels were measured using Quantikine Colorimetric ELISA kits for CXCL12 (R&D Systems), in duplicate trials in triplicate wells. The mean coefficient of variation of the ELISA assay for six replicates was 6.8%. From the six values obtained for each patient, the median value was taken. SDF-1-3'A genotyping was done with DNA extracted from lymphocytes using DNAzol (Invitrogen). Primers used were as follows: (F) CAGTCAACCTGGGCAAAGCC and (R) AGCTTTGGTCCTGAGAGTCC (11). PCR amplification was carried out as per protocol (14, 16), except the annealing temperature was modified to 62°C to decrease nonspecific annealing. PCR products were digested with MspI restriction enzyme at 37°C for at least 4 h; fragments were then visualized on a 3% agarose gel with ethidium bromide. The PCR products for the three genotypes were as follows: wild-type GG, two discrete fragments at 100 and 200 bps; homozygous AA, one fragment at 300 bps, and heterozygous AG; 3 fragments at 100, 200, and 300 bps (16).

Statistical analysis. {chi}2 analysis and Fisher's exact test were done to determine associations between SDF-1 plasma levels and polymorphism with clinicopathologic properties; Fisher's exact test was used when the number of samples were ≤5. To further understand directionality of the correlations and an estimation of their magnitude, Spearman's rank correlation was also done, wherein plasma SDF-1 was treated as a continuous variable and the SDF-1 polymorphism as an ordinal variable; the coefficient of correlation is represented by the {rho} value. Correlation between plasma SDF-1 levels and the genotype was done using one-way ANOVA. Survival analysis of plasma SDF-1 was carried out by examining the plasma levels as both a dichotomous variable, using the median SDF-1 value as an arbitrary dividing point, and as a continuous variable. To obtain cutpoint(s) of plasma SDF-1 levels that may be more clinically relevant, prognosis-derived cutpoints were also determined using X-tile, Version 3.6.1 (Robert Camp, Yale University of New Haven, CT; ref. 17). Survival intervals were measured from the time of surgery to the time of death or the first clinical or radiographic evidence of local recurrence or distant metastasis. The primary end points included overall survival, breast cancer–specific survival, disease-free survival (DFS; local or distant metastasis), and distant disease-free survival (DDFS). Because this is the first report of plasma SDF-1 levels in breast cancer patients, an a priori sample size could not be determined. Kaplan-Meier survival curves were constructed for univariate analysis (n = 270). To examine the effect of multiple covariates, a Cox proportional hazards regression model was used (18) and adjustment for age, tumor size, lymph nodes, tumor grade, estrogen receptor (ER), progesterone receptor (PR), and therapy (neoadjuvant or adjuvant hormonal or chemotherapy) was done. In the multivariate model, the categorical form of lymph node status, tumor grade, ER, PR, and therapy was used, whereas a linear trend was used for age and tumor size. Patients for whom lymphadenectomies were not done were included as a separate category. Fifty patients were excluded in multivariate analysis due to incomplete information regarding clinicopathologic characteristics. A survival analysis was done to compare the outcome of the patients with missing variables to those patients with complete information. No statistically significant difference between these groups was identified for overall survival, breast cancer–specific survival, DFS, or DDFS. Proportional hazards assumptions for all cox models were assessed using Schoenfeld residuals, and goodness of fit was graphically estimated using Cox-Snell residuals. The preoperative and postoperative blood study was designed to have a 90% power to detect a difference of 239 pg/mL before and post tumor excision, based on the difference observed between those patients who did and did not develop metastasis from the first cohort (see below). An unpaired t test was used to compare the preoperative plasma SDF-1 levels between the two cohorts. A paired t test compared the difference between the preoperative and postoperative plasma SDF-1 values. All reported P values were two sided. P values <0.05 were considered statistically significant. All statistical analysis was done using STATA Version 9.2.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Plasma SDF-1 levels. Two hundred seventy consecutive patients with primary breast cancer underwent surgery at the CHUM and were followed-up for a median of 3.3 years. Ten patients (3.7%) developed local recurrence, whereas 47 patients (17.4%) developed distant metastasis during follow-up. Plasma SDF-1 levels in these patients followed a Gaussian distribution and ranged from 726 to 4,238 pg/mL. Plasma SDF-1 levels were divided into two groups, low (<2,661 pg/mL) and high (≥2,661 pg/mL), based on the median SDF-1 value of 2,661 pg/mL for the patients in this cohort. Correlations with the clinicopathologic characteristics were done as described in Table 2 . Low plasma SDF-1 levels were associated with a younger age at the time of surgery (P = 0.01). There was a nonsignificant trend of an increased frequency of T4 tumors in patients with low SDF-1 levels, although only 11 patients had T4 tumors. A weak but inverse correlation was also identified between plasma SDF-1 and nodal status ({rho} = –0.15; P = 0.02). Patients who eventually developed distant metastasis had a lower mean SDF-1 value than those who did not develop metastasis [mean difference, 237 pg/mL; 95% confidence interval (95% CI), 78-395 pg/mL; P = 0.004]. The sensitivity of low plasma SDF-1 levels for distant metastasis was 66%, and the specificity was 53.4%. Low plasma SDF-1 levels were predictive of distant metastasis (relative risk, 1.94; 95% CI, 1.11-3.37; P = 0.02). Low plasma SDF-1 level was also an independent prognostic marker for poorer breast cancer–specific survival (adjusted hazard ratio, 3.92; 95% CI, 1.46-10.51; P = 0.007) and DDFS (adjusted hazard ratio, 2.27; 95% CI, 1.12- 4.61; P = 0.02) but was not significant for DFS, which includes local and distant recurrence (Table 3 ). When evaluated as a continuous variable, for every decrease in 1,000 pg/mL of plasma SDF-1, the rate of mortality due to breast cancer was 3.22 (95% CI, 1.76-5.88; P < 0.001). To identify a cutpoint that may stratify patients into groups that are validated and may have greater clinical application, optimal cutpoint analysis was done using X-tile software. Three groups were identified with the following SDF-1 levels and population proportions: Lo (≤2295 pg/mL), 22.2%; Mid (2296-2557 pg/mL), 20.4%; and Hi (>2557 pg/mL), 57.4%. The relative risk of patients dying from breast cancer was found to be 5.17-fold greater in the Lo versus Hi group (Monte Carlo, P = 0.03; Cross-validation Hi/Lo, P = 0.007; Fig. 1 ). No statistically significant correlation was identified with plasma SDF-1 levels and other comorbid conditions including previous history of cancer, coronary artery disease, arrhythmias, gastroesophageal reflux disease, hypertension, hypercholesterolemia, diabetes mellitus, arthritis, hypothyroidism, or chronic respiratory disease. There was a higher proportion of high plasma SDF-1 levels in patients with coronary artery disease (85.7%; P = 0.01), but this condition was only present in 5.2% of patients. When patients with coronary artery disease were excluded, low plasma SDF-1 remained significant for overall survival, breast scancer–specific survival, and DDFS (data not shown).


View this table:
[in this window]
[in a new window]

 
Table 2. Clinicopathologic correlations

 

View this table:
[in this window]
[in a new window]

 
Table 3. Unadjusted and adjusted survival analysis

 

Figure 1
View larger version (10K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Unadjusted Kaplan-Meier survival curve of plasma SDF-1 with Lo, Mid, and Hi values derived from optimal cutpoint analysis from X-tile software.

 
SDF-1-3'A genotyping. The genotypic and allelic frequencies were in accordance with Hardy-Weinberg equilibrium. The frequencies of the genotypes were as follows: AA, 4.4%; AG, 29.3%; and GG, 66.3%. With the exception of Spearman's rank correlation, the AA and AG genotypes were combined for all analysis due to the low frequency of the AA genotype. No correlation was identified between the genotype and breast tumor characteristics (Table 2). Patients with the SDF-1-3'A polymorphism showed a poorer breast cancer–specific survival (adjusted hazard ratio, 2.36; 95% CI, 1.05-5.29; P = 0.04) and DFS (adjusted hazard ratio, 2.28; 95% CI, 1.24-4.21; P = 0.008; Table 3). There was an increased incidence of patients with the SDF-1-3'A polymorphism who had a previous history of cancer excluding breast (63.2%; n = 19; P = 0.005). No statistically significant correlation was identified with any other comorbid condition such as coronary artery disease, arrhythmias, gastroesophageal reflux disease, hypertension, hypercholesterolemia, diabetes mellitus, arthritis, hypothyroidism, or chronic respiratory disease.

SDF-1 plasma levels and SDF-1-3'A genotyping. The means (SD) of plasma SDF-1 level for patients from each genotype were as follows: AA, 2555 pg/mL (271); AG 2620 pg/mL (540); GG, 2666 pg/mL (508). There seemed to be a trend with decreasing plasma SDF-1 levels from the GG to AG to AA genotypes, but this was not statistically significant (P = 0.65). Because of this trend, and the theoretical possibility that the AA polymorphism may affect SDF-1 mRNA levels, patients with both low plasma SDF-1 level and the SDF-1-3'A polymorphism (low + AA/AG) were combined (n = 49), also known as LowA, and compared with the other patients who either had a high plasma SDF-1 level (high + AA/AG or high + GG) or a low plasma SDF-1 level with the GG genotype (low + GG), also called the "Others" group. There was no statistically significant difference in survival in patients with high + AA/AG, high + GG, or low + GG. Patients with a low plasma SDF-1 level and the SDF-1-3'A polymorphism had a greater risk of developing metastasis (relative risk, 2.11; 95% CI, 1.25-3.59; P = 0.007) versus the Others group. In univariate analysis, n = 270, LowA patients showed a high rate of mortality due to breast cancer- related causes (unadjusted hazard ratio, 4.19; 95% CI, 1.99-8.81; P < 0.001; Fig. 2B ). The 5-year rate of breast cancer–specific survival for LowA was 70.8% (7.0% SE) versus 92.5% (1.9% SE) for the Others group. LowA patients also exhibited poorer overall survival (unadjusted hazard ratio, 3.15; 95% CI, 1.57-6.33; P = 0.001; Fig. 2A). The rates of DFS (unadjusted hazard ratio, 2.28; 95% CI, 1.29-4.03; P = 0.005) and DDFS (unadjusted hazard ratio, 2.42; 95% CI, 1.31-4.48; P = 0.005) were also significantly lower for LowA patients (Fig. 2C and D).


Figure 2
View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Unadjusted Kaplan-Meier survival curves of LowA (low plasma SDF-1 level + AA/AG genotype) versus Others (low plasma SDF-1 + GG, or high plasma SDF-1 + AA/AG, or high plasma SDF-1+GG; n = 270). A, overall survival; B, breast cancer–specific survival; C, disease-free survival; D, DDFS.

 
After multivariate analysis, LowA emerged as a powerful independent prognosticator with almost 4-fold higher rate of mortality secondary to breast cancer (Table 4 ). In comparison with other prognostic markers, LowA seemed to be stronger than tumor size and tumor grade. Because a positive correlation was identified between plasma SDF-1 levels and age, adjustment for age alone revealed similar statistical significance and rate of recurrence or mortality (data not shown). Due to the prognostic value of the combination of low plasma SDF-1 level and the SDF-1-3'A polymorphism, an interaction between these two variables was sought. No interaction was identified in unadjusted or adjusted multivariate analysis between the two variables for overall survival, DFS, or DDFS, but a trend was identified for breast cancer–specific survival (unadjusted interaction hazard ratio, 9.77; 95% CI, 0.93-103.03; P = 0.06; adjusted hazard ratio, 4.17; 95% CI, 0.36- 47.7; P = 0.25).


View this table:
[in this window]
[in a new window]

 
Table 4. Multivariate variable analysis for LowA versus Others

 
Tumor contribution to plasma SDF-1. Since it has been reported that tumors can express SDF-1 (19, 20), we verified whether tumor secretion of SDF-1 may significantly contribute to plasma SDF-1 levels by comparing preoperative and postoperative levels, at a median follow-up of 7 months in an independent group of 22 primary breast cancer patients at the Sir Mortimer B. Davis Jewish General Hospital. None of these patients showed evidence of recurrent disease at the time of the second blood collection. The mean age of this group (57.6 years) was comparable with that of the larger group of patients from the CHUM (58.0 years), and there was no statistically significant difference in mean preoperative SDF-1 plasma levels between the two cohorts (mean difference, 154 pg/mL; 95% CI, –69.30-372 pg/mL; P = 0.17). Within the Sir Mortimer B. Davis Jewish General Hospital cohort, the mean difference between the preoperative and postoperative SDF-1 levels was 85 pg/mL, which was not statistically significant (SD, 337; P = 0.26). Therefore, the contribution of plasma SDF-1 from the tumor can be considered minimal. The difference in plasma SDF-1 levels (i.e., tumor secreted SDF-1) was correlated with age, tumor size, grade, lymph node status, ER, PR, and Her2/neu status, and no association was identified (data not shown).


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Although it is commonly accepted that the clinical behavior of tumors depends on the relationship between tumor cells and the host, the majority of molecular studies have identified tumor-derived markers, whereas little is known about the predictive potential of host factors and their potential role in guiding therapy. One approach to uncover host factors is to screen for genetic polymorphisms in cancer-associated genes, or carcinogen-metabolizing genes (21). Such a search has not been very successful to date because these polymorphisms have generally not been clinically validated. However, starting from recent advances in the understanding of tumor biology, and specifically, the metastatic process in breast cancer, we proceeded to directly study a simple idea: that elevated chemokine levels in the blood of cancer patients may act to retain cancer cells in the circulation and prevent them from homing in to their metastatic target sites. Indeed, we discovered that a low plasma SDF-1 level is predictive of distant metastasis and an independent prognostic marker in breast cancer patients. Our data shows that tumor-secreted SDF-1 plays, at most, a minor role in SDF-1 plasma levels, suggesting that plasma SDF-1 is truly a host factor influencing the propensity of breast cancers to metastasize. Moreover, increasing SDF-1 plasma levels with age may be a factor contributing to the better prognosis of older women with breast cancer. In addition, the presence of the SDF-1 genetic polymorphism contributed to increasing the risk of metastatic disease in patients with low plasma SDF-1.

The origin of plasma SDF-1 is multifarious, including many different cell types such as lymphocytes, endothelial cells, bone marrow, and tumor stromal cells (2225). This has led to its measurement in plasma in various medical conditions such as HIV, rheumatoid arthritis, and in the context of stem cell mobilization (2629). Plasma SDF-1 has previously been measured in only a few neoplasms; in both B-cell chronic lymphocytic leukemia and colon cancer, the authors identified a lower level of plasma SDF-1 in cancer patients compared with normal controls (3032). Furthermore, patients with more advanced stage colon cancer exhibited lower levels of plasma SDF-1 versus patients of earlier stage colon cancer (32). These results are in concordance with the trend that we have reported herein between low plasma levels and increasing tumor size or nodal involvement. Here, for the first time, we report that a low plasma SDF-1 level in breast cancer is predictive of distant metastasis and poorer survival.

Our study has several strengths. All blood samples from the CHUM were collected prospectively, minutes before surgery in fasting patients, which minimizes variability that may be induced if collected at different time points. A commercially available assay (R&D Systems) was used for measurement of plasma SDF-1 levels in which a small coefficient of variation was obtained; this allows for greater potential for validation of results and, thus, implementation into the clinic. Furthermore, this study used a cohort of consecutive patients such that there was no a priori selection of patients; the resulting trends identified across this population of breast cancer patients are thus more generalizable. One of the limitations of this study is that the median follow-up is only 3.3 years; a study with a longer follow-up will be needed to account for distant recurrences that will occur beyond this point.

Recent reports have shown that women with the SDF-1-3'A polymorphism have an increased susceptibility to develop breast cancer (13, 14). The reasons for this association are presently unknown. Although an association between the polymorphism and distant metastasis was identified in acute myeloid leukemia patients (33), this was not observed in one underpowered study with breast cancer patients (34). In our cohort of 270 patients, we found that the SDF-1-3'A polymorphism is an independent prognostic marker for overall survival, breast cancer–specific survival, and DFS. Although we did find a correlative trend between SDF-1 plasma levels and SDF-1-3'A polymorphism, it was not significant. To clarify the association between SDF-1 levels and the polymorphism in breast cancer, a larger cohort would be necessary.

The combination of the polymorphism and low plasma SDF-1 level has a strong prognostic value with a 4-fold lower survival rate compared with those patients with either high plasma SDF-1 or the GG genotype. Given that plasma SDF-1 is mostly a host-derived factor and that the SDF-1-3'A polymorphism is a germline polymorphism, we have identified a cohort of patients with a poor prognosis due to an intrinsic, tumor-independent susceptibility to develop metastatic disease. As CXCR4 expression has been identified in many different neoplasms (35), it is likely that this intrinsic susceptibility for metastatic disease may not be unique to breast cancer. Because breast tumors widely express the receptor for SDF-1, CXCR4 (9), this ligand/receptor pair provides an interesting therapeutic target in breast cancer patients. In fact, anti-CXCR4 agents are currently in clinical trials in various cancers including breast cancer.5 Studies of anti-CXCR4 therapy in breast cancer should consider selecting not only patients whose breast tumors overexpress the CXCR4 receptor, but those patients carrying the SDF-1-3'A polymorphism and whose plasma SDF-1 levels are low. Our results point the way to new clinical trials in oncology that will consider both host factors in addition to tumor factors as criteria for selection of therapies. In conclusion, the predictive value of plasma SDF-1 offers a direct view of the physiology of metastatic disease in the blood of cancer patients. The significance of low plasma SDF-1 level suggests that a clinically important step in the process of breast cancer metastasis occurs at the stage of tumor extravasation driven by the differential concentration gradient by lower SDF-1 levels in the circulation compared with the metastatic organ site.


    Acknowledgments
 
We thank Ursula Krzemien and Marie-Claude Huneau for collection and processing of blood samples, and Marie-Andrée Gagnon and Micheline Daneau from the Archives of the CHUM for their technical support.


    Footnotes
 
Grant support: Canadian Breast Cancer Research Alliance grant #14598 (M. Basik) and Fonds de la recherche en santé du Québec Reseau de Recherche sur le Cancer for the tumor bank.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

4 Ries LAG, Krapcho M, Mariotto A, et al., editors. Surveillance, Epidemiology, and End Results Cancer Statistics Review, 1975 to 2004, National Cancer Institute. Bethesda, MD, based on November 2006 Surveillance, Epidemiology, and End Results data submission, posted to the Surveillance, Epidemiology, and End Results web site, 2007 [cited 2007 May 3]. Available from: http://seer.cancer.gov/csr/1975_2004/. Back

5 Chemokine Therapeutics. Chemokine Therapeutics achieves critical milestone with the start of a phase Ib/II human clinical trial in cancer. Press release, 2006. Available from: http://www.chemokine.net/news_releases.htm?id=57. Back

Received 5/15/07; revised 10/ 7/07; accepted 10/24/07.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fisher ER, Anderson S, Redmond C, Fisher B. Pathologic findings from the National Surgical Adjuvant Breast Project protocol B-06. 10-year pathologic and clinical prognostic discriminants. Cancer 1993;71:2507–14.[CrossRef][Medline]
  2. Fisher ER, Costantino J, Fisher B, Redmond C. Pathologic findings from the National Surgical Adjuvant Breast Project (Protocol 4). Discriminants for 15-year survival. National Surgical Adjuvant Breast and Bowel Project Investigators. Cancer 1993;71:2141–50.[CrossRef][Medline]
  3. Fisher B, Bauer M, Wickerham DL, et al. Relation of number of positive axillary nodes to the prognosis of patients with primary breast cancer. An NSABP update. Cancer 1983;52:1551–7.[CrossRef][Medline]
  4. Quiet CA, Ferguson DJ, Weichselbaum RR, Hellman S. Natural history of node-positive breast cancer: the curability of small cancers with a limited number of positive nodes. J Clin Oncol 1996;14:3105–11.[Abstract]
  5. Rosen PR, Groshen S, Saigo PE, Kinne DW, Hellman S. A long-term follow-up study of survival in stage I (T1N0M0) and stage II (T1N1M0) breast carcinoma. J Clin Oncol 1989;7:355–66.[Abstract]
  6. Bast RC, Jr., Ravdin P, Hayes DF, et al. 2000 update of recommendations for the use of tumor markers in breast and colorectal cancer: clinical practice guidelines of the American Society of Clinical Oncology. J Clin Oncol 2001;19:1865–78.[Abstract/Free Full Text]
  7. Fidler IJ. The pathogenesis of cancer metastasis: the "seed and soil" hypothesis revisited. Nat Rev Cancer 2003;3:453–8.[CrossRef][Medline]
  8. Muller A, Homey B, Soto H, et al. Involvement of chemokine receptors in breast cancer metastasis. Nature 2001;410:50–6.[CrossRef][Medline]
  9. Salvucci O, Bouchard A, Baccarelli A, et al. The role of CXCR4 receptor expression in breast cancer: a large tissue microarray study. Breast Cancer Res Treat 2006;97:275–83.[CrossRef][Medline]
  10. Petit I, Szyper-Kravitz M, Nagler A, et al. G-CSF induces stem cell mobilization by decreasing bone marrow SDF-1 and up-regulating CXCR4. Nat Immunol 2002;3:687–94.[CrossRef][Medline]
  11. Winkler C, Modi W, Smith MW, et al. Genetic restriction of AIDS pathogenesis by an SDF-1 chemokine gene variant. ALIVE Study, Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC). Science 1998;279:389–93.[Abstract/Free Full Text]
  12. Sei S, O'Neill DP, Stewart SK, et al. Increased level of stromal cell-derived factor-1 mRNA in peripheral blood mononuclear cells from children with AIDS-related lymphoma. Cancer Res 2001;61:5028–37.[Abstract/Free Full Text]
  13. Razmkhah M, Talei AR, Doroudchi M, Khalili-Azad T, Ghaderi A. Stromal cell-derived factor-1 (SDF-1) alleles and susceptibility to breast carcinoma. Cancer Lett 2005;225:261–6.[CrossRef][Medline]
  14. Zafiropoulos A, Crikas N, Passam AM, Spandidos DA. Significant involvement of CCR2–64I and CXCL12–3a in the development of sporadic breast cancer. J Med Genet 2004;41:e59.[Free Full Text]
  15. Soriano A, Martinez C, Garcia F, et al. Plasma stromal cell-derived factor (SDF)-1 levels, SDF1–3'A genotype, and expression of CXCR4 on T lymphocytes: their impact on resistance to human immunodeficiency virus type 1 infection and its progression. J Infect Dis 2002;186:922–31.[CrossRef][Medline]
  16. Ide A, Kawasaki E, Abiru N, et al. Stromal-cell derived factor-1 chemokine gene variant is associated with type 1 diabetes age at onset in Japanese population. Hum Immunol 2003;64:973–8.[CrossRef][Medline]
  17. Camp RL, Dolled-Filhart M, Rimm DL. X-tile: a new bio-informatics tool for biomarker assessment and outcome-based cut-point optimization. Clin Cancer Res 2004;10:7252–9.[Abstract/Free Full Text]
  18. Cox DR. Regression models and Life-Tables. J R Stat Soc Ser B 1972;34:187–220.
  19. Kang H, Watkins G, Parr C, Douglas-Jones A, Mansel RE, Jiang WG. Stromal cell derived factor-1: its influence on invasiveness and migration of breast cancer cells in vitro, and its association with prognosis and survival in human breast cancer. Breast Cancer Res 2005;7:R402–10.[CrossRef][Medline]
  20. Kang H, Mansel RE, Jiang WG. Genetic manipulation of stromal cell-derived factor-1 attests the pivotal role of the autocrine SDF-1-CXCR4 pathway in the aggressiveness of breast cancer cells. Int J Oncol 2005;26:1429–34.[Medline]
  21. Huang CS, Chern HD, Chang KJ, Cheng CW, Hsu SM, Shen CY. Breast cancer risk associated with genotype polymorphism of the estrogen-metabolizing genes CYP17, CYP1A1, and COMT: a multigenic study on cancer susceptibility. Cancer Res 1999;59:4870–5.[Abstract/Free Full Text]
  22. Orimo A, Gupta PB, Sgroi DC, et al. Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion. Cell 2005;121:335–48.[CrossRef][Medline]
  23. Bleul CC, Farzan M, Choe H, et al. The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature 1996;382:829–33.[CrossRef][Medline]
  24. Nishikawa S, Ogawa M, Nishikawa S, Kunisada T, Kodama H. B lymphopoiesis on stromal cell clone: stromal cell clones acting on different stages of B cell differentiation. Eur J Immunol 1988;18:1767–71.[Medline]
  25. Salvucci O, Yao L, Villalba S, Sajewicz A, Pittaluga S, Tosato G. Regulation of endothelial cell branching morphogenesis by endogenous chemokine stromal-derived factor-1. Blood 2002;99:2703–11.[Abstract/Free Full Text]
  26. Shalekoff S, Tiemessen CT. Circulating levels of stromal cell-derived factor 1{alpha} and interleukin 7 in HIV type 1 infection and pulmonary tuberculosis are reciprocally related to CXCR4 expression on peripheral blood leukocytes. AIDS Res Hum Retroviruses 2003;19:461–8.[CrossRef][Medline]
  27. Ikegawa M, Yuan J, Matsumoto K, et al. Elevated plasma stromal cell-derived factor 1 protein level in the progression of HIV type 1 infection/AIDS. AIDS Res Hum Retroviruses 2001;17:587–95.[CrossRef][Medline]
  28. Hansen IB, Ellingsen T, Hornung N, Poulsen JH, Lottenburger T, Stengaard-Pedersen K. Plasma level of CXC-chemokine CXCL12 is increased in rheumatoid arthritis and is independent of disease activity and methotrexate treatment. J Rheumatol 2006;33:1754–9.[Abstract/Free Full Text]
  29. Carion A, Benboubker L, Herault O, et al. Stromal-derived factor 1 and matrix metalloproteinase 9 levels in bone marrow and peripheral blood of patients mobilized by granulocyte colony-stimulating factor and chemotherapy. Relationship with mobilizing capacity of haematopoietic progenitor cells. Br J Haematol 2003;122:918–26.[CrossRef][Medline]
  30. Barretina J, Junca J, Llano A, et al. CXCR4 and SDF-1 expression in B-cell chronic lymphocytic leukemia and stage of the disease. Ann Hematol 2003;82:500–5.[CrossRef][Medline]
  31. Zannettino AC, Farrugia AN, Kortesidis A, et al. Elevated serum levels of stromal-derived factor-1{alpha} are associated with increased osteoclast activity and osteolytic bone disease in multiple myeloma patients. Cancer Res 2005;65:1700–9.[Abstract/Free Full Text]
  32. Dimberg J, Hugander A, Lofgren S, Wagsater D. Polymorphism and circulating levels of the chemokine CXCL12 in colorectal cancer patients. Int J Mol Med 2007;19:11–5.[Medline]
  33. Dommange F, Cartron G, Espanel C, et al. CXCL12 polymorphism and malignant cell dissemination/tissue infiltration in acute myeloid leukemia. FASEB J 2006;20:1913–5.[Abstract/Free Full Text]
  34. Ghilardi G, Biondi ML, La Torre A, Battaglioli L, Scorza R. Breast cancer progression and host polymorphisms in the chemokine system: role of the macrophage chemoattractant protein-1 (MCP-1) -2518 G allele. Clin Chem 2005;51:452–5.[Free Full Text]
  35. Balkwill F. The significance of cancer cell expression of the chemokine receptor CXCR4. Semin Cancer Biol 2004;14:171–9.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
S. Hassan, C. Ferrario, U. Saragovi, L. Quenneville, L. Gaboury, A. Baccarelli, O. Salvucci, and M. Basik
The Influence of Tumor-Host Interactions in the Stromal Cell-Derived Factor-1/CXCR4 Ligand/Receptor Axis in Determining Metastatic Risk in Breast Cancer
Am. J. Pathol., July 1, 2009; 175(1): 66 - 73.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hassan, S.
Right arrow Articles by Basik, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hassan, S.
Right arrow Articles by Basik, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online