Clinical Cancer Research CR Surrogrates Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Clinical Cancer Research 14, 984, February 15, 2008. doi: 10.1158/1078-0432.CCR-07-0828
© 2008 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chia, M. C.
Right arrow Articles by Liu, F.-F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chia, M. C.
Right arrow Articles by Liu, F.-F.

Human Cancer Biology

Nuclear Factor-Y and Epstein Barr Virus in Nasopharyngeal Cancer

Marie C. Chia1,3, Abby Leung1,3, Tiffany Krushel1,3, Nehad M. Alajez1,3, Kwok W. Lo5, Pierre Busson6, Henry J. Klamut1, Carlo Bastianutto1,3 and Fei-Fei Liu1,2,3,4

Authors' Affiliations: 1 Departments of Medical Biophysics and 2 Department of Radiation Oncology, University of Toronto; 3 Division of Applied Molecular Oncology, Ontario Cancer Institute and 4 Department of Radiation Oncology Princess Margaret Hospital, University Health Network, Toronto, Canada; 5 Departments of Anatomical and Cellular Pathology, Chinese University of Hong Kong, Hong Kong, China; and 6 Laboratoire de Biologie des Tumeurs Humaines, Institut Gustave Roussy, Villejuif, France

Requests for reprints: Fei-Fei Liu, Department of Radiation Oncology, Princess Margaret Hospital/Ontario Cancer Institute, 610 University Avenue, Toronto, Ontario, Canada M5G 2M9. Phone: 416-946-2123; Fax: 416-946-4586; E-mail: Fei-Fei.Liu{at}rmp.uhn.on.ca.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Purpose: The Epstein Barr virus (EBV) is intimately associated with nasopharyngeal cancer (NPC) in a latent state expressing a limited number of genes. The process of switching from latency to replication is not well understood, particularly in response to DNA stress; hence, the focus of this study is on an EBV-positive NPC model.

Experimental Design: C666-1 cells were exposed to radiation (2-15 Gy) or cisplatin (0.1-50 µg/mL) assayed subsequently for relative EBV copy number (BamHI) and lytic gene expression (BRLF1 and BZLF1) using quantitative real-time PCR. Chromatin immunoprecipitation was conducted to assess the interaction of the transcription factor nuclear factor-Y (NF-Y) with promoter sequences.

Results: Radiation-induced and cisplatin-induced BamHI expression, along with increased levels of BRLF1 and BZLF1 in a dose-dependent and time-dependent manner, associated with the immediate nuclear transactivation of the transcription factor NF-Y and its own increased transcription of NF-Y subunits 8 h posttreatment. In silico analysis revealed three putative NF-Y consensus-binding sequences in the promoter region of BRLF1, which all interacted with NF-Y in response to radiation and cisplatin, confirmed using chromatin immunoprecipitation. Introduction of dominant-negative NF-YA reduced BRLF1 expression after radiation and cisplatin by 2.8-fold; in turn, overexpression of NF-YA resulted in a 2-fold increase in both BRLF1 and BZLF1 expression.

Conclusions: These results show that NF-Y is an important mediator of EBV stress response in switching from a latent to lytic state. This novel insight could provide a potential therapeutic strategy to enhance NPC response to radiation and cisplatin.

Nasopharyngeal cancer (NPC) is a malignancy of the head and neck that affects a relatively young population with a median age of onset in the mid-1940s (1). NPC is endemic to certain geographic regions, such as Southeast Asia, and is associated with several environmental and genetic factors (2). NPC is also unique with its intimate association with the Epstein Barr virus (EBV) where over 80% of NPC patients worldwide harbor the EBV genome in their cancer cells (3).

The current treatment regimen for NPC is fractionated radiotherapy (radiation), and patients with advanced disease are also treated with chemotherapy, such as cisplatin (cis-diamminedichloroplatinum II) achieving an overall 5-year survival of ~65% (4). It has been repeatedly observed that plasma EBV gene copy number increases significantly immediately after treatment with radiation with or without chemotherapy (5), implying that either the NPC cells are undergoing apoptosis (6) or that the EBV genome might be switching from a latent to a lytic phase of gene expression. This latter possibility is the focus of our current investigation.

Agents that activate the cellular stress response, including radiation and chemotherapy, have been investigated with respect to their effects on the latent EBV within EBV-positive models, such as Burkitt's lymphoma and lymphoblastoid cell lines, and have shown induction from a latent to lytic gene expression profile (7). This transition is mediated by the expression of one or both of the critical immediate-early lytic genes, BRLF1 and BZLF1. BZLF1 belongs to the extended fos/jun family of transcription factors, and through its interaction with specific activator protein 1–like BZLF1-binding motifs in the regulatory region of downstream lytic gene targets, it plays an important role in lytic gene expression (8). BRLF1 also plays an important role in the lytic phenotype where it binds directly to a GC-rich motif on its downstream targets (9). The regulation of these genes is complex, including self-regulatory feedback mechanisms, synergistic autoactivation of BRLF1 and BZLF1 processes (10), and regulatory roles of several other transcription factors (11). Despite these important experimental contributions, there remain many underlying mechanistic questions as to how clinically used modalities, such as radiation and/or chemotherapy (e.g., cisplatin), might affect EBV activation, particularly in NPC.

In this study, we identify nuclear factor-Y (NF-Y) as an important mediator in the regulation of BRLF1 and BZLF1 gene expression. NF-Y is a multisubunit transcription factor, composed of subunits NF-YA, NF-YB, and NF-YC, all of which are required for sequence recognition and subsequent transcriptional activation. The specific consensus binding sequence includes the CCAAT motif, which is estimated to be present in ~30% of human promoters (12). NF-Y is an important transcription factor that has been implicated as a critical regulator of genes in multiple biological processes, including parathyroid hormone activation (13) and multidrug resistance 1 expression (14). More recently, NF-Y has been shown to be important in the regulation of other genes involved in cellular stress response, such as GADD45 and HSP (15, 16). This current work characterizes the latent to lytic activation of EBV in response to clinically relevant stress agents in NPC, shown by an increase in BRLF1 and BZLF1 expression, mediated in part by NF-Y.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Cells, culture conditions, and tumor models. Cells and culture conditions were used as previously described (17). Briefly, the EBV-positive NPC cell line C666-1 were maintained in RPMI 1640 supplemented with 10% fetal bovine serum (Wisent, Inc.). All experiments were conducted when cells were in an exponential growth phase. Transfection experiments were done using LipofectAMINE 2000 (Sigma-Aldrich) with pDN-NF-YA (kindly provided by R. Mantovani) and pNF-YA (Origene). Using the manufacturers' protocol, a transfection efficiency of ~60% was achieved. Three NPC xenograft models were used: C15, C17, and C666-1; all propagated in the gastrocnemius muscle of severe combined immunodeficiency mice, as previously described (18).

Cisplatin and radiation treatment in vitro. To assess the effects of radiation, cells were irradiated at room temperature using a 137Cs unit (Gamma-cell 40 Exactor, Nordion International, Inc.) between 2 and 15 Gy (dose rate of 1.1 Gy/min). The chemotherapeutic agents 5-fluorouracil (5-500 g/mL; Sigma-Aldrich), cis-diamminedichloroplatinum II (cisplatin, 0-50 µg/mL; Mayne Pharma), and paclitaxel (Taxol, 0.01-5.0 µg/mL; Abbott Laboratories) were added directly to the cell media and used to assess the dose-dependent activation of EBV at 48 h posttreatment, unless otherwise indicated. When cells were treated with both cisplatin and radiation, cisplatin was added directly to the media followed immediately by radiation.

Cell viability assay. Cell viability was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay by seeding C666-1 cells in 96-well plates, and after approximately one doubling time or 24 h, cells were exposed to either cisplatin (25, 50, or 100 µg/mL) with or without radiation (15 Gy). Cell viability was determined two doubling times postinfection (7 days), as previously described (19). Briefly, cells were exposed to 10% 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide solution (Sigma-Aldrich), prepared in PBS and filter sterilized for 3 h. Acid-isopropanol (with 0.04 N HCl) was then added to all wells and mixed to dissolve the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide formazam crystals formed by viable cells. Plates were then read-on a Bio-Rad 3350 microplate reader at 570 nm (Bio-Rad).

Quantitative real-time PCR. Gene expression in response to treatment was determined by quantitative real-time PCR (qPCR). After treatment, total RNA was extracted and quantified, and 1 µg was reverse-transcribed for qPCR analysis at the stated time points after treatment (Qiagen RNeasy; Taqman reverse transcription reagents, Applied Biosystems). The SYBR green protocol was used as per manufacturer's instructions in a total reaction volume of 12.5 µL (SYBR green master mix, Applied Biosystems).

Unique primers were designed to amplify specific regions between 150 and 250 bp of the transcripts [BRLF1, BZLF1, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), NF-YA, NF-YB, NF-YC]. To assess changes in relative EBV genome level, genomic DNA was isolated (Qiagen DNeasy) and unique primers were used for the genomic region BamHI-W, as previously described by Lo et al. (20). Primer specificity for both mRNA and genomic DNA was confirmed by analysis of the fragment length using agarose gel electrophoresis and the presence of single-peak melting dissociation curves. Primer sequences used were as follows:

BamHI-W For: 5'CCCAACACTCCACCACACC'3, Rev: 5'TCTTAGGAGCTGTCCGAGGG'3.
BRLF1 For: 5'AATTTACAGCCGGGAGTGTG, Rev: 5'AGCCCGTCTTCTTACCCTGT'3.
BZLF1 For: 5'GGCTAACCAAGGACAACAGC'3, Rev: 5'TTCAGATGATTTGGCAGCAG'3.
GAPDH For: 5'GAAGGTGAAGGTCGGAGTC, Rev: 5'GAAGATGGTGATGGGATTTC'3.
NF-YA For: 5'TGGTCATCTGGACCATCGTA, Rev: 5'AGTTCCCCAAATGCTGTCAC'3.
NF-YB For: 5'AAAGGAATTTGAGGCCAGGT, Rev 5'CGATCTCGGCTCACTTTAGG'3.
NF-YC For: 5'GGCAGCCCAGATTTTTATCA, Rev: 5'GCTCGGCAGGAGTTACAGAC'3.

qPCR was done using a Perkin-Elmer/ABI Prism 7900 sequence detection system (Applied Biosystems) using the following cycling profile: 95°C for 10 min followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 1 min. All experiments were done independently in triplicate, and qPCR was conducted on the same samples in duplicate.

Results were reported as mean fold change in gene expression, calculated using the {Delta}{Delta}Ct method, where Ct values for the amplicon of interest were normalized to GAPDH expression compared with control or untreated cells.

Western blotting of NF-YA. Cell extracts were prepared in lysis buffer [0.1 mol/L Tris-Cl (pH 8.0), 0.1% SDS, 10 mmol/L EDTA, 2 mmol/L DTT, protease inhibitors] and protein concentrations were determined using the bicinchoninic acid protein assay (Bio-Rad). Immunoblotting was conducted as previously described (18). Briefly, samples containing equal amounts of protein were loaded onto a 4% to 12% SDS-PAGE gel, electrophoresed for 120 min at 100 V using the electrophoresis cell (Bio-Rad) and transferred onto nitrocellulose membranes using a transblot semidry cell (Bio-Rad). Membranes were blocked in 5% milk in PBST (0.1% Tween 20 in PBS) for 30 min at room temperature and then probed with 0.2 µg/mL of mouse monoclonal NF-YA/CBF-A (Santa Cruz Biotechnology) or GAPDH (Calbiochem), all in PBST containing 5% low fat milk. Blots were then washed with PBST and incubated with horseradish peroxidase–conjugated secondary antibodies detected using chemiluminescence (DuPont).

In vivo xenograft experiments. All animal experiments used severe combined immunodeficiency BALB/c mice obtained from the Ontario Cancer Institute, Animal Research Colony, and the experiments were conducted in accordance with the guidelines of the Animal Care Committee, Ontario Cancer Institute, University Health Network. Female severe combined immunodeficiency mice of ages 6 to 8 weeks were injected i.m. (left gastrocnemius) with ~106 cells (C666-1, C15, C17). After 2 to 4 weeks, tumor plus leg diameter reached 9 mm (0.3-0.4 g tumor), and the animals were then randomized into one of the following three groups: (a) control, no treatment; (b) cisplatin alone (4 mg/kg, i.p.); and (c) cisplatin (4 mg/kg, i.p.) followed immediately with radiation (15 Gy). For local radiation treatment, animals were immobilized in a lucite box with the tumor-bearing leg exposed to 100 kV at a dose rate of 10 Gy/min. Animals were euthanized, and tumor RNA was extracted at either 5 or 48 h posttreatment.

In silico promoter analysis. MatInspector Release Professional version 7.4 with Matrix Library version 5 (Genomatix) was used to analyze 2.8 kb upstream of the mRNA start site of BRLF1 from the B-98-5 EBV (HHV4) genomic sequence, NC_001345, 105183 to 10800 bp, (–) strand. Matrix families were used to identify potential binding sites of known transcription factors and weighed according to a matrix similarity algorithm. Three different matrices were used to identify potential NF-Y binding sites. Each matrix is weighted on a 15-bp sequence defined from compiled sequences identified experimentally.

ELISA. NF-Y activation was evaluated using an ELISA (TransAM, NF-YA transcription factor assay, Active Motif) as per manufacturer's instructions. Briefly, C666-1 cells were treated with cisplatin (50 µg/mL) and radiation (15 Gy); at 0.1, 0.5, 1, 4, 8, and 24 h posttreatment, nuclear lysates were collected. Extracts of interest and the positive control cell line (Jurkat) were added at a concentration of 5 µg per well to a pretreated 96-well plate containing the NF-YA binding consensus oligonucleotide sequence. A monoclonal NF-YA primary antibody (0.4 µg/mL) and antirabbit horseradish peroxidase–conjugated secondary antibody (0.4 µg/mL) were used for colorimetric quantification.

Chromatin immunoprecipitation. Chromatin immunoprecipitation was done using the commercially available system as per manufacturer's instructions (Active Motif). Briefly, cells were treated and fixed and cellular chromatin was isolated. Sonication shearing conditions were optimized to generate chromatin fragments between 200 and 1,000 bp (five pulses, 20 s with 30 s intervals on ice; 25% maximum intensity). Immunoprecipitation was done using the monoclonal NF-YA (BD PharMingen) and NF-YB (Santa Cruz Biotechnology) antibodies at 4 µg per reaction, overnight. A monoclonal TFIIB antibody and IgG were used as respective positive and negative controls for the immunoprecipitation reaction. Input DNA was obtained from the same treated cells and underwent the entire protocol except the immunoprecipitation reaction. The resulting enrichment of chromatin bound to the NF-Y protein TFIIB and IgG was quantitated using qPCR. Primers specific for the three predicted NF-Y consensus regions in the BRLF1 promoter were designed and confirmed (data not shown):

NF-1 For: 5'GGTCTGAAAATTCCCCATCC'3, Rev: 5'GCCCCAGTAGCATCTCTGTC'3.
NF-2 For: 5'TGTTTAAAGGCCCTGTCGTC'3, Rev: 5'ACTCCATGAGCTTGAAGCAG'3.
NF-3 For: 5'TGCTTCAAGCTCATGGAGTC'3, Rev: 5'ATGTGCAGCTTGCATACGAC'3.

A negative control primer set for a region of genomic DNA between the GAPDH gene and the chromosome condensation-related SMC-associated protein (CNAP1) gene was used, which should not be enriched by any of the antibodies:

NEG For: 5'ATGGTTGCCCACTGGGGATCT'3, Rev: 5'TGCCAAAGCCTAGGGGAAGA'3.
GAPDH For: 5'GAAGGTGAAGGTCGGAGTC'3, Rev: 5'GAAGATGGTGATGGGATTTC'3.

Quantitation of the amplification of the enriched chromatin fragments was normalized to the raw Ct values of the input DNA and compared with values obtained under control conditions.

Statistical analysis. All data are reported as mean ± SE, unless otherwise stated. Statistical differences between groups were determined using a Student's t test, one-way ANOVA test (Microsoft Excel).


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
Dose-dependent stress activation of EBV. To assess the effect of different DNA-damaging agents on EBV activation, C666-1 cells were treated with increasing doses of 5-fluorouracil, Taxol, cisplatin, and radiation (Fig. 1A-E ). qPCR was used to measure the level of BamH1-W expression, an indicator of EBV genome replication and copy number (21). There was no significant effect of 5-fluorouracil on EBV BamH1 expression at 48 h posttreatment (Fig. 1A). However, both Taxol and cisplatin alone induced a dose-dependent increase in BamH1 expression to a maximum of 3.0-fold and 5.2-fold over untreated controls, respectively (Fig. 1B and C). When C666-1 cells were exposed to increasing doses of radiation from 0 to 6 Gy, there was an associated modest increase in BamHI detection with maximal levels observed at 1.4-fold, 24 h postradiation, which did not differ significantly at either 48 h or 72 h postradiation (Fig. 1D).


Figure 1
View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Effect of chemotherapy and radiation on EBV BamHI expression. C666-1 cells were treated with 5-fluoruracil (0-500 µg/mL; A), Taxol (0-5 µg/mL; B), cisplatin (0-50 µg/mL; C), radiation (0-6 Gy; D), or cisplatin (25 or 50 µg/mL; E) with radiation (0-15 Gy). qPCR was used to measure copy numbers of BamHI within the EBV genome at 48 h posttreatment. Radiation alone was assayed at 24, 48, and 72 h posttreatment.

 
Because radiation and cisplatin are the mainstays of NPC clinical management, this combination was evaluated on EBV activation. Figure 1E again shows a dose-dependent increase in BamH1 expression with cisplatin alone at 48 h. Using 25 µg/mL cisplatin with 15 Gy of radiation, BamHI increased 2.3-fold over untreated controls. When C666-1 cells were treated with a higher dose cisplatin (50 µg/mL) combined with 15 Gy, a 6.5-fold increase in BamH1 expression was observed. Hence, these data confirm an increase in relative EBV genome copy number in C666-1 cells in response to agents, such as cisplatin, radiation, and Taxol, demonstrating EBV activation in response to DNA damage.

Viability of C666-1 cells after treatment with cisplatin and radiation was assessed using an 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. There is a dose-dependent decrease in cell viability with increasing doses of cisplatin and radiation (Fig. 2 ). At 48 h post–15 Gy, 85% of cells were viable; when combined with 25 or 50 µg/mL cisplatin, viability was further reduced to 41% and 47%, respectively. There was a time-dependent decrease in viability from 24 to 72 h after treatment, where cisplatin (25 µg/mL) and radiation (15 Gy) reduced viability to 77%, 40%, and 11% at 24, 48, and 72 h, respectively. At 48 h posttreatment, cisplatin (50 µg/mL) plus radiation (15 Gy) resulted in 47% cell viability, which were the doses chosen for the majority of the subsequent experiments.


Figure 2
View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. Cisplatin and radiation treatment reduce cell viability of C666-1 cells. C666-1 cells were treated with cisplatin (0, 25, or 50 µg/mL) followed immediately by radiation (15 Gy); viability was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay at 24, 48, and 72 h posttreatment.

 
Cisplatin and radiation treatment induce EBV lytic gene expression in vitro and in vivo. The switch from EBV latent to lytic gene expression profile is associated with the expression of two critical immediate-early genes BRLF1 and BZLF1. Figure 3A shows that when C666-1 cells are treated with cisplatin (50 µg/mL) and radiation (15 Gy), there is a significant time-dependent increase in expression of both BRLF1 and BZLF1, as assessed by qPCR. The expression of BRLF1 is significantly increased 8 h posttreatment and reaches a maximum level of 20-fold induction at 48 h over the paired time control group. BZLF1 expression also increases in a time-dependent manner to a maximum of ~23-fold at 48 h with a significant increase apparent at 8 h posttreatment (Fig. 3A). In a separate experiment, a more detailed examination of gene expression immediately after treatment shows a significant increase in BRLF1 expression within 5 min postcisplatin and radiation, followed by a comparable increase in BZLF1 expression observed at 1 h posttreatment (Fig. 3B), suggesting that BRLF1 might play a more dominant role in EBV stress activation in NPC.


Figure 3
View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. Increased expression of BRLF1 and BZLF1 after cisplatin and radiation treatment in NPC in vitro and in vivo. A, qPCR was used to determine BRLF1 and BZLF1 expression 2 to 48 h after treatment with cisplatin (50 µg/mL) and radiation (15 Gy). The data are reported as mean fold change in expression compared with that of matched untreated controls. B, qPCR analysis of lytic gene expression 5 min to 1 h posttreatment. BRLF1 (C) and BZLF1 (D) expression from C666-1 xenograft tumors analyzed at 5 h posttreatment of cisplatin (4 mg/kg, i.p.) with or without local tumor radiation (15 Gy). The data in C and D are plotted individually; solid lines indicate the mean value for each group.

 
The induction of BZLF1 and BRLF1 expression in response to cisplatin and radiation was also evaluated in vivo using several EBV-positive NPC xenograft models. Results of this analysis for the C666-1 xenograft model are shown in Fig. 3C and D. There was a trend observed for BRLF1 induction by 1.7-fold with cisplatin alone, which increased further with cisplatin plus radiation (2.4-fold induction); respective P values were 0.30 and 0.13. Similarly, BZLF1 induction was also observed with cisplatin (1.5-fold), which increased further with cisplatin and radiation (1.9-fold). The respective P values were 0.16 and 0.05, bordering on statistical significance with this last combination.

These data were very similar for the other two EBV-positive NPC xenograft models of C15 and C17 (data not shown). In summary, these experiments suggest that the increase in lytic EBV gene expression (BRLF1 and BZLF1) in response to cisplatin and radiation treatment is observed both in vitro and in vivo for NPC.

NF-Y interacts with regions of the BRLF1 promoter. An in silico analysis (Matinspector) of the promoter regions of BRLF1 and BZLF1 was conducted to evaluate the possible mechanisms by which these genes are influenced in response to stress agents, leading to the identification of NF-Y as a potential mediator (Fig. 4A ). NF-Y is a transcription factor that binds with high affinity and fidelity to CCAAT-containing consensus sequences and has also been described to be involved in cell cycle (22) and stem cell self-renewal (23).


Figure 4
View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. Interaction of NF-Y and the BRLF1 promoter in cells treated with cisplatin and radiation. A, schema depicting the genomic organization of the region containing BRLF1 and BZLF1 and their related promoters. Within the Rp regulatory region, three NF-Y consensus sequences denoted as NF1, NF2, and NF3 were identified. B, chromatin immunoprecipitation analysis of the BRLF1 promoter region. Specific primer sequences were designed and verified for three consensus regions NF1, NF2, and NF3. Cells were treated with cisplatin and radiation then analyzed for the potential interaction of the NF-Y protein with one or more of the NF consensus sequences at 6 h posttreatment. Data are analyzed as raw Ct normalized to the input DNA (sample that did not undergo immunoprecipitation) and reported as a function of the untreated group (*, P ≤ 0.05).

 
The hypothesis that the NF-Y protein complex was binding directly to one or more of these sites and thereby influencing transcriptional activation was evaluated using chromatin immunoprecipitation, which examines protein-DNA interactions in a cellular context. Here, C666-1 cells were treated with cisplatin alone or cisplatin plus radiation and analyzed at 6 and 24 h posttreatment (Fig. 4B). After immunoprecipitation with either NF-YA or NF-YB antibodies, the extent of chromatin enrichment after treatment was quantified by qPCR of all three putative consensus sequences on the BRLF1 promoter. Figure 4B shows that the NF-Y trimeric transcription factor seems to be indeed binding to the BRLF1 regulatory region after cisplatin alone or cisplatin plus radiation (P ≤ 0.05). This was observed early, at 6 h posttreatment, but not later at 24 h (data not shown), thereby documenting a physical interaction of NF-Y with the BRLF1 promoter soon after stress exposure with cisplatin or cisplatin plus radiation.

NF-Y is activated after cisplatin and radiation treatment. To assess the effect of NF-Y after stress, C666-1 cells were treated with cisplatin and radiation and an ELISA was done to assess NF-Y activation in a time-dependent manner (Fig. 5A ). Functional NF-Y transactivation was evaluated by exposing nuclear extracts to an oligonucleotide containing the NF-Y consensus sequence, where positive activity would result after the successful interaction of the NF-Y protein with the oligonucleotide. The sequence specificity of this interaction was confirmed using competitive oligonucleotides corresponding to wild-type and mutant NF-Y consensus sequences. As shown in Fig. 5A, there is an immediate and significant 1.8-fold increase in nuclear activation of NF-Y as early as 5 min after treatment relative to untreated control cells. This activation continues for up to 48 h posttreatment. These results indicate that NF-Y protein and/or function increases rapidly and is sustained for up to 2 days in the nucleus of C666-1 cells after cisplatin and radiation treatment.


Figure 5
View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. NF-Y activation and increased expression after cisplatin and radiation treatment. A, NF-Y transcriptional activation after treatment (cisplatin, 50 µg/mL and radiation, 15 Gy) was determined using an ELISA and sequence-specific competitive oligonucleotides. Results are reported as mean fold activation normalized to the wild-type oligonucleotide (to ensure sequence specificity) compared with untreated cells. Jurkat nuclear lysates were used as a positive control. B, qPCR analysis of NF-YA, NF-YB, and NF-YC expression 2 to 48 h posttreatment. Columns, mean fold change in gene expression compared with that of matched untreated controls; *, P ≤ 0.05. C, Western blot analysis of NF-YA protein expression after cisplatin and radiation treatment. There is the expected increase in both the 42 and 46 kDa isoforms observed; GAPDH protein expression was used as the loading control.

 
The NF-Y protein complex is composed of three independent subunits: NF-YA, NF-YB, and NF-YC; all of which are essential for its transcriptional activity. To assess the effect of cisplatin and radiation on NF-Y gene expression, transcript levels for each of the three subunits were assessed using qPCR. As shown in Fig. 5B, a significant time-dependent increase in NF-YA and NF-YB expression was first observed at 8 h posttreatment and reached maximal levels of 10.8-fold and 6.3-fold at 48 h, respectively. NF-YC expression remained unchanged after cisplatin and radiation exposure. Detailed analysis of transcript levels immediately after treatment showed stable expression for all three subunits between 5 min and 2 h posttreatment (data not shown).

Western blot analysis confirmed the increase in NF-YA expression at the protein level. Both the 42 and 46 kDa isoforms of the NF-YA protein were observed to increase between 4 and 24 h posttreatment (Fig. 5C). This series of studies confirm an almost immediate nuclear activation of NF-Y after cisplatin and radiation, associated with an increase in NF-YA protein expression. This is followed subsequently by a delayed increase in the expression of NF-YA and NF-YB transcripts (Fig. 5B).

NF-Y is an important regulator of BRLF1 and BZLF1 gene expression. To assess the importance of NF-Y on BRLF1 and BZLF1 expression, a dominant-negative NF-YA plasmid was transiently transfected into C666-1 cells. Once the cells have re-attached as a monolayer, 12 h posttransfection, they were treated with cisplatin and radiation. Control cells were transfected with B-galactosidase plasmid. BRLF1 and BZLF1 gene transcript levels were determined at 24, 48, and 72 h posttreatment by qPCR (Fig. 6A ). Induction of BRLF1 and BZLF1 expression were observed in B-galactosidase–transfected cells treated with cisplatin and radiation at 24, 48, and 72 h posttreatment. However, dominant-negative NF-YA–transfected cells showed a significant reduction in expression of both BRLF1 and BZLF1 genes, particularly at 72 h. Specifically, BRLF1 mean fold expression was decreased from 13.9-fold to 4.9-fold; BZLF1 expression also decreased from 12.8-fold to 8.1-fold, as a result of dominant-negative NF-YA.


Figure 6
View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 6. Dominant-negative and overexpression studies indicate an important role for NF-Y in the regulation of BRLF and BZLF1 expression. qPCR analysis of BRLF1 and BZLF1 after treatment with cisplatin and radiation in the presence of dominant-negative NF-YA (dN-NF-YA; A) and NF-YA (B). Cells were treated with cisplatin (50 µg/mL) and radiation (15 Gy) 12 h posttransfection. Cell lysates were collected at 24, 48, and 72 h posttreatment (not posttransfection) and RNA was isolated for qPCR analysis. Changes in gene expression in the presence of the dominant-negative NF-YA or NF-YA were compared with the B-galactosidase (B-gal) controls.

 
This role of NF-Y in regulating BRLF1 and BZLF1 activity was examined conversely using transient transfection of the NF-YA plasmid with cisplatin and radiation. Figure 6B reveals an initial modest increase in BRLF1 expression in NF-YA over B-galactosidase–transfected cells after treatment with cisplatin and radiation, but by 72 h, this increased from 4.3 to 7.9 mean fold change in gene expression. Under these same experimental conditions, there was a similar trend in BZLF1 expression, with an increase from 4.0-fold to 7.5-fold observed at 72 h. Taken together, these data indicate an important role for NF-Y in regulating the transcription of the EBV lytic genes, BRLF1 and BZLF1.


   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
This report is the first detailed characterization of EBV lytic gene expression in NPC after cisplatin and radiation and identification of NF-Y as an important mediator of this stress response. DNA-damaging agents, such as cisplatin and radiation, can induce EBV activation, associated with a significant induction in BRLF1 and BZLF1 lytic gene expression in a time-dependent manner. This, therefore, confirms the initiation of the EBV lytic gene expression profile after stress exposure, which is observed both in cells and in xenograft models in vivo. The modest induction in vivo might be partially explained by the observation that this induction is occurring only in a subpopulation of tumor cells, in that ~25% to 27% of cells expressed BZLF1 and BRLF1 72 h after cisplatin and radiation treatment in vitro (fluorescence-activated cell sorting data not shown). This subpopulation phenomenon has been observed in EBV-positive gastric (24) and B-cell models (7) after DNA-damaging treatments. The precise reason behind this subpopulation effect is unclear at the moment, but might be related to factors, such as the cell cycle phase.

Circulating levels of plasma EBV DNA is an established biomarker for monitoring NPC response to therapy (25); the precise etiology of these DNA fragments remains under investigation, but based on their short fragment sizes (~180 bp), they have been attributed to apoptotic death of NPC cells after exposure to chemotherapy and radiation (6). It is also observed that there is a "spike" in circulating EBV DNA levels immediately after the first treatment (5), suggesting an alternate hypothesis of the activation of EBV into a lytic phase. This hypothesis is supported by the detection of infectious EBV in NPC cells (26), the presence of the linear form of the EBV genome suggestive of a productive lytic cycle (27), and observations of BRLF1 expression in NPC biopsy samples along with circulating BRLF1 antibodies in NPC patients (28). Our current study supports the concept that EBV activation could contribute to the observed increased levels of circulating EBV after treatment.

One concern regarding this study might relate to the high radiation and cisplatin doses selected for evaluation given that radiation is usually given in a fractionated regimen, with 2 Gy per fraction, as opposed to 15 Gy as a single dose. In addition, the clinically used cisplatin dose of 100 mg/m2 is significantly less than the 50 µg/mL used for these studies. Radiation alone has a modest effect on BamHI expression level (Fig. 1D); the combination, however, of radiation with cisplatin, even at 5 Gy radiation with 25 µg/mL cisplatin, did induce almost a 2-fold increase in BamHI, demonstrating that even at these lower doses of DNA-damaging agents, the EBV genome seems to be doubling, suggesting a switch in the EBV program from a latent to lytic phase.

BRLF1 and BZLF1 are two critical early-immediate genes activated upon initiation of the lytic program (29). Our data show that although both BRLF1 and BZLF1 are induced upon treatment, BRLF1 may play a more prominent role in EBV activation in NPC, given its more immediate and pronounced induction after cisplatin and radiation (Fig. 3B). Other groups have shown that BRLF1 is sufficient to disrupt latency in several EBV-positive human tumor cell lines (30). Moreover, Westphal et al. have shown that infection with adenoviral BRLF1 induces the expression of late lytic protein BMRF1 in another NPC cell line (31). Hence, BRLF1 may be a more dominant mediator of the latent to lytic transition in NPC, although there is a complex and intimate relationship with BZLF1 in this activation process, particularly with other stressors, such as phorbol esters and sodium butyrate, where both BRLF1 and BZLF1 are important (24).

Experimental work has shown that BZLF1 could be initiated by one of two promoters: the Zp promoter and the more distal Rp promoter. Transcription from Zp is the major contributor to the expression of a 0.9-kb transcript, whereas the Rp promoter is responsible for not only BZLF1 transcription but also the more proximal BRLF1 expression. The proximal region of Zp, –221 to +12 has been characterized to contain several responsive elements to extracellular stimuli through the interaction with cellular transcription factors, including regions of cAMP-responsive element binding protein/activating transcription factor 1 binding, Sp1/Sp3, and a more distal YY1-negative element (32). In addition, the Zp promoter activity is regulated through chromatin structure, where upon external signaling, the inactive state maintained by histone deacetylation is released after phosphorylation of MEF-2D with subsequent recruitment of histone acetyl transferase, resulting in histone acetylation (33). An added level of regulation is achieved through an autoactivation mechanism mediated by the binding of the BZLF1 homodimer to the Zp promoter (34).

Characterization of the proximal region of the Rp promoter has also revealed several sites for cellular transcription factor binding, including Sp1, YY1, and Zif268 (35, 36). Moreover, autoactivation of BRLF1 is achieved through two Sp1-binding sites at –279 and –45 relative to the transcriptional start site (37). Using 5'-deletion constructs of the BRLF1 promoter region, Glaser et. al. examined up to –962 bp of the transcriptional start site, where they identified the distal NF1 site as being important for BRLF1 expression (38).

Our in silico analysis of the BRLF1 promoter was extended to –2.8 kb beyond the transcriptional start site, thereby identifying many more potential cellular transcription factor binding sites, including three CCAAT-containing consensus sequences for NF-Y (Fig. 4). NF-Y has been shown to be involved in viral gene expression with a role in latent gene expression from the EBV Cp promoter (39), and in other viral systems, such as hepatitis B (40), cytomegalovirus (41), adenovirus (42), and retroviral gene expression (43). There is emerging evidence of the role of NF-Y stress response further supporting its candidacy as a potential mediator of EBV response to radiation and cisplatin treatment in NPC (15).

Our data show that cisplatin and radiation induce an immediate NF-Y nuclear translocation and activation that increases to maximal levels at 4 h posttreatment (Fig. 5C). This significant increase in nuclear transactivation suggests a nuclear localization of the NF-Y protein upon stress. This is supported by Kahle et al., who showed that the NF-Y complex, which normally resides in the cytoplasm, rapidly translocates to the nucleus through a dual mechanism where NF-YA is transported in an importin β-dependent pathway, whereas the NF-YB and NF-YC subunits are translocated through a distinct pathway involving importin 13 (44). Our investigation of all three NF-Y subunits in response to cisplatin and radiation showed an increase in NF-YA and NF-YB transcript levels beginning at 8 h reaching maximal levels 48 h posttreatment (Fig. 5B). To our knowledge, this is the first report of a detailed kinetics evaluation of NF-Y expression after stress exposure.

Until recently, NF-Y target genes seemed to be regulated through NF-Y consensus sites located approximately –60 to –100 bp upstream of the transcriptional start site. However, recent evidence has demanded a broader definition in that growth hormone receptor (45), MHCII (46), and Hoxb4 (47) have all have been shown to be regulated through more distal NF-Y sites. In addition, a thorough chromatin immunoprecipitation on on-chip (microarray) analysis confirmed the exception to the position rule by demonstrating that NF-Y is not necessarily a promoter-specific factor. In fact 40% to 50% of NF-Y regulated genes containing CCAAT sites were located distant to the transcriptional start site (48).

Our experimental data support a model (Fig. 7 ) where, upon stress treatment with cisplatin and radiation, NF-Y localizes to the nucleus (44) and transcriptionally activates the expression of the EBV lytic genes BRLF1 and BZLF1 within 30 min. NF-Y activation of BRLF1 may be mediated by the physical interaction of NF-Y with one or a combination of the three consensus sequences within the distal promoter region. Alternatively, this interaction might also be occurring through participation of cofactors, such as Oct-1 (15) or Sp1 (39). Finally, NF-Y may also be exerting its effect indirectly through the up-regulation of the transcription factor Sp3 and its subsequent involvement in BRLF1 autoactivation (49), allowing for a positive feedback loop with further amplification of NF-Y–mediated lytic gene expression (Fig. 7).


Figure 7
View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 7. Model of NF-Y–mediated expression of BRLF1/BZLF1 after radiation and cisplatin treatment. NF-Y localizes to the nucleus almost immediately after stress treatment either directly in response to stress or mediated by unknown factors (i). Upon nuclear localization, NF-Y mediates BRLF1 and BZLF1 expression through a direct interaction with the regulatory regions (ii) and/or with cofactors (iii), such as Oct-1 or Sp1. The relationship between NF-Y and BRLF1 may be further potentiated by the presence of BRLF1 consensus sites within the NF-YA regulatory region (iv).

 
EBV activation has been shown to have important potential therapeutic applications. Treatment with radiation, chemotherapy, or sodium butyrate can induce expression of an EBV late lytic gene BXLF1, a homologue of the herpes simplex thymidine kinase. BXLF1 is a potential sensitizer to ganciclovir, whereby BXLF1 could phosphorylate ganciclovir, resulting in the production of a nucleotide analogue thereby causing chain termination. This approach of ganciclovir, combined with radiation or chemotherapy, has already been shown to achieve greater cytotoxicity and tumor growth delay when compared with either radiation and chemotherapy alone (50). Similarly, a recent study had used bortezomib to activate EBV lytic gene expression, thereby facilitating the imaging of EBV positive malignancies in vivo (51).

In conclusion, for the first time, we have shown that the NF-Y transcription factor is an important mediator of EBV stress response in switching from latent to lytic gene expression in NPC models, occurring both in vitro and in vivo. This important observation not only offers biological insight but might also provide treatment opportunities, whereby NPC response could be potentially enhanced through manipulations of this regulatory pathway.


   Footnotes
 
Grant support: Canadian Institutes of Health Research, Elia Chair in Head and Neck Cancer Research, and Canadian Institutes of Health Research Doctoral Award (M.C. Chia).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 4/10/07; revised 7/27/07; accepted 10/16/07.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Parkin DM, Ferlay J, Raymond L, Young J. Cancer incidence in five continents. IARC Scientific Publications No. 143 vol. 7; 1997 pp. 534–6.
  2. Hildesheim A, Levine PH. Etiology of nasopharyngeal carcinoma: a review. Epidemiol Rev 1993;15:466–85.[Free Full Text]
  3. Chen CL, Wen WN, Chen JY, Hsu MM, Hsu HC. Detection of Epstein-Barr virus genome in nasopharyngeal carcinoma by in situ DNA hybridization. Intervirology 1993;36:91–8.[Medline]
  4. Baujat B, Audry H, Bourhis J, et al. Chemotherapy in locally advanced nasopharyngeal carcinoma: an individual patient data meta-analysis of eight randomized trials and 1753 patients. Int J Radiat Oncol Biol Phys 2006;64:47–56.[CrossRef][Medline]
  5. Lo YM, Leung SF, Chan LY, et al. Kinetics of plasma Epstein-Barr virus DNA during radiation therapy for nasopharyngeal carcinoma. Cancer Res 2000;60:2351–5.[Abstract/Free Full Text]
  6. Jahr S, Hentze H, Englisch S, et al. DNA fragments in the blood plasma of cancer patients: quantitations and evidence for their origin from apoptotic and necrotic cells. Cancer Res 2001;61:1659–65.[Abstract/Free Full Text]
  7. Westphal EM, Blackstock W, Feng W, Israel B, Kenney SC. Activation of lytic Epstein-Barr virus (EBV) infection by radiation and sodium butyrate in vitro and in vivo: a potential method for treating EBV-positive malignancies. Cancer Res 2000;60:5781–8.[Abstract/Free Full Text]
  8. Amon W, Farrell PJ. Reactivation of Epstein-Barr virus from latency. Rev Med Virol 2005;15:149–56.[CrossRef][Medline]
  9. Gruffat H, Duran N, Buisson M, Wild F, Buckland R, Sergeant A. Characterization of an R-binding site mediating the R-induced activation of the Epstein-Barr virus BMLF1 promoter. J Virol 1992;66:46–52.[Abstract/Free Full Text]
  10. Liu P, Speck SH. Synergistic autoactivation of the Epstein-Barr virus immediate-early BRLF1 promoter by Rta and Zta. Virology 2003;310:199–206.[Medline]
  11. Speck SH, Chatila T, Flemington E. Reactivation of Epstein-Barr virus: regulation and function of the BZLF1 gene. Trends Microbiol 1997;5:399–405.[CrossRef][Medline]
  12. FitzGerald PC, Shlyakhtenko A, Mir AA, Vinson C. Clustering of DNA sequences in human promoters. Genome Res 2004;14:1562–74.[Abstract/Free Full Text]
  13. Alimov AP, Park-Sarge OK, Sarge KD, Malluche HH, Koszewski NJ. Transactivation of the parathyroid hormone promoter by specificity proteins and the nuclear factor Y complex. Endocrinology 2005;146:3409–16.[Abstract/Free Full Text]
  14. Jin S, Scotto KW. Transcriptional regulation of the MDR1 gene by histone acetyltransferase and deacetylase is mediated by NF-Y. Mol Cell Biol 1998;18:4377–84.[Abstract/Free Full Text]
  15. Jin S, Fan F, Fan W, et al. Transcription factors Oct-1 and NF-YA regulate the p53-independent induction of the GADD45 following DNA damage. Oncogene 2001;20:2683–90.[CrossRef][Medline]
  16. Imbriano C, Bolognese F, Gurtner A, Piaggio G, Mantovani R. HSP-CBF is an NF-Y-dependent coactivator of the heat shock promoters CCAAT boxes. J Biol Chem 2001;276:26332–9.[Abstract/Free Full Text]
  17. Li JH, Chia M, Shi W, et al. Tumor-targeted gene therapy for nasopharyngeal carcinoma. Cancer Res 2002;62:171–8.[Abstract/Free Full Text]
  18. Chia MC, Shi W, Li JH, et al. A conditionally replicating adenovirus for nasopharyngeal carcinoma gene therapy. Mol Ther 2004;9:804–17.[CrossRef][Medline]
  19. Li JH, Huang D, Sun BF, et al. Efficacy of ionizing radiation combined with adenoviral p53 therapy in EBV-positive nasopharyngeal carcinoma. Int J Cancer 2000;87:606–10.[CrossRef][Medline]
  20. Lo YM, Chan LY, Lo KW, et al. Quantitative analysis of cell-free Epstein-Barr virus DNA in plasma of patients with nasopharyngeal carcinoma. Cancer Res 1999;59:1188–91.[Abstract/Free Full Text]
  21. Chan KC, Lo YM. Circulating EBV DNA as a tumor marker for nasopharyngeal carcinoma. Semin Cancer Biol 2002;12:489–96.[CrossRef][Medline]
  22. Caretti G, Salsi V, Vecchi C, Imbriano C, Mantovani R. Dynamic recruitment of NF-Y and histone acetyltransferases on cell-cycle promoters. J Biol Chem 2003;278:30435–40.[Abstract/Free Full Text]
  23. Zhu J, Zhang Y, Joe GJ, Pompetti R, Emerson SG. NF-Ya activates multiple hematopoietic stem cell (HSC) regulatory genes and promotes HSC self-renewal. Proc Natl Acad Sci U S A 2005;102:11728–33.[Abstract/Free Full Text]
  24. Feng WH, Israel B, Raab-Traub N, Busson P, Kenney SC. Chemotherapy induces lytic EBV replication and confers ganciclovir susceptibility to EBV-positive epithelial cell tumors. Cancer Res 2002;62:1920–6.[Abstract/Free Full Text]
  25. Lin JC, Wang WY, Chen KY, et al. Quantification of plasma Epstein-Barr virus DNA in patients with advanced nasopharyngeal carcinoma. N Engl J Med 2004;350:2461–70.[Abstract/Free Full Text]
  26. Trumper PA, Epstein MA, Giovanella BC, Finerty S. Isolation of infectious EB virus from the epithelial tumour cells of nasopharyngeal carcinoma. Int J Cancer 1977;20:655–62.[Medline]
  27. Raab-Traub N, Flynn K. The structure of the termini of the Epstein-Barr virus as a marker of clonal cellular proliferation. Cell 1986;47:883–9.[CrossRef][Medline]
  28. Feng P, Chan SH, Soo MY, et al. Antibody response to Epstein-Barr virus Rta protein in patients with nasopharyngeal carcinoma: a new serologic parameter for diagnosis. Cancer 2001;92:1872–80.[CrossRef][Medline]
  29. Takada K, Ono Y. Synchronous and sequential activation of latently infected Epstein-Barr virus genomes. J Virol 1989;63:445–9.[Abstract/Free Full Text]
  30. Bogedain C, Alliger P, Schwarzmann F, Marschall M, Wolf H, Jilg W. Different activation of Epstein-Barr virus immediate-early and early genes in Burkitt lymphoma cells and lymphoblastoid cell lines. J Virol 1994;68:1200–3.[Abstract/Free Full Text]
  31. Westphal EM, Mauser A, Swenson J, Davis MG, Talarico CL, Kenney SC. Induction of lytic Epstein-Barr virus (EBV) infection in EBV-associated malignancies using adenovirus vectors in vitro and in vivo. Cancer Res 1999;59:1485–91.[Abstract/Free Full Text]
  32. Montalvo EA, Cottam M, Hill S, Wang YJ. YY1 binds to and regulates cis-acting negative elements in the Epstein-Barr virus BZLF1 promoter. J Virol 1995;69:4158–65.[Abstract]
  33. Jenkins PJ, Binne UK, Farrell PJ. Histone acetylation and reactivation of Epstein-Barr virus from latency. J Virol 2000;74:710–20.[Abstract/Free Full Text]
  34. Flemington E, Speck SH. Autoregulation of Epstein-Barr virus putative lytic switch gene BZLF1. J Virol 1990;64:1227–32.[Abstract/Free Full Text]
  35. Zalani S, Holley-Guthrie E, Kenney S. The Zif268 cellular transcription factor activates expression of the Epstein-Barr virus immediate-early BRLF1 promoter. J Virol 1995;69:3816–23.[Abstract]
  36. Zalani S, Coppage A, Holley-Guthrie E, Kenney S. The cellular YY1 transcription factor binds a cis-acting, negatively regulating element in the Epstein-Barr virus BRLF1 promoter. J Virol 1997;71:3268–74.[Abstract]
  37. Ragoczy T, Miller G. Autostimulation of the Epstein-Barr virus BRLF1 promoter is mediated through consensus Sp1 and Sp3 binding sites. J Virol 2001;75:5240–51.[Abstract/Free Full Text]
  38. Glaser G, Vogel M, Wolf H, Niller HH. Regulation of the Epstein-Barr viral immediate early BRLF1 promoter through a distal NF1 site. Arch Virol 1998;143:1967–83.[CrossRef][Medline]
  39. Borestrom C, Zetterberg H, Liff K, Rymo L, Functional interaction of nuclear factor y and sp1 is required for activation of the epstein-barr virus C promoter. J Virol 2003;77:821–9.[CrossRef][Medline]
  40. Lu CC, Yen TS. Activation of the hepatitis B virus S promoter by transcription factor NF-Y via a CCAAT element. Virology 1996;225:387–94.[CrossRef][Medline]
  41. Chen J, Stinski MF. Activation of transcription of the human cytomegalovirus early UL4 promoter by the Ets transcription factor binding element. J Virol 2000;74:9845–57.[Abstract/Free Full Text]
  42. Song B, Young CS. Functional analysis of the CAAT box in the major late promoter of the subgroup C human adenoviruses. J Virol 1998;72:3213–20.[Abstract/Free Full Text]
  43. Yu X, Zhu X, Pi W, et al. The long terminal repeat (LTR) of ERV-9 human endogenous retrovirus binds to NF-Y in the assembly of an active LTR enhancer complex NF-Y/MZF1/GATA-2. J Biol Chem 2005;280:35184–94.[Abstract/Free Full Text]
  44. Kahle J, Baake M, Doenecke D, Albig W. Subunits of the heterotrimeric transcription factor NF-Y are imported into the nucleus by distinct pathways involving importin β and importin 13. Mol Cell Biol 2005;25:5339–54.[Abstract/Free Full Text]
  45. Gowri PM, Yu JH, Shaufl A, Sperling MA, Menon RK. Recruitment of a repressosome complex at the growth hormone receptor promoter and its potential role in diabetic nephropathy. Mol Cell Biol 2003;23:815–25.[Abstract/Free Full Text]
  46. Dorn A, Fehling HJ, Koch W, et al. B-cell control region at the 5' end of a major histocompatibility complex class II gene: sequences and factors. Mol Cell Biol 1998;8:3975–87.
  47. Gilthorpe J, Vandromme M, Brend T, et al. Spatially specific expression of Hoxb4 is dependent on the ubiquitous transcription factor NFY. Development 2002;129:3887–99.[Medline]
  48. Testa A, Donati G, Yan P, et al. Chromatin immunoprecipitation (ChIP) on chip experiments uncover a widespread distribution of NF-Y binding CCAAT sites outside of core promoters. J Biol Chem 2005;280:13606–15.[Abstract/Free Full Text]
  49. Tapias A, Monasterio P, Ciudad CJ, Noe V. Characterization of the 5'-flanking region of the human transcription factor Sp3 gene. Biochim Biophys Acta 2005;1730:126–36.[Medline]
  50. Gutierrez MI, Judde JG, Magrath IT, Bhatia KG. Switching viral latency to viral lysis: a novel therapeutic approach for Epstein-Barr virus-associated neoplasia. Cancer Res 1996;56:969–72.[Abstract/Free Full Text]
  51. Fu DX, Tanhehco YC, Chen J, et al. Virus-associated tumor imaging by induction of viral gene expression. Clin Cancer Res 2007;13:1453–8.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
N. M. Alajez, J. D. Mocanu, W. Shi, M. C. Chia, C. J. Breitbach, A. B.Y. Hui, S. Knowles, J. C. Bell, P. Busson, K. Takada, et al.
Efficacy of Systemically Administered Mutant Vesicular Stomatitis Virus (VSV{Delta}51) Combined with Radiation for Nasopharyngeal Carcinoma
Clin. Cancer Res., August 1, 2008; 14(15): 4891 - 4897.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chia, M. C.
Right arrow Articles by Liu, F.-F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chia, M. C.
Right arrow Articles by Liu, F.-F.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online