Clinical Cancer Research Versailles No Abst Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Clinical Cancer Research 14, 559, January 15, 2008. doi: 10.1158/1078-0432.CCR-07-1176
© 2008 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, L.
Right arrow Articles by Xu, D.-Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, L.
Right arrow Articles by Xu, D.-Q.

Cancer Therapy: Preclinical

Effects of Plasmid-Based Stat3-Specific Short Hairpin RNA and GRIM-19 on PC-3M Tumor Cell Growth

Ling Zhang1, Lifang Gao1, Yang Li1, Guimiao Lin1, Yueting Shao1, Kun Ji1, Hao Yu1, Jiadi Hu2, Dhananjaya V. Kalvakolanu2, Dennis J. Kopecko3, Xuejian Zhao1 and De-Qi Xu3

Authors' Affiliations: 1 Prostate Diseases Prevention and Treatment Research Center and Department of Pathophysiology, School of Basic Medicine, Jilin University, Changchun, P.R. China; 2 Greenebaum Cancer Center, Department of Microbiology and Immunology, Molecular Biology Program, University of Maryland School Medicine, Baltimore, Maryland; and 3 Laboratory of Enteric and Sexually Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland

Requests for reprints: Zhao Xuejian, Prostate Diseases Prevention and Treatment Research Centre, and Department of Pathophysiology, School of Basic Medicine, Jilin University, Xinmin Street, Changchun, 130021, P. R. China. Phone: 011-86-431-563-2348; Fax: 011-86-431-563-2348; E-mail: pro_2{at}jlu.edu.cn or De-Qi Xu, Laboratory of Enteric and Sexually Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland 20892. Phone: 301-496-1894; Fax: 301-402-8701; E-mail: deqi.xu{at}fda.hhs.gov.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Purpose: Persistent activation of signal transducers and activators of transcription 3 (Stat3) and its overexpression contribute to the progression and metastasis of several different tumor types. For this reason, Stat3 is a reasonable target for RNA interference–mediated growth inhibition. Blockade of Stat3 using specific short hairpin RNAs (shRNA) can significantly reduce prostate tumor growth in mice. However, RNA interference does not fully ablate target gene expression in vivo, owing to the idiosyncrasies associated with shRNAs and their targets. To enhance the therapeutic efficacy of Stat3-specific shRNA, we applied a combination treatment involving gene associated with retinoid-IFN–induced mortality 19 (GRIM-19), another inhibitor of STAT3, along with shRNA.

Experimental Design: The coding sequences for GRIM-19, a cellular STAT3-specific inhibitor, and Stat3-specific shRNAs were used to create a dual expression plasmid vector and used for prostate cancer therapy in vitro and in mouse xenograft models in vivo.

Results: The coexpressed Stat3-specific shRNA and GRIM-19 synergistically and more effectively suppressed prostate tumor growth and metastases when compared with treatment with either single agent alone.

Conclusion: The simultaneous use of two specific, but mechanistically different, inhibitors of STAT3 activity exerts enhanced antitumor effects.

Prostate carcinoma is a leading cause of cancer-related death in Western countries (1, 2). Although we do not have a complete understanding of the molecular bases underlying the development of prostate cancer, significant progress has been made in defining a set of gene expression changes that occur in these tumors (2, 3). Some of these affected gene products are useful targets for the development of specific antitumor therapeutic strategies. For example, the altered signal transducers and activators of transcription 3 (Stat3) signaling pathway has been shown to play a key role in carcinogenesis by promoting cell proliferation, differentiation, and cell cycle progression, as well as inhibition of apoptosis (4, 5). In normal cells, cytokine-induced activation of STAT3 (via phosphorylation at Tyr705) is suppressed by feedback regulators, such as SOCS3 (5). However, constitutive activation of Stat3 and its overexpression have been detected in a wide variety of human tumors (6), including prostate cancer (3). Aberrantly active Stat3 promotes tumor cell growth and survival via an incessant induction of progrowth genes, such as cyclin D1, c-Myc, Bcl-xL, Bcl-2, Mcl-1, vascular endothelial growth factor, and matrix metalloproteinase 2 (MMP-2; refs. 7–15), whose products promote tumor cell cycle progression, survival, angiogenesis, and metastasis, as well as inhibit apoptosis. In these instances, inhibition of STAT3 activity potently suppresses tumor growth by reducing the expression of the progrowth genes. Although STAT3 decoys (16) or Stat3-specific RNA interferences have been successfully used for the suppression of tumor growth in vitro or in a mouse model (17–19), their therapeutic efficacy in vivo has not been fully assessed.

RNA interference is an evolutionarily conserved, posttranscriptional gene silencing mechanism, wherein a small interfering RNA (siRNA) directs a sequence-specific degradation of its target mRNA (20). Because of their unparallel target specificity, there has been an intensive effort for using siRNAs as therapeutics for various diseases. RNA interference–based therapies have been successfully implemented in a variety of disease models. Because synthetic siRNAs can only transiently decrease the target gene expression in proliferating cancer cells (21), a sustained supply of anticancer siRNAs is critical for imparting a strong therapeutic benefit. Plasmid-based expression of gene-specific small hairpin RNAs (shRNA), under the control of RNA polymerase III–dependent promoters (e.g., U6 and H1), produces a sustainable and economic source of siRNAs for therapeutic purposes. The shRNAs are processed intracellularly by the enzyme Dicer into siRNAs (22). In a recent study (19), we showed that blockade of Stat3 using shRNA expression vectors via a direct i.t. injection can significantly reduce prostate tumor growth in nude mice. However, we did not observe a complete suppression of tumor growth. In fact, it is known that RNA interference does not completely block gene expression, especially when the target mRNA is expressed at abnormally high levels (23). Therefore, we wondered if another STAT3-specific inhibitor can be combined with shRNAs for enhanced suppression of tumor growth. We chose a recently described native host cellular protein, gene associated with retinoid-IFN–induced mortality (GRIM-19), for this purpose.

GRIM-19 was originally isolated as a growth suppressive gene product in the IFN-β–induced and retinoic acid–induced cell death pathway using a genetic screen (24). GRIM-19 binds to the Stat3 gene and inhibits transcription (25, 26). The tumor suppressive function of GRIM-19 was further supported by recent reports that mutations in the human GRIM-19 gene occur in the Hûrthle cell thyroid carcinomas (27) and a loss of its expression occurs in human renal and in some prostate carcinomas (28). We show here, for the first time, that coexpression of siRNA-Stat3 and GRIM-19 protein from the same plasmid causes a synergistic suppression of prostate tumor growth. Furthermore, the number of metastases was significantly reduced by the coexpression vector compared with the controls.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Immunohistochemistry. Thirty-eight total prostate tumor samples and 29 normal prostate tissues were collected for determination of Stat3 and GRIM-19 expression. Immunostaining was done using Vectastain Elite ABC avidin-biotin staining kit (Vector). Antibodies specific for total STAT3 and activated phosphorylated (Tyr705) STAT3 (p-STAT3) were obtained from Santa Cruz Biotech. A mouse monoclonal antibody against GRIM-19 was described earlier (29). Antibody against Ki-67 was obtained from Biogenex. Paraffin-embedded tissue sections of primary prostate tumors and the adjacent normal prostate tissues were used for immunohistochemical studies. The criteria for grading immunohistochemical data for STAT3, p-STAT3, and GRIM-19 were similar to those described earlier (19). Briefly, the percentage of cells positively stained in each section were categorized as follows: negative (samples with ≤5% positive cells), low (5-25% positive cells), moderate (25-50% positive cells), and strong (50-100% positive) were considered as –, +, ++, and +++, respectively, for these analyses.

Construction of recombinant plasmids. As shown in Fig. 1 , we constructed a series of expression plasmids that contain, individually or in combination, shRNA specific to Stat3 and GRIM-19 expression elements. Among several shRNAs tested, Stat3-3, which was localized to the SH2 domain of human Stat3, was the most effective at inhibiting growth (19). Thus, this Stat3-3 shRNA (which has the sequence GCAGCAGCTGAACAACATG corresponding to nucleotides 2,144 to 2,162; Genbank accession number NM_003150) was used in this study. A negative control scramble shRNA sequence (Ambion), which has no significant homology to mouse or human gene sequences, was used to eliminate nonspecific effects. The oligonucleotide contained a sense strand of 19 nucleotides followed by a short spacer (TTCAAGAGA), the antisense strand, five Ts (terminator), as well as terminal BamHI and HindIII restriction sites. This oligonucleotide construct was cloned into the BamHI and HindIII sites of plasmid pSilencer neo 3.1-H1 (Ambion) to generate a Stat3-specific shRNA expression vector, designated pH1-Si-Stat3 (not shown in Fig. 1). The H1 promoter and the sequence of siRNA-Stat3 or siRNA-scramble were then PCR amplified and cloned into BglII and NruI sites of plasmid pcDNA3.1(+; Invitrogen) to generate pSi-Stat3 and pSi-scramble vectors, respectively (Fig. 1). The human GRIM-19 open reading frame was PCR amplified using the pCXN2mycA GRIM-19 plasmid (24, 29) as a template with primers P1, 5'-AGGTACCATGGCGGCGTCAAAGGTGA-3' and P2, 5'ACGAATTCCTACGTGTACCACATGAAGCC 3' then cloned into KpnI and EcoRI sites of plasmid pcDNA3.1(+) to construct a plasmid pGRIM-19, in which the GRIM-19 gene was placed under the control of a cytomegalovirus enhancer. The H1 promoter and siRNA-Stat3 DNA fragments were amplified using the pSi-Stat3 plasmid as template, with primers P3, 5'-CGAGATCTGAATTCATATTTGCATGTCGCTATG-3' and P4, 5'-TCGCGAAGGAAACAGCTATGACCATGATTAC-3', and were then cloned into BglII and NurI sites of pGRIM-19 to generate pGRIM-19-Si-Stat3 that coexpressed both siRNA-Stat3 and protein-GRIM-19 (Fig. 1). Plasmids lacking the GRIM-19 gene did not contain any insert under the control of the cytomegalovirus promoter.


Figure 1
View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Expression vectors used in this study. The H1 promoter directs the expression of Stat3-specific shRNA and the cytomegalovirus (CMV) promoter drives the expression of GRIM-19 protein.

 
Cell culture and transfections. The human prostate cancer cell line PC-3M (androgen independent, highly invasive) was grown in Iscove's modified Dulbecco's medium (Invitrogen) with 10% fetal bovine serum. LipofectAMINE 2000 (Invitrogen) was used to transfect plasmids into these host cells.

Western blot. Cell lysis, protein quantification, and Western blot analyses were carried out as described previously (19). The absorbance of each band in Western blots was quantified using densitometry, and the results are shown as relative expression of each protein from different samples. Antibodies against STAT3, p-STAT3, cyclin D1, c-Myc, vascular endothelial growth factor, and antimouse MMP-2 (Santa Cruz Biotech), Bcl-2 (DAKO Biotech), and Ki-67 (Biogenex) were used.

mRNA quantification. mRNA levels were determined using reverse transcription–PCR (RT-PCR) or Northern blot analyses. For RT-PCR analysis, 3 µg of total RNA were used to synthesize cDNA using an RT-PCR kit (Promega). For Stat3 mRNA, the primer pair 5'-TTGCCAGTTGTGGTGATC-3' and 5'-AGAACCCAGAAGGAGAAGC-3' was used, and for amplification of GRIM-19 mRNA, the primer pair 5'-GAGTCACGCACTGTCTGGG-3' and 5'-CGGTCGGTTTCTGCCTGTA-3' was used. For Northern blot analysis, 20 µg of total RNA were probed with 32P-labeled cDNA of Stat3 and β-actin.

Growth assays in vitro. PC-3M cells (2 x 104) were plated into each well of a 96-well dish. To avoid the influence of cell confluence on the cell growth assay (30), all experiments were conducted with 60% confluent cultures. Cell proliferation was assessed using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide staining kit (Sigma) according to the manufacturer's protocol. After 68 h, cells were incubated with 5 g/L of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide for 4 h. Then the medium was removed, and 100 µL of DMSO were added. The absorbance of the reaction solution was measured at 490 nm. Cell cycle phase distribution was monitored by flow cytometry (CellQuest software, Becton Dickinson FACScan). Apoptosis was detected using an Annexin V–Cy3 detection kit (Sigma). The Annexin V–Cy3 kit uses the dye Cy3.18 as the fluorochrome conjugated with Annexin V. Microscopically, Cy3.18 fluoresces brighter than FITC. The kit includes a nonfluorescent cell permeable compound 6-carboxyfluorescein diacetate, which, upon entering the cell, is hydrolyzed by esterases to a fluorescent compound, 6-CF. Generation of a fluorochrome indicates a viable cell. This combination allows the differentiation among early apoptotic cells (Annexin V positive, 6-CF positive; yellow), necrotic cells (Annexin V positive, 6-CF negative; red), and viable cells (Annexin V negative, 6-CF positive; green). The apoptotic index was calculated as follows: apoptotic index = (number of Cy3 apoptotic cells / total cell number counted) x 100%.

Gelatin zymography assay and metastasis examination. Gelatinase activity of MMP-2 was examined as described by Lalu et al. (31). Development of muscle infiltration and lymph node metastasis in nude mice (n = 10) treated with different plasmids was examined by H&E staining.

Tumor growth in vivo. Male BALB/c nude mice (Shanghai Institute of Experimental Animals) were inoculated with 2 x 106 cells of PC-3M cells s.c. into the right flank of mice. After the formation of palpable tumors (~5 mm by day 12), the mice were randomized into five groups (n = 5) and inoculated with 20 µg/50 µL per mouse via i.t. injection of different plasmids. Immediately after injection, tumors were pulsed with an electroporation generator (ECM 830, BTX). Pulses were delivered at a frequency of 1/s, 150 V/cm, with a length of 50 ms. Mice were sacrificed on day 36, and tumor sizes were determined. Various tissues (lung, liver, spleen, kidney, heart, and tumor) were harvested from these mice for monitoring metastases. Normal tissues and tumors were excised and weighed. Tissues were processed for sectioning, H&E staining, Terminal deoxynucleotidyl transferase-mediated nick end labeling (TUNEL) assay, immunohistochemical, Western blot, RT-PCR, and apoptosis analyses. Mock mice received implanted tumor but did not receive any plasmid construct therapy or electroporation.

Histochemistry and TUNEL assay. Tumors treated with different plasmids were excised from mice for H&E staining and TUNEL assay, as described previously (19). The Cell Death Detection kit (Roche) was used for TUNEL assays.

Statistical analysis. The significance of the differences between various samples was determined using Student's two-tailed t test. The significance of the differences between the median values of the data was determined using the two-tailed Mann-Whitney test. P values of <0.05 were deemed statistically significant.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
Down-regulation of GRIM-19 is associated with increased STAT3 activity in prostate tissues. Because GRIM-19 and STAT3 have opposite effects on cell growth, we first investigated if an inverse correlation could be found between the expressions of these proteins in primary tumors versus normal prostate tissue. We screened 38 primary prostate tumors and 29 normal prostate tissues for the expression of STAT3, p-STAT3, and GRIM-19 proteins using immunohistochemical analyses. Normal prostate tissue showed low to moderate levels of STAT3 and generally high levels of GRIM-19. In contrast, primary prostate tumor tissue showed moderate to high levels of STAT3 and very low levels of GRIM-19. The results of the immunostaining patterns for total STAT3 revealed that ~90% of the tumors immunostained as 2 to 3+ and GRIM-19 was severely depressed in tumor tissue (P < 0.001; Supplementary Fig. S1A). STAT3 and p-STAT3 levels were comparable in both prostate cancer cells and normal tissue. The overexpression of STAT3 protein in the tumors may be due to an autoregulation of its own synthesis, which was commonly seen with many tumors (32). The expression levels of STAT3 and GRIM-19 in tumors were significantly different from those found in normal tissues (Supplementary Table S1 and Supplementary Fig. S1A). These data show an inverse correlation between GRIM-19 and STAT3 expression, which is significantly different for primary prostate tumors versus normal prostate tissues. We observed that expression of GRIM-19 is inhibited in primary prostate cancer. This effect, in part, results in an increased expression of STAT3-regulated genes.

Stat3-specific shRNA and GRIM-19 specifically reduce STAT3 expression in prostate cancer PC-3M cells. Because our previous study showed a significant but incomplete antitumor effect of plasmid-based Stat3-specific shRNAs alone (19), we investigated if these shRNAs could be complemented with another STAT3-specific inhibitor, i.e., GRIM-19. Therefore, we generated a set of expression vectors that are capable of expressing, individually or in combination, GRIM-19 and shRNA specific to Stat3 (Fig. 1). These plasmids were transfected into PC-3M cells, a highly invasive human prostate cancer cell line, and their expression was monitored using Western blot, immunohistochemical, and RT-PCR analyses. RT-PCR analyses for GRIM-19 and Stat3 mRNA (Fig. 2A and C ), Western blot analyses for STAT3, p-STAT3, or GRIM-19 proteins (Fig. 2E and F), and immunohistochemical analyses for STAT3 and GRIM-19 expression (Fig. 2B and D) revealed a significant increase in GRIM-19 expression after transfection of expression vectors pGRIM-19, pGRIM-19-Si-Stat3, or pGRIM-19-Si-scramble (Fig. 2A and D-F) and a down-regulation of STAT3 after transfection with pSi-Stat3, pGRIM-19, pGRIM-19-Si-Stat3, or pGRIM-19-Si-scramble (Fig. 2B, C, E, and F). Consistent with other reports, these data suggest that GRIM-19 functions as a negative regulator of the Stat3 gene and suppresses Stat3 transcriptional activity. As expected, the pSi-scramble did not have an effect on Stat3 mRNA or protein levels. Because the pGRIM-19 and pGRIM-19-Si-scramble expression vectors had virtually identical effects on STAT3 and GRIM-19 expression and on cell growth, we used only pGRIM-19 as an experimental control in further studies.


Figure 2
View larger version (59K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. Expression of GRIM-19, STAT3, and p-STAT3 in PC-3M cells transfected with various plasmids. A, RT-PCR analysis of GRIM-19 mRNA. B, immunohistochemical (IHC) analysis of STAT3 expression; mock, no transfection. C, RT-PCR analysis of the expression of Stat3 mRNA. D, immunohistochemical analysis of GRIM-19 expression. E, Western blot analyses for STAT3, p-STAT3, and GRIM-19. F, quantification of STAT3, p-STAT3, and GRIM-19 protein by densitometric analysis.

 
Coexpressed Stat3-specific siRNA and GRIM-19 synergistically inhibit the expression of STAT3-dependent growth–associated genes and suppress cell growth in cultured PC-3M cells. To investigate if these constructs exert significantly different effects on cell growth and apoptosis, PC-3M cells were transfected with individual expression vectors. After 72 h, cells were stained with AnnCy3 (red) and 6-CF (green) to visualize apoptotic cells. The apoptotic cells were positively stained with 6-CF (green), producing a yellow color on merged images (Fig. 3A ). The GRIM-19-Si-Stat3 plasmid caused the strongest level of apoptosis. All groups, except the control, had a significant increase in apoptosis, which corresponded with a decline in the levels of STAT3-regulated genes Bcl-2, cyclin D1, c-Myc, and vascular endothelial growth factor (Fig. 3C and D). However, the magnitude of these effects is significantly different among various transfectants (Fig. 3D). The pGRIM-19, pSi-Stat3, and pGRIM-19-Si-Stat3 plasmids, respectively, induced ~14-fold, 19-fold, and 25-fold more apoptosis compared with the scramble control (Table 1 ). Another control, pGRIM-19-Si scramble (data not shown), was no different from pGRIM-19 in terms of its growth inhibitory effects. Taken together, the results shown in Figs. 2 and 3 are consistent with other reports, which showed a suppression of Stat3-regulated genes by GRIM-19. A profile of growth arrest (Fig. 3B), similar to that of apoptosis (Table 1), was observed in these transfected cells. The coexpression of siRNA-Stat3 with GRIM-19 caused the strongest growth suppression of prostate cancer PC-3M cells.


Figure 3
View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. Effects of coexpressed siRNA-Stat3 and GRIM-19 on cell growth and apoptosis. A, cells were transfected with the indicated vectors. After 72 h, cells were stained with 6-CF (green) using a Cy3–Annexin V apoptosis kit and subjected to confocal microscopy. Live and apoptotic cells are stained green and red, respectively. Upon merging, apoptotic cells appeared yellow. B, growth inhibitory effects of various plasmids detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assays. Cell growth was significantly reduced by treatment with pGRIM-19, pSi-Stat3, and pGRIM-19-Si-Stat3. Columns, mean from three separate experiments; bars, SE; *, P < 0.05 versus pSi-scramble. C, Western blot analysis of the STAT3-regulated genes. D, quantification of STAT3-regulated gene expression.

 

View this table:
[in this window]
[in a new window]

  		Table 1. Effect of different plasmids on apoptosis and cell cycle analysis in PC-3M cells

 
Coexpressed Stat3-shRNA and GRIM-19 synergistically suppress tumor growth in vivo. We next determined if the coexpressed GRIM-19 and siRNA-Stat3 could synergistically inhibit tumor growth using a xenograft tumor model. Mice were transplanted s.c. with 2 x 106 PC-3M cells into the right flank. Once palpable tumors (mean diameter, 5 mm) had developed at the sites of injection, the mice (n = 5 per group) were injected i.t. with individual expression vectors, coding for shRNAs and GRIM-19. Immediately after injection, tumors were pulsed with an electroporator to enhance the uptake of plasmid DNA into the target cells. Tumor growth was monitored for 36 days (Fig. 4A and B ). On day 36, animals were sacrificed and final tumor weights and volumes were determined (Table 2 ). The tumor size for mock and scrambled control groups was within statistical variation. Tumor sizes in various treatment groups were significantly (P < 0.05) diminished when compared with the scramble control. The GRIM-19-Si-Stat3 vector had a remarkably stronger effect on tumor growth when compared with either pGRIM-19 or pSi-Stat3 alone (P < 0.01; Fig. 4B). We next examined the expression of STAT3, p-STAT3, and GRIM-19 in grafted tumor tissues using RT-PCR and Western blot analysis. RT-PCR analysis revealed that GRIM-19 expression levels were increased in the groups treated with the pGRIM-19 and pGRIM-19-Si-Stat3 plasmids (Fig. 4C). Reduction in the levels of STAT3 and p-STAT3 occurred in the groups treated with pGRIM-19, pSi-Stat3, or pGRIM-19-Si-Stat3 (Fig. 4D-F). However, the level of p-STAT3 was lowest in the group treated with pSiGRIM-19-Stat3 (Fig. 4E and F). In this case, the p-STAT3 reduction reflected the diminished total level of STAT3. We also determined the levels of GRIM-19, STAT3, and Ki-67 expression via immunohistochemical analysis of tumors treated with pSi-scramble vector and pGRIM-19-Si-Stat3 (Supplementary Fig. S1B). The levels of GRIM-19 were increased, and those of STAT3 or Ki-67 (a cell division–associated antigen) were suppressed by treatment with pGRIM-19-Si-Stat3 compared with the scrambled vector. Ki-67 is expressed in proliferating G1-phase, S-phase, and G2-M–phase nuclei (33). TUNEL assays (Fig. 5A-F ) showed that pSi-Stat3–treated, pGRIM-19–treated, and pGRIM-19-Si-Stat3–treated tumors had undergone massive apoptosis and contained sparsely dispersed chromatin, necrotic tissue, and several TUNEL-positive cells or cell clusters. In sharp contrast to this, either the buffer or the scrambled siRNA controls showed a finely granular cytoplasm with evenly dispersed chromatin and no TUNEL-positive cells. MMP-2 activity, known to promote metastasis, was suppressed in the tumors treated with pGRIM-19, pSi-Stat3, or pGRIM-19-Si-Stat3 (Fig. 5G and H). Tumor infiltration into muscle or lymph node metastasis was observed in all 10 mice of the scrambled vector control group (Fig. 5I and J) but was not seen in mice treated with pSi-Stat3, pGRIM-19, and pGRIM-19-Si-Stat3. These results suggest that both GRIM-19 restoration and Stat3-specific shRNA treatment blocked metastasis. The pGRIM-19-Si-Stat3 combination vector showed the largest reduction of MMP-2 activity.


Figure 4
View larger version (53K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. Antitumor effects of various plasmids. A, tumor-bearing mice were treated with various plasmids. Inset images show the sizes of representative tumors. Note the strongest reduction in tumor size in mice treated with pGRIM-19-si-STAT3. B, growth curves of PC-3M tumors treated with various plasmids. Mice were transplanted s.c. with PC-3M cells. Once palpable tumors (mean diameter, 5 mm) had developed at the sites of injection, the mice were divided into five groups (n = 5 per group) and injected i.t. with various plasmids. The tumor sizes were determined on various days; *, P < 0.01 versus pSi-scramble. C, RT-PCR analyses of GRIM-19 mRNA in tumor tissues. All data were normalized to that of β-actin. Mean ± SE; *, P < 0.01 versus untreated and empty vector. D, RT-PCR analyses of Stat3 mRNA in tumors treated with various plasmids. Mean ± SE of triplicates. E, Western blot analyses for STAT3, p-STAT3, and GRIM-19 in tumor tissues after treatment with various plasmids. F, a quantification of STAT3, p-STAT3, and GRIM-19 proteins in tumor tissues.

 

View this table:
[in this window]
[in a new window]

  		Table 2. Tumor suppression by GRIM-19/Stat3-shRNA combination

 

Figure 5
View larger version (81K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. H&E staining (A and B), TUNEL analyses (C–F) of PC-3M tumor cells transfected with different plasmids, gelatin zymography assay for detection of expression of MMP-2 (G and H), and H&E staining for revealing metastasis (I and J). H&E staining (100x) of tumor cells treated with pSi-scramble vector (A) and with pSi-Stat3 plasmid (B). TUNEL assay (200x), tumors were treated with scramble vector (C), pGRIM-19 (D), pSi-Stat3 (E), and pGRIM-19-Si-Stat3 (F) plasmids. G, MMP-2 zymography of PC-3M tumors treated with various plasmids. H, quantitative analysis of gelatinolytic activity of mice prostate tissue using a computer-supported image analysis program. Columns, mean from 10 animals; bars, SD; *, P < 0.05. I, muscle infiltration. J, lymph node metastasis observed in all mice-bearing PC-3M tumors from the mock group or group treated with pSi-scramble.

 

   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
The application of gene transfer technologies has led to the development of new experimental approaches, such as inhibition of oncogene function and restoration of activity of tumor-suppressor genes. The STAT3 protein has been the focus of intensive study, given its central involvement in cell growth promotion. More importantly, a large number of different oncogenic events lead to activation of the tyrosyl phosphorylation of STAT3. Activated STAT3 acts like an oncogene by inhibiting apoptosis and promoting cell proliferation (7–15). Persistently active, high-level STAT3 has been detected in a wide variety of human tumors (4, 6), including prostate cancer (3). Interestingly, recent studies have also shown that mutant STAT3 proteins (defective in tyrosyl phosphorylation) can also promote gene expression and cell growth (34). In this case, an increase in mutant STAT3 levels seems to be sufficient for promoting gene expression. Thus, tyrosyl phosphorylation of the STAT3 protein need not necessarily occur for promoting cell growth. Apart from constitutive activation of STAT3, loss of its inhibitors could also play a role in the persistent induction of STAT3-regulated genes.

The importance of GRIM-19 in tumor growth regulation has been realized only recently. Originally described as an inhibitor of cell growth in response to IFN-retinoid treatment, GRIM-19 has been shown to interact exclusively with the transcriptional activating domain of Stat3 and inhibit autoregulatory STAT3-driven transcriptional activation (24–26). Furthermore, mutations in the GRIM-19 gene have been described in primary thyroid cancers (27). Recent studies have also shown that expression of the GRIM-19 gene is reduced or eliminated in a number of primary renal cell carcinomas and other tumors (28, 35). Loss or reduction of GRIM-19 expression results in robust up-regulation of STAT3-regulated genes in these tumors, and restoration of GRIM-19 suppresses the growth-promoting activities of STAT3 (28). In the current report, we have shown an inverse correlation between GRIM-19 and STAT3 expression in prostate tumors relative to normal prostate tissues (Supplementary Table S1). We confirm that GRIM-19 inhibits transcription driven by activated transcription factor STAT3 via a direct binding to the transactivation domain of STAT3 (25). In other studies, we have shown that a restoration of GRIM-19 expression suppresses both tumor cell growth and STAT3-regulated gene expression in vitro and in vivo (25, 28).

RNA interference–mediated knockdown of STAT3 reduces tumor cell growth, metastasis, angiogenesis, and chemoresistance (14, 15, 19, 29, 36, 37). We previously used Stat3-specific shRNA via i.t. injection to show its utility for tumor growth suppression in vivo (19). These shRNAs caused significant, but not complete, suppression of tumor growth. Multiple factors determine the efficacy of shRNAs, e.g., the shRNA sequence, expression levels, and stability. Also, the rate of transcription of the target gene can affect the extent of target mRNA destruction by shRNAs. Furthermore, the protein resulting from the residual mRNA remaining after shRNA attack and its stability may also diminish the efficacy of shRNAs. In theory, the antitumor effects of Stat3-shRNA could be complemented by the use of another inhibitor which blocks STAT3 activity. In this study, we have provided in vitro prostate tumor tissues and in vivo mouse implant prostate tumor data to show enhanced antitumor activity of Stat3-specific shRNAs when combined with GRIM-19 coexpressed from the same plasmid.

Herein, we examined the inhibitory effects of a combined GRIM-19/Stat3–specific shRNA therapy on tumor growth and found that a single dose of the combined genetic therapy (via i.t. administration) was superior to either component alone with the absence of apparent toxic effects on treated mice. Indeed, the combined therapy completely extinguished the activity of MMP-2 and vascular endothelial growth factor, key players in metastasis. The relatively high target specificity and different mechanisms of Stat3 down-regulation are key properties that contribute to the observed synergistic antitumor effects of the combination vector. Moreover, i.t. administration achieves high therapeutic concentration at the intended target site while using a relatively low dose and minimizing nonspecific adverse effects on other host tissues. Further efforts will clearly be necessary to explore the human therapeutic value of using these recombinant plasmids together with improved in vivo delivery methods and in multiple doses to eliminate carcinomas. Employing an appropriate conventional antitumor treatment combined with targeted genetic therapies (e.g., siRNA) may ultimately achieve an improved therapeutic effect while allowing for lowered doses for each component, perhaps reducing total adverse effects.

In this study. we used a combination of direct injection and electroporation to facilitate the transfer of plasmid DNA into tumor tissues. Note that mock mice, which did not receive electropulsation, and the pSi-scramble vector treatment group, which did receive electroporation, showed identical growth of tumors over time, indicating that electroporation itself had seemed no effect on tumors. Transfer of naked plasmid DNA and the expression of the genes of interest are enhanced by electropulsation into different tissues, including tumors (38–40). In fact, electroporation has already been applied in vivo to cause a transient permeabilization of the plasma membrane, which allows exogenous macromolecules to enter the cells. Much evidence has been accumulated to show the safety of in vivo electroporation for clinical use (19, 41, 42). We recently used attenuated Salmonella enterica serovar typhimurium, which is known to target tumor tissues, as a potential gene delivery system for plasmid-borne antitumor therapies, with considerable success in a mouse prostate tumor model (43). Future studies aimed at using Salmonella vectors or other tumor-targeting delivery systems containing combined antitumor therapies are needed to evaluate the full potential of a multifactorial antitumor approach.


   Footnotes
 
Grant support: Specialized Programs of Research in Prostate Cancer grant 2004DFB02000 from the Ministry of Science and Technology of the People's Republic of China, Japan International Cooperation Agency, and National Cancer Institute grants CA105005 and CA78282 (D. V. Kalvakolanu).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/).

Received 5/14/07; revised 10/ 2/07; accepted 10/ 9/07.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Pisani P, Parkin DM, Bray F, Ferlay J. Estimates of the worldwide mortality from 25 cancers in 1990. Int J Cancer 1999;83:18–29.[Medline]
  2. Nicholson B, Theodorescu D. Molecular therapeutics in prostate cancer. Histol Histopathol 2003;18:275–98.[Medline]
  3. Mora LB, Buettner R, Seigne J, et al. Constitutive activation of Stat3 in human prostate tumors and cell lines: direct inhibition of Stat3 signaling induces apoptosis of prostate cancer cells. Cancer Res 2002;62:6659–66.[Abstract/Free Full Text]
  4. Darnell JE, Jr. STATs and gene regulation. Science 1997;277:1630–5.[Abstract/Free Full Text]
  5. Lu Y, Fukuyama S, Yoshida R, et al. Loss of SOCS3 gene expression converts STAT3 function from anti-apoptotic to pro-apoptotic. J Biol Chem 2006;281:36683–90.[Abstract/Free Full Text]
  6. Catlett-Falcone R, Dalton WS, Jove R. STAT proteins as novel targets for cancer therapy. Signal transducer an activator of transcription. Curr Opin Oncol 1999;11:490–6.[CrossRef][Medline]
  7. Turkson J. STAT proteins as novel targets for cancer drug discovery. Expert Opin Ther Targets 2004;8:409–22.[CrossRef][Medline]
  8. Masuda M, Suzui M, Yasumatu R, et al. Constitutive activation of signal transducers and activators of transcription 3 correlates with cyclin D1 overexpression and may provide a novel prognostic marker in head and neck squamous cell carcinoma. Cancer Res 2002;62:3351–5.[Abstract/Free Full Text]
  9. Bromberg JF, Wrzeszczynska MH, Devgan G, et al. Stat3 as an oncogene. Cell 1999;98:295–303.[CrossRef][Medline]
  10. Ala S, Bonavida B. Rituximab inactivates signal transducer and activation of transcription 3 (STAT3) activity in B-non-Hodgkin's lymphoma through inhibition of the interleukin 10 autocrine/paracrine loop and results in down-regulation of Bcl-2 and sensitization to cytotoxic drugs. Cancer Res 2001;61:5137–44.[Abstract/Free Full Text]
  11. Puthier D, Bataille R, Amiot M. IL-6 up-regulates mcl-1 in human myeloma Cells through JAK/STAT rather than ras/MAP kinase pathway. Eur J Immunol 1999;29:3945–50.[CrossRef][Medline]
  12. Aoki Y, Feldman GM, Tosato G. Inhibition of STAT3 signaling induces apoptosis and decreases surviving expression in primary effusion lymphoma. Blood 2003;101:1535–42.[Abstract/Free Full Text]
  13. Niu G, Wright KL, Huang M, et al. Constitutive Stat3 activity up-regulates VEGF expression and tumor angiogenesis. Oncogene 2002;21:2000–8.[CrossRef][Medline]
  14. Wei D, Le X, Zheng L, et al. Stat3 activation regulates the expression of vascular endothelial growth factor and human pancreatic cancer angiogenesis and metastasis. Oncogene 2003;22:319–29.[CrossRef][Medline]
  15. Xie TX, Wei D, Liu M, et al. Stat3 activation regulates the expression of matrix metalloproteinase-2 and tumor invasion and metastasis. Oncogene 2004;23:3550–60.[CrossRef][Medline]
  16. Leong PL, Adrews GA, Johnson DE, et al. Targeted inhibition of Stat3 with a decoy oligonucleotide abrogates head and neck cancer cell growth. Proc Natl Acad Sci U S A 2003;100:4138–43.[Abstract/Free Full Text]
  17. Lee SO, Lou W, Khusroo M, Mehraein-Ghomi F, Trump DL, Gao AC. RNA interference targeting Stat3 inhibits growth and induces apoptosis of human prostate cancer cells. Prostate 2004;60:303–9.[CrossRef][Medline]
  18. Ling X, Arlinghaus RB. Knockdown of STAT3 expression by RNA interference inhibits the induction of breast tumors in immunocompetent mice. Cancer Res 2005;65:2532–6.[Abstract/Free Full Text]
  19. Gao L, Zhang L, Hu J, et al. Down-regulation of signal transducer and activator of transcription 3 expression using vector-based small interfering RNAs suppresses growth of human prostate tumor in vivo. Clin Cancer Res 2005;11:6333–41.[Abstract/Free Full Text]
  20. Hannon GJ. RNA interference. Nature 2002;418:244–51.[CrossRef][Medline]
  21. Tuschl T, Borkhard A. Small interfering RNAs: a revolutionary tool for the analysis of gene function and gene therapy. Mol Interv 2002;2:158–67.[Abstract/Free Full Text]
  22. Paddison PJ, Caudy AA, Bernstein E, Hannon J, Conklin DS. Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev 2002;16:948–58.[Abstract/Free Full Text]
  23. Elbashir SM, Harborth J, Weber K, Tuschl T. Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods 2002;26:199–213.[CrossRef][Medline]
  24. Angell JE, Lindner DJ, Shapiro PS, Hofmann ER, Kalvakolanu DV. Identification of GRIM-19, a novel cell death-regulatory gene induced by the interferon-β and retinoic acid combination, using a genetic approach. J Biol Chem 2000;275:33416–26.[Abstract/Free Full Text]
  25. Zhang J, Yang J, Roy SK, et al. The cell death regulator GRIM-19 is an inhibitor of signal transducer and activator of transcription 3. Proc Natl Acad Sci U S A 2003;100:9342–7.[Abstract/Free Full Text]
  26. Lufei C, Ma J, Huang G, et al. GRIM-19, a death-regulatory gene product, suppresses Stat3 activity via functional interaction. EMBO J 2003;22:1325–35.[CrossRef][Medline]
  27. Maximo V, Botelho T, Capela J, et al. Somatic and germline mutation in GRIM-19, a dual function gene involved in mitochondrial metabolism and cell death, is linked to mitochondrion-rich (Hûrthle cell) tumours of the thyroid. Br J Cancer 2005;92:1892–8.[CrossRef][Medline]
  28. Alchanati I, Nalla SC, Sun P, et al. A proteomic analysis reveals the loss of expression of the cell death regulatory gene GRIM-19 in human renal cell carcinomas. Oncogene 2006;25:7138–47.[CrossRef][Medline]
  29. Hu J, Angell JE, Zhang J, et al. Characterization of monoclonal antibodies against GRIM-19, a novel IFN-β and retinoic acid-activated regulator of cell death. J Interferon Cytokine Res 2002;22:1017–26.[CrossRef][Medline]
  30. Steinman RA, Wentzel A, Lu Y, Stehle C, Grandis JR. Activation of Stat3 by cell confluence reveals negative regulation of Stat3 by cdk2. Oncogene 2003;22:3608–15.[CrossRef][Medline]
  31. Lalu MM, Csonka C, Giricz Z, et al. Estimates of the worldwide mortality from 25 cancers in 1990. Int J Cancer 1999;83:18–29.[Medline]
  32. Buettner R, Mora LB, Jove R. Activated STAT signaling in human tumors provides novel molecular targets for therapeutic intervention. Clin Cancer Res 2002;8:945–54.[Abstract/Free Full Text]
  33. Gerdes J, Li L, Schlueter C, et al. Immunobiochemical and molecular biologic characterization of the cell proliferation-associated nuclear antigen that is defined by monoclonal antibody Ki-67. Am J Pathol 1991;38:867–73.
  34. Yang J, Chatterjee-Kishore M, Staugaitis SM, et al. Novel roles of unphosphorylated STAT3 in oncogenesis and transcriptional regulation. Cancer Res 2005;65:939–47.[Abstract/Free Full Text]
  35. Zhang X, Huang Q, Yang Z, Li Y, Li CY. GW112, a novel antiapoptotic protein that promotes tumor growth. Cancer Res 2004;64:2474–81.[Abstract/Free Full Text]
  36. Real PJ, Sierra A, De Juan A, Segovia JC, Lopez-Vega JM, Fernandez-Luna JL. Resistance to chemotherapy via Stat3-dependent overexpression of Bcl-2 in metastatic breast cancer cells. Oncogene 2002;21:7611–8.[CrossRef][Medline]
  37. Suiqing C, Min Z, Lirong C. Overexpression of phosphorylated-STAT3 correlated with the invasion and metastasis of cutaneous squamous cell carcinoma. J Dermatol 2005;32:354–60.[Medline]
  38. Cemazar M, Golzio M, Sersa G, Rols MP, Teissie J. Electrically-assisted nucleic acids delivery to tissues in vivo: where do we stand [review]? Curr Pharm Des 2006;12:3817–25.[CrossRef][Medline]
  39. Mir LM, Bureau MF, Gehl J, et al. High-efficiency gene transfer into skeletal musle mediated by electric pulses. Proc Natl Acad Sci U S A 1999;96:4262–7.[Abstract/Free Full Text]
  40. Rols MP, Delteil C, Golzio M, Dumond P, Cros S, Teissie J. iiiIn vivo electrically mediated protein and gene transfer in murine melanoma. Nat Biotechnol 1998;16:168–71.[CrossRef][Medline]
  41. Gothelf A, Mir LM, Gehl J. Electrochmotherapy: results of cancer treatment using enhanced delivery of bleomycin by electroporation. Cancer Treat Rev 2003;29:371–87.[CrossRef][Medline]
  42. Nishi T, Yoshizato K, Yamashiro S, et al. High-efficiency in vivo gene transfer using in-traarterial plasmid DNA injection following in vivo electroporation. Cancer Res 1996;56:1050–5.[Abstract/Free Full Text]
  43. Zhang L, Gao L, Guo B, et al. Intratumoral delivery and suppression of prostate tumor growth by attenuated Salmonella enterica serovar typhimurium carrying plasmid-based siRNAs. Cancer Res 2007;67:5859–64.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, L.
Right arrow Articles by Xu, D.-Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, L.
Right arrow Articles by Xu, D.-Q.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online