Clinical Cancer Research Grants AACR Membership
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gleave, M.
Right arrow Articles by Goldie, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gleave, M.
Right arrow Articles by Goldie, J.
Clinical Cancer Research Vol. 5, 2891-2898, October 1999
© 1999 American Association for Cancer Research


Experimental Therapeutics, Preclinical Pharmacology

Progression to Androgen Independence Is Delayed by Adjuvant Treatment with Antisense Bcl-2 Oligodeoxynucleotides after Castration in the LNCaP Prostate Tumor Model1

Martin Gleave2, Anthony Tolcher, Hideaki Miyake, Colleen Nelson, Bob Brown, Eliana Beraldi and James Goldie

Division of Urology, Vancouver General Hospital [M. G., H. M., C. N.], and Departments of Cancer Endocrinology [M. G., H. M., C. N., E. B.] and Medical Oncology [A. T., J. G.], British Columbia Cancer Agency, Vancouver, British Columbia; Genta Inc., Lexington, Massachusetts [B. B.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bcl-2 has emerged as a critical regulator of apoptosis in a variety of cell systems and is up-regulated during progression to androgen independence in prostate cancer cells. The objectives of this study were to characterize changes in Bcl-2 after androgen withdrawal and during progression to androgen independence in the human prostate LNCaP tumor model and determine whether adjuvant use of antisense Bcl-2 oligodeoxynucleotides (ODNs) with androgen ablation delays progression to androgen independence. Bcl-2 expression in LNCaP cells is down-regulated to undetectable levels by androgen in vitro and up-regulated after castration in vivo. Antisense Bcl-2 ODN treatment reduced LNCaP cell Bcl-2 messenger RNA and protein levels by >90% in a sequence-specific and dose-dependent manner at concentrations >50 nM. Bcl-2 mRNA levels returned to pretreatment levels by 48 h after discontinuing treatment. Athymic male mice bearing SQ LNCaP tumors were castrated and injected i.p. with 12.5 mg/kg/day with two-base mismatch ODN control, reverse polarity ODN control, or antisense Bcl-2 ODN. Tumor volume in control mice gradually increased 5-fold (range, 3–6) by 12 weeks after castration compared to a 10–50% decrease in precastrate tumor volume in mice treated with antisense Bcl-2 ODN. Changes in serum PSA paralleled changes in tumor volume, increasing 4-fold faster above nadir in controls than in mice treated with antisense Bcl-2 ODN. After decreasing 70% by 1 week after castration, PSA increased 1.6-fold above precastrate levels by 11 weeks in controls while staying 30% below precastrate levels in antisense-treated mice. In a second group of experiments, LNCaP tumor growth and serum PSA levels were 90% lower (P < 0.01) in mice treated with antisense Bcl-2 ODN compared with mismatch or reverse polarity ODN controls. These results support the hypothesis that Bcl-2 helps mediate progression to androgen independence and is an appropriate target for antisense therapy.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Prostate cancer is the most common cancer in men with over 200,000 new cases being diagnosed in North America in 1996 and <40,000 deaths/year in the United States from disseminated hormone-refractory prostate cancer (1) . Androgen withdrawal therapy remains the only efficacious treatment for advanced prostate cancer, leading to tumor cell apoptosis and >90% decrease in serum PSA3 levels. Responses, although marked, are temporary, lasting, on average, 18–24 months. The development of androgen-independent prostate cancer is heralded by a rise in serum PSA and a return of clinical symptoms, most prominently painful bone metastases. Therapeutic options at this phase of the disease are limited and confined to palliative radiotherapy. Despite several hundred clinical studies of both experimental and approved single agents, chemotherapy has limited antitumor activity in hormone-refractory prostate cancer, with objective response rates generally below 10% and no demonstrated survival benefit (2) .

Progression to androgen independence is a multifactorial process by which cells acquire the ability to both survive in the absence of androgens and proliferate using nonandrogenic stimuli for mitogenesis (3) . At the molecular level, some genes initially dependent on androgens for expression, such as PSA, become constitutively expressed (4 , 5) , whereas many other genes become aberrantly expressed and actively participate, or passively accompany, the progression to androgen independence (3 , 6) . Recent evidence suggests that a critical step in progression to androgen-independent prostate carcinoma may involve overexpression of Bcl-2, which blocks apoptosis induced by androgen withdrawal. The Bcl-2 proto-oncogene belongs to a family of related genes, the proteins of which regulate a final common pathway regulating programmed cell death in both normal and abnormal cell populations (7 , 8) . Bcl-2-transfected cell lines exhibit prolonged survival in growth factor-deprived medium and greater resistance to heat shock stress, various chemotherapeutic agents, and irradiation (9, 10, 11, 12, 13) . Intrinsic expression of Bcl-2 by prostate carcinoma tissue may result in resistance to the effects of hormone manipulation because higher proportion of nonresponders or early relapsers to hormonal therapy occurred in patients strongly expressing Bcl-2 (14, 15, 16) . Virtually all hormone-refractory prostate carcinomas express Bcl-2, which supports the hypothesis that Bcl-2 expression confers resistance to androgen withdrawal by cells blocking the usual apoptotic signal from androgen manipulation (17) . Indeed, stable Bcl-2 transfection of LNCaP cells increased in vitro resistance to serum starvation, increased in vivo tumorigenicity, and accelerated tumor growth in male mice after castration (18) .

Accumulating evidence suggests that Bcl-2 overexpression protects prostate cancer cells from apoptosis after androgen withdrawal and, therefore, represents a suitable molecular target with antisense technology. Antisense ODNs are modified stretches of single-stranded DNA that are complementary to mRNA regions of a target gene and thereby block translation and protein synthesis. Phosphorothioate ODNs are stabilized to resist nuclease digestion by substituting one of the nonbridging phosphoryl oxygens of DNA with a sulfur (19 , 20) . The objectives of this study were to define in vitro and in vivo effects of androgens and androgen withdrawal on Bcl-2 gene expression in the LNCaP tumor model, to determine the effects of antisense-Bcl-2 ODN on Bcl-2 mRNA levels in LNCaP cells in vitro, and to evaluate the ability of antisense-BCL-2 ODN to delay time to androgen-independent progression of LNCaP tumors after castration.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and Cell Lines.
LNCaP cells were maintained in RPMI 1640 (Terry Fox Laboratory, Vancouver, British Columbia, Canada) with 5% FBS (Life Technologies, Inc., Burlington, Ontario, Canada) as described previously (4 , 21) . Male athymic nude mice (BALB/c strain), 6–8 weeks of age, were purchased from Harlan Sprague Dawley, Inc. (Indianapolis, IN).

Bcl-2 ODNs.
The following Bcl-2 ODNs were kindly provided by Genta Inc. (San Diego, CA): antisense Bcl-2 ODN (sequence, 5'-TCTCCCAGCGTGCGCCAT), a two-base mismatch control ODN (5'-TCTCCCAGCATGTGCCAT), and a reverse control ODN (sequence, 5'-TACCGCGTGCGACCCTCT). All ODNs are 18-mer phosphorothioates targeting the translation initiation site. ODNs were stored at -20°C at concentration in 10 mM Tris and 1 mM EDTA.

Evaluation of Androgen and ODN Effects on Bcl-2 mRNA Levels in Vitro.
LNCaP cells (5 x 106) were plated in 30-mm dishes (Falcon) in RPMI + 5% FBS. When LNCaP cell cultures reached 70–80% confluence, the cell medium was changed to RPMI + 1% charcoal-stripped FBS and treated with various concentrations of antisense or control ODN +/- 10 µl of lipofectin (Life Technologies, Inc., Gaithersburg, MD) for 6 h, or androgen (10 nM R1881) for 24 h. Controls were treated with equivalent concentrations of lipofectin (Life Technologies Inc.) or medium alone. One day later, total RNA was isolated from LNCaP cells using the 4 M guanidinium thiocyanate extraction method, as described in previous studies (22) , and 4 µg were reverse transcribed by Moloney murine leukemia virus reverse transcriptase. For the PCR reaction, 5 µl of the synthesized cDNA were added to 45 µl of a reaction solution containing 1x PCR buffer (20 mM Tris-HCL and 50 mM KCl), 2 mM MgCl2, 160 µM dNTPs, 1 µM each of the primers bcl2, 2.5 units of Taq polymerase, and 70 nM Taq start antibody (23) . The upstream sequence primer beginning at nucleotide 1814 in the human Bcl-2 complementary DNA sequence is 5'-TGCACCTGACGCCTTCAC-3', and the downstream primer at nucleotide 2377 is 5'-TAGCTGATTCGACGTTTTGCCTGA-3'. The gene bank accession number for Bcl-2 is M 13994. After 40 cycles of amplification, the PCR products were analyzed by ethidium bromide-stained agarose gel electrophoresis. GADPH primers were used in parallel reactions to verify the integrity of the RNA. Experiments were repeated three times, and representative examples are shown.

Evaluation of ODN Effects on LNCaP Cell Apoptosis in Vitro.
When LNCaP cell cultures reached 70–80% confluence, cell medium was changed to serum-free RPMI with 100 nM antisense or control mismatch ODN with 10 µl of lipofectin (Life Technologies, Inc.). After 6 h, cell medium was changed to RPMI + 1% charcoal-stripped serum for 18 h. Additional 6-h incubations were performed every 24 h for 5 days. Controls were treated with equivalent concentrations of lipofectin (Life Technologies, Inc.) or medium alone. After 5 days, cells were harvested and assayed for DNA fragmentation and flow cytometry. DNA fragmentation was used to detect apoptosis induced by ODN treatment and was analyzed by agarose gel electrophoresis (24) . Flow cytometric evaluation for apoptosis was performed as described previously (25) .

In Vitro Mitogenic Assays.
Effects of antisense Bcl-2 ODN on LNCaP cell growth in vitro was assessed using a 96-well assay based on the uptake and elution of crystal violet dye by the cells in each well (21) . Three thousand LNCaP cells were plated/well in 96-well plates (Falcon) in RPMI with 5% FBS, and the cell media was changed to various concentrations of antisense or mismatch ODN (500 nM, 1 µM, 5 µM, and 10 µM plus lipofectin) 24 h later. One week later, the cells were fixed in 1% glutararalydehyde (Sigma), stained with 0.5% crystal violet (Sigma), and eluted with 100 µl of Sorensen’s solution (9 mg of trisodium citrate in 305 ml of distilled H2O, 195 ml of 0.1 N HCl, and 500 ml of 90% ethanol). Absorbance of each well was measured by a Titertek Multiskan TCC/340 (Flow Laboratories, McLean, VA) at 560 nm.

Bcl-2 Western Blot Analysis.
LNCaP cells were cultured in 5% FBS until 70–80% confluence, and media was changed to RPMI + 1% charcoal-stripped FBS with 50, 100, or 500 nM antisense or control mismatch ODN plus 10 µl of lipofectin (Life Technologies, Inc.) for 6 h, or androgen (10 nM R1881) for 24 h. Additional 6-h incubations were performed every 24 h for 4 days. Controls were treated with equivalent concentrations of lipofectin or medium alone. After 5 days, cells were harvested directly into lysis buffer containing NP40 and 40 µg of protein from each transfection were separated on 12% acrylamide gel. After blotting onto an Immobilon membrane (Millipore, Bedford, MD), Bcl-2 protein or {beta}-tubulin were detected using monoclonal mouse anti-human Bcl-2 antibodies (DAKO, Mississauga, Ontario, Canada) or {beta}-tubulin antibody (Chemicon International Inc., Tumecula, CA).

Northern Blot Analysis.
Northern analysis was used to define changes in Bcl-2 expression in LNCaP tumors in vivo. Total cellular RNA for PSA and polyA for Bcl-2 were prepared from cultured LNCaP cells or LNCaP tumors using the 4 M guanidinium thiocyanate extraction method. Electrophoresis, blotting, hybridization, and densitometric analyses were carried out as reported previously (21 , 22) . The cDNA probe for PSA was a 1.4-kb EcoRI fragment of PSA cDNA (21) . The cDNA probe for Bcl-2 was generated using primers with the following sequence: sense 5'-AGATAGTGATGAAGTACATCCATTA-3' and antisense 5'-TCCGTTATCCTGGATCCAGGTGTGCA-3'. Density of bands for PSA and Bcl-2 were normalized against that of GAPDH (sense, TGCTTTTAACTCTGGTAAAGT; antisense, ATATTTGGCAGGTTTTTCTGAT).

Assessment of in Vivo Tumor Growth.
LNCaP cells (1 x 106) were inoculated s.c. with 0.1 ml of Matrigel (Becton Dickinson Labware, Bedford, MA) in the flank region of male athymic nude mice, 6–8 weeks of age, via a 27-gauge needle under methoxyfluorane anesthesia. Tumors were thereafter measured twice weekly and their volumes were calculated by the formula L x W x H x 0.5236 (22) . Mice bearing tumors between 100–200 mm3 in volume were castrated via a scrotal approach and randomly assigned to a treatment arm. Mice were treated beginning 1 or 7 days after castration with 12.5 mg/kg ODN i.p. twice daily in the first experiment and with 12.5 mg/kg ODN i.p. once daily for the second experiment. Tumor volume and serum PSA measurements were performed weekly. Data points for both sets of experiments were expressed as average tumor volumes ± SEs of the mean based on at least five determinations.

Determination of Serum PSA Levels.
Blood samples were obtained with tail vein incisions of mice before treatment and then once weekly after starting ODN treatment. Serum PSA levels were determined by an enzymatic immunoassay kit with a lower limit of sensitivity of 0.2 µg/liter (Abbott IMX, Montreal, Quebec, Canada), according to the manufacturer’s protocol. PSA velocity is defined as the rate of change of serum PSA over time, whereas PSA doubling time is defined as the number of doubings of serum PSA over the treatment period. Time to androgen-independent PSA regulation was defined as the duration of time required after castration for serum PSA levels to return to or increase above precastrate levels. Data points were expressed as average tumor volumes ± SEs of the mean based on at least five determinations.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Effects of Androgens on Basal Levels of Bcl-2 mRNA in LNCaP Cells in Vitro and in Vivo.
RT-PCR was used to determine changes in Bcl-2 mRNA levels in LNCaP cells after treatment with androgen (1, 10 nM R1881). Physiological concentrations of androgen down-regulated Bcl-2 gene expression to undetectable levels after 24 h (Fig. 1A)Citation After 1 week of 1 nM R1881, Bcl-2 protein levels in LNCaP cells were undetectable (data not shown). Androgen-induced down-regulation of Bcl-2 mRNA was reversible; within 48 h after androgen withdrawal and culture in charcoal-stripped serum in vitro, Bcl-2 mRNA levels returned back to baseline (data not shown).



View larger version (71K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Physiological levels of androgen down-regulate Bcl-2 mRNA after 24 h. Total RNA was isolated from LNCaP cells, and 4 µg were reverse transcribed as described in the text. Lane 1, 5% FBS control; Lane 2, 1% charcoal-stripped control; Lane 3, +10 nM R1881; Lane 4, positive control (Shionogi cells); Lane 5, water (negative) control.

 
Changes in Bcl-2 expression in LNCaP tumors grown in vivo paralleled the in vitro observations. Bcl-2 expression was low in LNCaP tumors grown in intact male mice (i.e., androgen-dependent tumors), but increases 3–4-fold beginning 1 week after castration and remains elevated in androgen-independent tumors (Fig. 2)Citation . LNCaP tumors stained variably positive for Bcl-2 protein, but staining was too weak and heterogenous to permit quantitative comparison between intact and castrate LNCaP tumors (data not shown). PSA gene expression decreases by 80% by 1 week after castration, but increases again in androgen-independent tumors (4 , 22) .



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Northern analysis of changes in PSA and Bcl-2 mRNA levels after castration in the LNCaP tumor model. After castration, tumor-cell PSA mRNA levels decrease up to 80%, but increase again above precastrate levels beginning 3–4 weeks after castration. Bcl-2 mRNA levels in LNCaP tumors increase 350% within 7 days after castration. Markers of androgen-independent progression include nonandrogen-regulated PSA and Bcl-2 expression. Lane 1, LNCaP tumors before castration; Lane 2, LNCaP tumors 4 days after castration; Lane 3, LNCaP tumors 7 days after castration; Lane 4, LNCaP tumors 30 days after castration.

 
Rapid and Reversible Suppression of Bcl-2 mRNA Levels in LNCaP Cells in Vitro by Antisense Bcl-2 ODN.
RT-PCR was used to measure changes in Bcl-2 mRNA levels in LNCaP cells after treatment with antisense, mismatch, or reverse polarity ODN. ODN treatment in vitro was evaluated with or without lipofectin (10 µl). Potency of antisense Bcl-2 ODN is increased 100-fold with lipofectin treatment, which permits increased uptake of the ODN into the cell (26) . Without lipofectin treatment, Bcl-2 mRNA suppression was induced by antisense ODN at doses of 5 µg and higher (Fig. 3)Citation ; with lipofectin treatment, doses of 50 nM and higher suppressed bcl-2 mRNA to undetectable levels. Antisense, but not mismatch or reverse polarity, Bcl-2 ODN decreased Bcl-2 expression in LNCaP cells to undetectable levels within 24 h, demonstrating sequence-specific suppression of bcl-2 mRNA by antisense ODN (Fig. 4A)Citation . The suppression was reversible with Bcl-2 expression, returning to baseline within 48 h of a single 24-h exposure (Fig. 4B)Citation .



View larger version (100K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Antisense Bcl-2 ODN treatment of LNCaP cells in vitro results in dose-dependent decreases in Bcl-2 mRNA levels. RT-PCR was used to measure changes in Bcl-2 mRNA levels in LNCaP cells after treatment with antisense ODN with or without lipofectin (10 µl). LNCaP cells were treated with various concentrations of antisense Bcl-2 ODN +/- 10 µl of lipofectin for 6 h, and RNA was isolated 24 h later. Control cells were incubated in medium plus 10 µl of lipofectin alone (Lanes 1 and 2). Potency of antisense Bcl-2 ODN is increased 100-fold with lipofectin treatment. Without lipofectin treatment, Bcl-2 mRNA suppression was induced by antisense ODN at doses of 5 µg and higher (Lanes 3–6); with lipofectin treatment, doses of 100 nM and higher suppressed Bcl-2 mRNA to undetectable levels (Lanes 7–10).

 


View larger version (65K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Sequence-specific decreases in Bcl-2 mRNA levels by antisense, but not mismatch, Bcl-2 ODN treatment. RT-PCR was used to measure changes in Bcl-2 mRNA levels in LNCaP cells treated with various concentrations of antisense or mismatch Bcl-2 ODN. Cells were treated with ODN plus 10 µl of lipofectin for 6 h, and RNA was isolated 24 h later. A: Antisense, but not a two-base mismatch, Bcl-2 ODN decreased Bcl-2 expression in LNCaP cells to undetectable levels within 24 h at concentrations of 50 nM or higher. B, suppression of Bcl-2 mRNA levels was reversible, with Bcl-2 mRNA levels returning to baseline 48 h after a single 24-h treatment.

 
Suppression of Bcl-2 Protein Levels by Antisense Bcl-2 ODN in LNCaP Cells in Vitro.
Western blotting was used to measure changes in Bcl-2 mRNA levels in LNCaP cells after dose-dependent treatment with 50, 100, or 500 nM antisense or mismatch ODN. Antisense, but not mismatch-control, Bcl-2 ODN decreased bcl-2 protein levels in LNCaP cells after 5 days of treatment at concentrations of 100 nM or higher (Fig. 5)Citation .



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Bcl-2 protein levels in LNCaP cells suppressed by antisense Bcl-2 ODN in vitro. Western blotting was used to measure changes in Bcl-2 mRNA levels in LNCaP cells after treatment with antisense or mismatch ODN. LNCaP cells were cultured in RPMI + 1% charcoal-stripped FBS with 50, 100, or 500 nM of antisense or mismatch ODN plus 10 µl of lipofectin for 6 h and changed to RPMI + 1% charcoal-stripped FBS for 18 h. Additional 6-h incubations were performed every 24 h for 5 days.

 
Effects of Bcl-2 ODN on LNCaP Cell Apoptosis and Growth Rates in Vitro.
To determine whether reduced expression of LNCaP cell Bcl-2 mRNA levels was accompanied by increased apoptosis, LNCaP cell DNA was extracted after 5 days of ODN treatment and analyzed for characteristic endonuclease-mediated DNA fragmentation. Although cell morphology changed with rounding and detachment of some cells after antisense Bcl-2 ODN treatment, sequence-specific decreases in LNCaP cell growth rate were not detected using mitogenic assays, and induction of apoptosis was not detected using DNA fragmentation or flow cytometric analysis (data not shown).

Effects of Bcl-2 ODN on LNCaP Tumor Growth Rates in Vivo.
In the first set of in vivo experiments, a two-base mismatch Bcl-2 ODN was compared with two groups receiving antisense Bcl-2 ODN, one beginning 1 day and the other 7 days after castration. Changes in LNCaP tumor growth and serum PSA are compared in Fig. 6Citation . LNCaP tumor growth rates were 5-fold higher in mismatch ODN controls compared with antisense Bcl-2 ODN-treated mice. Tumor volume in mismatch controls increased 2.5-fold (range, 1.5–3.2) by 6 weeks after castration and 5-fold (range, 3–6.2) by 12 weeks after castration. In contrast, tumor volume in both antisense Bcl-2 ODN groups gradually decreased during the first 2–3 weeks after castration of treatment, with stabilization thereafter. By 6 weeks after castration, mean tumor volume in group 1 was 53% of baseline (range, 42–59%) and 61% in group 2 (range, 48–75%). By 12 weeks after castration, tumor volume remained below precastrate baseline tumor volumes in both groups (75% of baseline in group 1 and 95% in group 2). Changes in serum PSA levels paralleled changes in tumor volume. Mean pretreatment PSA levels were 156 µg/liter, 143 µg/liter, and 153 µg/liter for the mismatch ODN and the two groups receiving antisense ODN, respectively. After castration, serum PSA decreased by 60–70% in all three groups to nadir levels by 1 week after castration. In the mismatch ODN group, serum PSA increased beginning 2 weeks after castration to a mean of 400 µg/liter by 12 weeks after castration. In contrast, serum PSA levels stabilized or regressed compared with controls over the treatment period in mice treated with adjuvant antisense Bcl-2 ODN. By 12 weeks after castration, mean serum PSA levels were 75% lower (group 1, 92 µg/liter; group 2, 115 µg/liter) than control (400 µg/liter) levels. By 12 weeks after castration mean serum PSA increased 2.5-fold above precastrate levels in controls compared with remaining 30% lower than precastrate levels in the two antisense ODN groups. No significant toxicity (i.e., changes in weight, activity, death) was observed in any treatment group.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. LNCaP tumor-bearing mice were castrated and treated with twice daily intraperitoneal injections of either a two-base mismatch or antisense ODN. Antisense Bcl-2 ODN therapy was initiated 24 h after castration in group 1 and 1 week after castration in group 2 (n = 6 in each group). A, mean tumor volume increased 5-fold (range, 3–6.2) in mismatch-treated controls by 12 weeks after castration compared with stabilization or up to 25% decrease in antisense-treated groups. B, by 12 weeks after castration, mean serum PSA was 75% lower in antisense-treated groups than mismatch-treated group.

 
To confirm the results observed in the first set of in vivo experiments, a second set of in vivo experiments compared two control groups (mismatch and reverse polarity Bcl-2 ODN; n = 6 in each group) to antisense Bcl-2 ODN (n = 12). ODN treatment was initiated 1 day after castration. Changes in LNCaP tumor growth and serum PSA are compared in Fig. 7, A and BCitation , respectively. As in the first set of experiments, LNCaP tumor growth rates were five times faster in mice treated with control ODN groups compared with antisense Bcl-2 ODN-treated mice (P < 0.01). LNCaP tumor volume in the mismatch and reverse polarity ODN groups increased 2.2- and 3-fold by 9 weeks after castration and by >7-fold by 14 weeks after castration. In contrast, tumor volume in the antisense Bcl-2 ODN group decreased by 40% by 9 weeks after castration and stabilized thereafter. Mean pretreatment PSA levels were 88 µg/liter, 82 µg/liter, and 80 µg/liter for the mismatch, reverse polarity, and antisense ODN groups, respectively. After castration, serum PSA decreased 70–80% in all three groups to nadir levels by 1–2 weeks after castration. In the reverse polarity and mismatch ODN groups, serum PSA began increasing again by 4–5 weeks after castration to a mean of 180 and 136 µg/liter by 14 weeks after castration. At 14 weeks after castration, mean serum PSA level (16 µg/liter) in the antisense-treated group was significantly lower than in both control groups. No significant toxicity was observed in any treatment group.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. LNCaP tumor-bearing mice were castrated and treated with once daily intraperitoneal injections of a two-base mismatch control ODN (n = 6), a reverse polarity control ODN (n = 6), or antisense Bcl-2 ODN (n = 12). All mice were treated once daily beginning 1 day after castration for the duration of the experiment. By 14 weeks after castration, mean tumor volume (A) and serum PSA levels (B) were 90% greater in controls compared with the antisense Bcl-2 ODN group (P < 0.01).

 
We then examined the effects of in vivo ODN treatment on Bcl-2 mRNA expression in LNCaP tumors by Northern blotting. In this experiment, beginning 1 day after castration, five tumor-bearing mice were administered either 12.5 mg/kg antisense Bcl-2 or mismatch control ODN i.p. once daily, and tumor tissues were harvested for RNA extraction 4 days after castration. Antisense Bcl-2 ODN resulted in a 62% reduction in Bcl-2 mRNA levels in LNCaP tumors compared with mismatch control ODN-treated tumors (Fig. 8)Citation .



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. Effects of antisense Bcl-2 ODN administration on Bcl-2 mRNA levels in LNCaP tumors by day 4 after castration. One day after castration, LNCaP tumor-bearing mice were treated daily with antisense Bcl-2 (n = 3) or mismatch control (n = 2) ODN at a dose of 12.5 mg/kg, poly A+ RNA was extracted 4 days after castration, and Bcl-2 and GAPDH mRNA levels were analyzed by Northern blotting. Lanes 1 and 2, LNCaP tumors in mice administered mismatch Bcl-2 control ODN; Lanes 3, 4 and 5, LNCaP tumors in mice administered antisense Bcl-2 ODN. Mean Bcl-2 mRNA levels were 62% lower after antisense ODN treatment.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although prostate cancer is resistant to conventional chemotherapeutic agents, androgen ablation results in tumor regression and symptomatic relief through apoptotic cell death (1 , 2) . The benefits of androgen withdrawal therapy, however, are usually temporary because surviving tumor cells generally progress to an androgen-independent state (1, 2, 3) . Average survival from initiation of androgen ablation in patients with metastatic disease is <30 months (1) . Progression to hormone-resistant disease, therefore, represents a major obstacle to effective control and cure of disseminated disease. Before we can have a significant impact on survival with the development of new therapeutic strategies, an improved understanding of the molecular pathogenesis of AI progression is needed.

Controlled investigation of the molecular mechanisms mediating androgen-independent progression has proved difficult because of a paucity of animal models that mimick the course of the clinical disease. Of the available human prostate cancer cell lines, only the LNCaP cell line is androgen responsive, PSA secreting, and immortalized in vitro (27) . Like in human prostate cancer, serum PSA levels in the LNCaP tumor model are initially regulated by androgen, are directly proportional to tumor volume, and increase after prolonged periods of growth after castration to signal progression to androgen independence (4 , 22) . Apoptotic tumor regression does not consistently occur after castration, but tumor growth is inhibited and serum and tumor-cell PSA levels decrease by 80% for several weeks after castration, after which LNCaP tumor growth rates increase and PSA expression rises above precastrate levels. Nonandrogen-regulated PSA gene expression in LNCaP tumors after castration is one example of how other transacting factors can replace androgens and alter gene regulation during progression to androgen independence (28) . Characterization of androgen-repressed genes that are up-regulated after androgen withdrawal and play a causative role in progression to androgen indepen-dence is a critical step in developing targeted therapies that may prevent hormone-refractory prostate cancer.

Bcl-2 is one gene that has emerged as a putative mediator of resistance to chemotherapy and hormonal therapies and serves as a logical therapeutic target to delay progression after castration in prostate cancer. The Bcl-2 gene was originally identified at the chromosomal breakpoint of the translocation of a portion of chromosome 18 to 14 in B-cell lymphomas (7) . Bcl-2 is a critical regulator of apoptosis in a variety of cell systems and is now known to belong to a growing family of apoptosis regulatory gene products, which may either be death antagonists (Bcl-2, Bcl-Xl, Bcl-W, Bfl-1, Brag-1, and Mcl-1) or death agonists (Bax, Bak, Bcl-XS, Bad, Bid, Bik, and Hrk; Refs. (7, 8, 9, 10 ). The ratio of death antagonists to death agonists determines how a cell will respond to an apoptotic signal. In the prostate gland, Bcl-2 is expressed in the less differentiated basal cell layer of prostatic acini, but not in benign differentiated luminal cells or androgen-dependent prostate cancer cells (13, 14, 15, 16) . In prostate cancer cells, Bcl-2 is up-regulated during progression to androgen independence and may play an active role in resistance to apoptosis (17) . In view of the high prevalence of Bcl-2 in androgen-independent prostate cancers and its antiapoptosis function, we hypothesize that Bcl-2 plays a protective role in preventing castration-induced apoptosis initiated by androgen withdrawal, thereby accelerating progression to androgen independence. Hence, preventing Bcl-2 up-regulation after androgen withdrawal may enhance castration-induced apoptosis and delay progression to androgen independence.

Antisense ODNs offer one strategy to specifically target Bcl-2 gene expression. Phosphorothioate ODNs are water-soluble, stable agents manufactured to resist nuclease digestion. After parenteral administration, phosphorothioate ODNs become associated with high-capacity, low-affinity serum-binding proteins (19) . Recent studies have shown that antisense Bcl-2 ODNs induce apoptosis in Bcl-2-positive small-cell lung cancer cell lines in vitro (29) and increase chemosensitivity of melanoma cells in vitro and in vivo (30) . Hammerhead anti-Bcl-2 ribozyme treatment of LNCaP cells reduces Bcl-2 levels and induces apoptosis in low-Bcl-2-expressing LNCaP variants in vitro, but in vivo activity has not yet been reported (31) . A Phase I dose-escalation trial using antisense Bcl-2 ODNs in nine patients with lymphoma reported objective and subjective responses with no significant toxicity (32) . Taken together, the preclinical and early clinical data support the hypothesis that targeting Bcl-2 gene expression using antisense ODNs may be a valid therapeutic strategy. Indeed, in the androgen-dependent mouse Shionogi tumor model, which undergoes complete apoptotic regression with increased Bcl-2 gene expression after castration, followed by recurrence of androgen-refractory tumors, we have recently reported that adjuvant treatment with mouse antisense Bcl-2 ODN enhances castration-induced apo-ptosis and delays time to recurrence (33) .

Previous studies have focused on treatment strategies combining antisense Bcl-2 ODNs with chemotherapeutic agents (30) . The objectives of our studies were to evaluate the effects of androgen on Bcl-2 expression in androgen-sensitive LNCaP cells and whether the combination of antisense Bcl-2 ODN and androgen withdrawal therapy could delay progression to androgen independence. Increased levels of bcl-2 expression during progression from early untreated to hormone-refractory tumors may result from either clonal selection of Bcl-2-expressing clones or adaptative up-regulation of Bcl-2 gene expression in response to androgen depletion. Our data in LNCaP cells suggest that Bcl-2 is an androgen-repressed gene that is up-regulated after withdrawal of androgens both in vitro and in vivo. Physiological levels of androgens almost completely down-regulate Bcl-2 gene expression within 24 h. The reversible, androgen-repressed Bcl-2 expression demonstrated in this study, in addition to the sequence-specific in vitro and in vivo effects of antisense Bcl-2 ODNs in LNCaP cells, further supports the hypothesis that Bcl-2 up-regulation after androgen ablation helps mediate progression to androgen independence, presumably by inhibiting castration-induced apoptosis.

The sequence specificity of Bcl-2 mRNA suppression observed in our in vitro and in vivo studies supports an antisense mechanism of action for the antisense ODN, although additional therapeutically beneficial, sequence-independent, nonantisense interactions can not be ruled out (34 , 35) . For example, nonspecific phosphorothioate immunostimulation can occur via natural killer cell activation (36) . Phosphorothioates have also been shown to competitively inhibit a variety of nucleases and polymerases (37 , 38) and interact with heparin-binding growth factors (39) . However, nonspecific in vivo activity was not observed in our studies using two similar phosphorothioate control ODNs. Despite distinct sequence-specific Bcl-2 suppression and significant in vivo activity, a cytotoxic effect of antisense Bcl-2 ODNs could not be demonstrated in vitro. Other investigators have reported induction of apoptosis after treatment with antisense bcl-2 ODN (29 , 30) or ribozymes (31) . This disparity may result from varying sensitivity to specific apoptotic stimuli depending on growth conditions. Tumor cell sensitivity to antisense ODNs vary from tissue type and cell subline (28, 29, 30) . The relative balance between death antagonists and death agonists after androgen withdrawal may differ under in vitro and in vivo conditions. Second, androgen-regulated gene expression and growth sensitivity is significantly altered in androgen-dependent tissues when transferred to in vitro monolayer culture (40 , 41) . Finally, DNA fragmentation may not be a reliable marker of apoptosis in epithelial cells (42) , although lack of measurable apoptosis was also observed using flow cytometry.

In summary, the data reported herein provides additional evidence that Bcl-2 helps mediate progression to androgen independence. Antisense Bcl-2 ODNs decrease Bcl-2 mRNA and protein levels in LNCaP cells in vitro and inhibit tumor growth and serum PSA increases in vivo after castration in a sequence-specific manner. These data provide the first direct evidence that targeting a putative molecular mediator of androgen-independent progression using antisense ODN can delay progression.


    ACKNOWLEDGMENTS
 
We thank Virginia Yago and Dr. Marianne Sadar for excellent technical assistance and Drs. Marcel Bally and Richard Klasa for constructive advice and collaboration.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Grant 009002 from the National Cancer Institute of Canada. Back

2 To whom requests for reprints should be addressed, at D-9, 2733 Heather Street, Vancouver Hospital and Health Sciences Centre, Vancouver, British Columbia V5Z 3J5, Canada. Phone: (604) 875-5003; Fax: (604) 875-5604. Back

3 The abbreviations used are: PSA, prostate-specific antigen; ODN, oligodeoxynucleotide; FBS, fetal bovine serum; RT-PCR, reverse transcription-PCR. Back

Received 2/22/99; revised 7/19/99; accepted 7/30/99.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Denis L., Murphy G. P. Overview of phase III trials on combined androgen treatment in patients with metastatic prostate cancer. Cancer (Phila.), 72 (Suppl): 3888-3895, 1993.[Medline]
  2. Yagoda A., Petrylak D. Cytotoxic chemotherapy for advanced hormone-resistant prostate cancer. Cancer (Phila.), 71 (Suppl. 3): 1098-1109, 1993.[Medline]
  3. Isaacs J. Growth regulation of normal and malignant prostatic cells. First International Consultation on Prostate Cancer Murphy Griffiths Denis Khoury Chatelain Cockett eds. . Scientific Communication International Ltd., : 1996.
  4. Gleave M., Hsieh J. T., Wu H. C., von Eschenbach A. C., Chung L. W. Serum prostate-specific antigen levels in mice bearing human prostate LNCaP tumors are determined by tumor volume and endocrine and growth factors. Cancer Res., 52: 1598-1605, 1992.[Abstract/Free Full Text]
  5. Hsieh J., Wu H., Gleave M., von Eschenbach A., Chung L. Autocrine regulation of prostate-specific antigen gene expression in human prostate cells. Cancer Res., 53: 2852-2859, 1993.[Abstract/Free Full Text]
  6. Rennie P., Bruchovsky N., Buttyan R., Benson M., Cheng H. Gene expression during the early phases of regression of the androgen-dependent Shionogi mouse mammary carcinoma. Cancer Res., 48: 6309 1988.[Abstract/Free Full Text]
  7. Reed J. C. bcl-2 and the regulation of programmed cell death. J. Cell Biol., 124: 1-6, 1994.[Free Full Text]
  8. Yang E., Korsemeyer S. J. Molecular thanatopsis: a discourse on the bcl-2 family and cell death. Blood, 88: 386-401, 1996.[Free Full Text]
  9. Hockenbery D., Nunez G., Milliman C., Schreiber R. D., Korsmeyer S. J. bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature (Lond.), 348: 334-336, 1990.[Medline]
  10. Nunez G., London L., Hockenbery D., Alexander M., McKearn J. P., Korsmeyer S. J. Deregulated bcl-2 gene expression selectively prolongs survival of growth factor-deprived hemopoietic cell lines. J. Immunol., 144: 3602-3610, 1990.[Abstract]
  11. Tsujimoto Y. Stress-resistance conferred by a high level of bcl-2 {alpha} protein in human B lymphoblastoid cell. Oncogene, 4: 1331-1336, 1989.[Medline]
  12. Miyashita T., Reed J. C. bcl-2 oncoprotein blocks chemotherapy-induced apoptosis in a human leukemia cell line. Blood, 81: 151-157, 1993.[Abstract/Free Full Text]
  13. Kyprianou N., King E. D., Bradbury D., Rhee J. G. bcl-2 overexpression delays radiation-induced apoptosis without affecting the clonogenic survival of human prostate cancer cells. Int. J. Cancer, 70: 341-348, 1997.[Medline]
  14. Moul J. W., Bettencourt M. C., Sesterhenn I. A., Mostofi F. K., McLeod D. G., Srivastava S., Bauer J. J. Protein expression of p53, bcl-2, and KI-67 (MIB-1) as prognostic biomarkers in patients with surgically treated, clinically localized prostate cancer. Surgery, 120: 159-166, 1996.[Medline]
  15. Bubendorf L., Sauter G., Moch H., Jordan P., Blochlinger A., Gasser T. C., Mihatsch M. J. Prognostic significance of bcl-2 in clinically localized prostate cancer. Am. J. Pathol., 148: 1557-1565, 1996.[Abstract]
  16. Matsushima H., Hosaka Y., Suzuki M., Mizutani T., Ishizuka H., Kawabe K. bcl-2 expression on prostate cancer and its relationship to cell cycle and prognosis. Int. J. Urol., 3: 113-117, 1996.[Medline]
  17. McDonnell T. J., Navone N. M., Troncoso P., Pisters L. L., Conti C., von Eschenbach A. C., Brisbay S., Logothetis C. J. Expression of bcl-2 oncoprotein and p53 protein accumulation in bone marrow metastases of androgen-independent prostate cancer. J. Urol., 157: 569-574, 1997.[Medline]
  18. Raffo A. J., Perlman H., Chen M. W., Day M. L., Streitman J. S., Buttyan R. Overexpression of bcl-2 protects prostate cancer cells from apoptosis in vitro and confers resistance to androgen depletion in vivo. Cancer Res., 55: 4438-4445, 1995.[Abstract/Free Full Text]
  19. Saijo Y., Perlaky L., Wang H., Busch H. Pharmacokinetics, tissue distribution, and stability of antisense oligonucleotide phosphorothioate ISIS 3466 in mice. Oncol. Res., 6: 243-249, 1994.[Medline]
  20. Crooke S. T., Lemonidis K. L., Neilson L., Griffey R., Lesnik E. A., Monia B. P. . Biochem. J., 312: 599-608, 1995.
  21. Gleave M. E., Hsieh J. T., Gao C., von Eschenbach A. C., Chung L. W. K. Acceleration of human prostate carcinoma growth in vivo by factors produced by prostate and bone fibroblasts. Cancer Res., 51: 3753-3761, 1991.[Abstract/Free Full Text]
  22. Sato N., Gleave M. E., Bruchovsky N., Rennie P. S., Goldenberg S. L., Lange P. L., Sullivan L. D. Intermittent androgen suppression delays progression to androgen-independent regulation of prostate-specific antigen gene in the LNCaP prostate tumor model. J. Steroid Biochem. Mol. Biol., 58: 139-146, 1996.[Medline]
  23. Liu A., Grey E., Bladou F., Lange P., Vessella R. Prostatic cell lineage markers: emergence of bcl2 cells of human prostate cancer xenograft LuCaP 23 following castration. Int. J. Cancer, 65: 85-89, 1996.[Medline]
  24. Sellins K., Cohen J. Gene induction by {gamma} irradiation leads to DNA fragmentation in lymphocytes. J. Immunol., 39: 3199-3206, 1987.
  25. Gleave M. E., Sato N., Rennie P., Bruchovsky N. Prevention of LNCaP prostate tumor growth and progression by isobutyramide, and orally bioavailable butyrate analogue. J. Cell. Biochem., 69: 271-281, 1998.[Medline]
  26. Monia B. P., Johnston J. F., Geiger T., Muller M., Fabbro D. Antitumor activity of a phosphorothioate antisense oligodeoxynucleotide targeted against C-raf kinase. Nat. Med., 2: 668-675, 1996.[Medline]
  27. Horoszewicz J., Leong S., Chu T., Wajsman Z., Friedman M., Papsidero L., Kim U., Chai L. S., Kakati S., Arya S. K., Sandberg A. A. The LNCaP cell line—a new model for studies on human prostatic carcinoma. Prog. Clin. Biol. Res., 37: 115-132, 1980.[Medline]
  28. Sato N., Satar M., Bruchovsky N., Rennie P., Saatcioglu F., Sato S., Lange P., Gleave M. Androgenic induction of prostate-specific gene is repressed by protein-protein interaction between the androgen receptor and AP-1/c-jun in the human prostate cancer cell line LNCaP. J. Biol. Chem., 272: 17485-17494, 1997.[Abstract/Free Full Text]
  29. Ziegler A., Luedke G. H., Fabbro D., Altmann K-H., Stahel R. A., Zangemeister-Wittke U. Induction of apoptosis in small-cell lung cancer cells by an antisense oligodeoxynucleotide targeting the Bcl-2 coding sequence. J. Natl. Cancer Inst., 89: 1027-1035, 1997.[Abstract/Free Full Text]
  30. Jansen B., Schlagbauer-Wadl H., Brown B. D., Bryan R. N., van Elsas A., Muller M., Wolff K., Eichler H-G., Pehamberger H. bcl-2 antisense therapy chemosensitizes human melanoma in SCID mice. Nat. Med., 4: 232-234, 1998.[Medline]
  31. Dorai T., Olsson C. A., Katz A. E., Buttyan R. Development of a hammerhead ribozyme against bcl-2. Preliminary evaluation of a potential gene therapeutic agent for hormone-refractory human prostate cancer. Prostate, 32: 246-258, 1997.[Medline]
  32. Webb A., Cunningham D., Cotter F., Clarke P. A., di Stefano F., Ross P., Corbo M., Dziewanowska Z. bcl-2 antisense therapy in patients’ with non-Hodgkin’s lymphoma. Lancet, 349: 1137-1141, 1997.[Medline]
  33. Miyake H., Tolcher A., Gleave M. E. Antisense Bcl-2 oligodeoxynucleotides inhibit progression to androgen independence after castration in the shionogi tumor model. Cancer Res., 59: 4030-4034, 1999.[Abstract/Free Full Text]
  34. Stein C. A., Cheng Y-C. Antisense oligonucleotides as therapeutic agents: is the bullet really magical?. Science (Washington, DC), 261: 1004-1012, 1993.[Abstract/Free Full Text]
  35. Stein C. A. Does antisense exist?. Nat. Med., 1: 1119-1121, 1995.[Medline]
  36. Wooldridge J. E., Ballas Z., Krieg A. M., Weiner G. J. Immunostimulatory oligonucleotides containing CpG motifs enhance the efficacy of monoclonal therapy of lymphoma. Blood, 89: 2994-2998, 1997.[Abstract/Free Full Text]
  37. Crooke S. T., Lemonidis K. L., Neilson L., Griffey R., Lesnik E. A., Monia B. P. Kinetic characteristics of Escherichia coliRNase HI: cleavage of various antisense oligonucleotide-RNA duplexes. Biochem. J., 312: 599-608, 1995.
  38. Gao W. Y., Han F-S., Storm C., Egan W., Cheng Y. C. Phosphorothioate oligonucleotides are inhibitors of human DNA polymerase and RNase H: implications for antisense technology. Mol. Pharmacol., 41: 223-230, 1991.[Abstract]
  39. Guvakova M. A., Yakubov L. A., Vlodabsky I., Tonkinson J. L., Stein C. A. Phosphorothioate oligodeoxynucleotides bind to basic fibroblast growth factor, inhibit its binding to cell surface receptors, and remove it from low affinity binding sites on extracellular matrix. J. Biol. Chem., 270: 2620-2627, 1994.[Abstract/Free Full Text]
  40. Bruchovsky N., Rennie P. S., Coldman A. J., Goldenberg S. L., To M., Lawson D. Effects of androgen withdrawal on the stem cell composition of the Shionogi carcinoma. Cancer Res., 50: 2275-2282, 1990.[Abstract/Free Full Text]
  41. Hoehn W., Schroeder F., Riemann J., Joebsis A., Hermanek P. Human prostatic adenocarcinoma. Some characteristics of a serially transplantable line in nude mice (PC-82). Prostate, 1: 95 1980.[Medline]
  42. Oberhammer F., Wilson J. W., Dive C., Morris I. D., Hickman J. A., Wakeling A. E., Walker P. R., Sikorska M. Apoptotic death in epithelial cells; cleavage of DNA to 300 and/or 50-kb fragments prior to or in the absence of internucleosomal fragmentation. EMBO J., 12: 3679-3684, 1993.[Medline]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
S. Narita, A. So, S. Ettinger, N. Hayashi, M. Muramaki, L. Fazli, Y. Kim, and M. E. Gleave
GLI2 Knockdown Using an Antisense Oligonucleotide Induces Apoptosis and Chemosensitizes Cells to Paclitaxel in Androgen-Independent Prostate Cancer
Clin. Cancer Res., September 15, 2008; 14(18): 5769 - 5777.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. A. Locke, E. S. Guns, A. A. Lubik, H. H. Adomat, S. C. Hendy, C. A. Wood, S. L. Ettinger, M. E. Gleave, and C. C. Nelson
Androgen Levels Increase by Intratumoral De novo Steroidogenesis during Progression of Castration-Resistant Prostate Cancer
Cancer Res., August 1, 2008; 68(15): 6407 - 6415.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
K. Iguchi, M. Ito, S. Usui, A. Mizokami, M. Namiki, and K. Hirano
Downregulation of Thymosin {beta}4 Expression by Androgen in Prostate Cancer LNCaP Cells
J Androl, March 1, 2008; 29(2): 207 - 212.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. D. Mocanu, K. W. Yip, J. Skliarenko, W. Shi, P. Busson, K.-W. Lo, C. Bastianutto, and F.-F. Liu
Imaging and Modulating Antisense Microdistribution in Solid Human Xenograft Tumor Models
Clin. Cancer Res., October 1, 2007; 13(19): 5935 - 5941.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Zhang, J. Wang, B. Pang, R.-x. Liang, S. Li, P.-t. Huang, R. Wang, L. W.K. Chung, H. E. Zhau, C. Huang, et al.
PC-1/PrLZ Contributes to Malignant Progression in Prostate Cancer
Cancer Res., September 15, 2007; 67(18): 8906 - 8913.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. Y. Khor, J. Moughan, T. Al-Saleem, E. H. Hammond, V. Venkatesan, S. A. Rosenthal, M. A. Ritter, H. M. Sandler, G. E. Hanks, W. U. Shipley, et al.
Bcl-2 and Bax Expression Predict Prostate Cancer Outcome in Men Treated with Androgen Deprivation and Radiotherapy on Radiation Therapy Oncology Group Protocol 92-02
Clin. Cancer Res., June 15, 2007; 13(12): 3585 - 3590.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. Anai, S. Goodison, K. Shiverick, Y. Hirao, B. D. Brown, and C. J. Rosser
Knock-down of Bcl-2 by antisense oligodeoxynucleotides induces radiosensitization and inhibition of angiogenesis in human PC-3 prostate tumor xenografts
Mol. Cancer Ther., January 1, 2007; 6(1): 101 - 111.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. Kamada, A. So, M. Muramaki, P. Rocchi, E. Beraldi, and M. Gleave
Hsp27 knockdown using nucleotide-based therapies inhibit tumor growth and enhance chemotherapy in human bladder cancer cells
Mol. Cancer Ther., January 1, 2007; 6(1): 299 - 308.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. Inoue, T. Yoshida, Y. Shimizu, T. Kobayashi, T. Yamasaki, Y. Toda, T. Segawa, T. Kamoto, E. Nakamura, and O. Ogawa
Requirement of Androgen-Dependent Activation of Protein Kinase C{zeta} for Androgen-Dependent Cell Proliferation in LNCaP Cells and Its Roles in Transition to Androgen-Independent Cells
Mol. Endocrinol., December 1, 2006; 20(12): 3053 - 3069.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Cheng, R. Snoek, F. Ghaidi, M. E. Cox, and P. S. Rennie
Short Hairpin RNA Knockdown of the Androgen Receptor Attenuates Ligand-Independent Activation and Delays Tumor Progression
Cancer Res., November 1, 2006; 66(21): 10613 - 10620.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
F. Maluf, C Cordon-Cardo, D. Verbel, J. Satagopan, M. Boyle, H Herr, and D. Bajorin
Assessing interactions between mdm-2, p53, and bcl-2 as prognostic variables in muscle-invasive bladder cancer treated with neo-adjuvant chemotherapy followed by locoregional surgical treatment
Ann. Onc., November 1, 2006; 17(11): 1677 - 1686.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. Tang, M. A. Khan, O. Goloubeva, D. I. Lee, D. Jelovac, A. M. Brodie, and A. Hussain
Docetaxel Followed by Castration Improves Outcomes in LNCaP Prostate Cancer-Bearing Severe Combined Immunodeficient Mice
Clin. Cancer Res., January 1, 2006; 12(1): 169 - 174.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Rocchi, E. Beraldi, S. Ettinger, L. Fazli, R. L. Vessella, C. Nelson, and M. Gleave
Increased Hsp27 after Androgen Ablation Facilitates Androgen-Independent Progression in Prostate Cancer via Signal Transducers and Activators of Transcription 3-Mediated Suppression of Apoptosis
Cancer Res., December 1, 2005; 65(23): 11083 - 11093.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
K. Yamanaka, P. Rocchi, H. Miyake, L. Fazli, B. Vessella, U. Zangemeister-Wittke, and M. E. Gleave
A novel antisense oligonucleotide inhibiting several antiapoptotic Bcl-2 family members induces apoptosis and enhances chemosensitivity in androgen-independent human prostate cancer PC3 cells
Mol. Cancer Ther., November 1, 2005; 4(11): 1689 - 1698.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
K-M Rau, H-Y Kang, T-L Cha, S A Miller, and M-C Hung
The mechanisms and managements of hormone-therapy resistance in breast and prostate cancers
Endocr. Relat. Cancer, September 1, 2005; 12(3): 511 - 532.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. W. Tolcher, K. Chi, J. Kuhn, M. Gleave, A. Patnaik, C. Takimoto, G. Schwartz, I. Thompson, K. Berg, S. D'Aloisio, et al.
A Phase II, Pharmacokinetic, and Biological Correlative Study of Oblimersen Sodium and Docetaxel in Patients with Hormone-Refractory Prostate Cancer
Clin. Cancer Res., May 15, 2005; 11(10): 3854 - 3861.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Rocchi, A. So, S. Kojima, M. Signaevsky, E. Beraldi, L. Fazli, A. Hurtado-coll, K. Yamanaka, and M. Gleave
Heat Shock Protein 27 Increases after Androgen Ablation and Plays a Cytoprotective Role in Hormone-Refractory Prostate Cancer
Cancer Res., September 15, 2004; 64(18): 6595 - 6602.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. W. Tolcher, J. Kuhn, G. Schwartz, A. Patnaik, L. A. Hammond, I. Thompson, H. Fingert, D. Bushnell, S. Malik, J. Kreisberg, et al.
A Phase I Pharmacokinetic and Biological Correlative Study of Oblimersen Sodium (Genasense, G3139), an Antisense Oligonucleotide to the Bcl-2 mRNA, and of Docetaxel in Patients with Hormone-Refractory Prostate Cancer
Clin. Cancer Res., August 1, 2004; 10(15): 5048 - 5057.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. L. Ettinger, R. Sobel, T. G. Whitmore, M. Akbari, D. R. Bradley, M. E. Gleave, and C. C. Nelson
Dysregulation of Sterol Response Element-Binding Proteins and Downstream Effectors in Prostate Cancer during Progression to Androgen Independence
Cancer Res., March 15, 2004; 64(6): 2212 - 2221.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Kiyama, K. Morrison, T. Zellweger, M. Akbari, M. Cox, D. Yu, H. Miyake, and M. E. Gleave
Castration-Induced Increases in Insulin-Like Growth Factor-Binding Protein 2 Promotes Proliferation of Androgen-independent Human Prostate LNCaP Tumors
Cancer Res., July 1, 2003; 63(13): 3575 - 3584.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Zellweger, K. Chi, H. Miyake, H. Adomat, S. Kiyama, K. Skov, and M. E. Gleave
Enhanced Radiation Sensitivity in Prostate Cancer by Inhibition of the Cell Survival Protein Clusterin
Clin. Cancer Res., October 1, 2002; 8(10): 3276 - 3284.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
F. Ciardiello and G. Tortora
Inhibition of bcl-2 as cancer therapy
Ann. Onc., April 1, 2002; 13(4): 501 - 502.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. N. Chi, M. E. Gleave, R. Klasa, N. Murray, C. Bryce, D. E. Lopes de Menezes, S. D'Aloisio, and A. W. Tolcher
A Phase I Dose-finding Study of Combined Treatment with an Antisense Bcl-2 Oligonucleotide (Genasense) and Mitoxantrone in Patients with Metastatic Hormone-refractory Prostate Cancer
Clin. Cancer Res., December 1, 2001; 7(12): 3920 - 3927.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Huang, J. C. Cheville, Y. Pan, P. C. Roche, L. J. Schmidt, and D. J. Tindall
PTEN Induces Chemosensitivity in PTEN-mutated Prostate Cancer Cells by Suppression of Bcl-2 Expression
J. Biol. Chem., October 12, 2001; 276(42): 38830 - 38836.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
T. Zellweger, H. Miyake, S. Cooper, K. Chi, B. S. Conklin, B. P. Monia, and M. E. Gleave
Antitumor Activity of Antisense Clusterin Oligonucleotides Is Improved in Vitro and in Vivo by Incorporation of 2'-O-(2-Methoxy)Ethyl Chemistry
J. Pharmacol. Exp. Ther., September 1, 2001; 298(3): 934 - 940.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
G. Tortora, R. Caputo, V. Damiano, R. Bianco, G. Fontanini, S. Cuccato, S. De Placido, A. R. Bianco, and F. Ciardiello
Combined Blockade of Protein Kinase A and Bcl-2 by Antisense Strategy Induces Apoptosis and Inhibits Tumor Growth and Angiogenesis
Clin. Cancer Res., August 1, 2001; 7(8): 2537 - 2544.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. R. Smith, T. Xie, Z.-Z. Zhou, and I. Joshi
Efficacy of Treatment with Antisense Oligonucleotides Complementary to Immunoglobulin Sequences of bcl-2/Immunoglobulin Fusion Transcript in a t(14;18) Human Lymphoma-scid Mouse Model
Clin. Cancer Res., February 1, 2001; 7(2): 400 - 406.
[Abstract] [Full Text]


Home page
Genes Dev.Home page
C. Abate-Shen and M. M. Shen
Molecular genetics of prostate cancer
Genes & Dev., October 1, 2000; 14(19): 2410 - 2434.
[Full Text]


Home page
Clin. Cancer Res.Home page
H. Miyake, K. N. Chi, and M. E. Gleave
Antisense TRPM-2 Oligodeoxynucleotides Chemosensitize Human Androgen-independent PC-3 Prostate Cancer Cells Both in Vitro and in Vivo
Clin. Cancer Res., May 1, 2000; 6(5): 1655 - 1663.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
H. Miyake, C. Nelson, P. S. Rennie, and M. E. Gleave
Testosterone-repressed Prostate Message-2 Is an Antiapoptotic Gene Involved in Progression to Androgen Independence in Prostate Cancer
Cancer Res., January 1, 2000; 60(1): 170 - 176.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gleave, M.
Right arrow Articles by Goldie, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gleave, M.
Right arrow Articles by Goldie, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online