
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Preclinical Pharmacology |
Division of Urology, Vancouver General Hospital [M. G., H. M., C. N.], and Departments of Cancer Endocrinology [M. G., H. M., C. N., E. B.] and Medical Oncology [A. T., J. G.], British Columbia Cancer Agency, Vancouver, British Columbia; Genta Inc., Lexington, Massachusetts [B. B.]
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Progression to androgen independence is a multifactorial process by which cells acquire the ability to both survive in the absence of androgens and proliferate using nonandrogenic stimuli for mitogenesis (3) . At the molecular level, some genes initially dependent on androgens for expression, such as PSA, become constitutively expressed (4 , 5) , whereas many other genes become aberrantly expressed and actively participate, or passively accompany, the progression to androgen independence (3 , 6) . Recent evidence suggests that a critical step in progression to androgen-independent prostate carcinoma may involve overexpression of Bcl-2, which blocks apoptosis induced by androgen withdrawal. The Bcl-2 proto-oncogene belongs to a family of related genes, the proteins of which regulate a final common pathway regulating programmed cell death in both normal and abnormal cell populations (7 , 8) . Bcl-2-transfected cell lines exhibit prolonged survival in growth factor-deprived medium and greater resistance to heat shock stress, various chemotherapeutic agents, and irradiation (9, 10, 11, 12, 13) . Intrinsic expression of Bcl-2 by prostate carcinoma tissue may result in resistance to the effects of hormone manipulation because higher proportion of nonresponders or early relapsers to hormonal therapy occurred in patients strongly expressing Bcl-2 (14, 15, 16) . Virtually all hormone-refractory prostate carcinomas express Bcl-2, which supports the hypothesis that Bcl-2 expression confers resistance to androgen withdrawal by cells blocking the usual apoptotic signal from androgen manipulation (17) . Indeed, stable Bcl-2 transfection of LNCaP cells increased in vitro resistance to serum starvation, increased in vivo tumorigenicity, and accelerated tumor growth in male mice after castration (18) .
Accumulating evidence suggests that Bcl-2 overexpression protects prostate cancer cells from apoptosis after androgen withdrawal and, therefore, represents a suitable molecular target with antisense technology. Antisense ODNs are modified stretches of single-stranded DNA that are complementary to mRNA regions of a target gene and thereby block translation and protein synthesis. Phosphorothioate ODNs are stabilized to resist nuclease digestion by substituting one of the nonbridging phosphoryl oxygens of DNA with a sulfur (19 , 20) . The objectives of this study were to define in vitro and in vivo effects of androgens and androgen withdrawal on Bcl-2 gene expression in the LNCaP tumor model, to determine the effects of antisense-Bcl-2 ODN on Bcl-2 mRNA levels in LNCaP cells in vitro, and to evaluate the ability of antisense-BCL-2 ODN to delay time to androgen-independent progression of LNCaP tumors after castration.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Bcl-2 ODNs.
The following Bcl-2 ODNs were kindly provided by Genta Inc. (San Diego, CA): antisense Bcl-2 ODN (sequence, 5'-TCTCCCAGCGTGCGCCAT), a two-base mismatch control ODN (5'-TCTCCCAGCATGTGCCAT), and a reverse control ODN (sequence, 5'-TACCGCGTGCGACCCTCT). All ODNs are 18-mer phosphorothioates targeting the translation initiation site. ODNs were stored at -20°C at concentration in 10 mM Tris and 1 mM EDTA.
Evaluation of Androgen and ODN Effects on Bcl-2 mRNA Levels in Vitro.
LNCaP cells (5 x 106) were plated in 30-mm dishes (Falcon) in RPMI + 5% FBS. When LNCaP cell cultures reached 7080% confluence, the cell medium was changed to RPMI + 1% charcoal-stripped FBS and treated with various concentrations of antisense or control ODN +/- 10 µl of lipofectin (Life Technologies, Inc., Gaithersburg, MD) for 6 h, or androgen (10 nM R1881) for 24 h. Controls were treated with equivalent concentrations of lipofectin (Life Technologies Inc.) or medium alone. One day later, total RNA was isolated from LNCaP cells using the 4 M guanidinium thiocyanate extraction method, as described in previous studies (22)
, and 4 µg were reverse transcribed by Moloney murine leukemia virus reverse transcriptase. For the PCR reaction, 5 µl of the synthesized cDNA were added to 45 µl of a reaction solution containing 1x PCR buffer (20 mM Tris-HCL and 50 mM KCl), 2 mM MgCl2, 160 µM dNTPs, 1 µM each of the primers bcl2, 2.5 units of Taq polymerase, and 70 nM Taq start antibody (23)
. The upstream sequence primer beginning at nucleotide 1814 in the human Bcl-2 complementary DNA sequence is 5'-TGCACCTGACGCCTTCAC-3', and the downstream primer at nucleotide 2377 is 5'-TAGCTGATTCGACGTTTTGCCTGA-3'. The gene bank accession number for Bcl-2 is M 13994. After 40 cycles of amplification, the PCR products were analyzed by ethidium bromide-stained agarose gel electrophoresis. GADPH primers were used in parallel reactions to verify the integrity of the RNA. Experiments were repeated three times, and representative examples are shown.
Evaluation of ODN Effects on LNCaP Cell Apoptosis in Vitro.
When LNCaP cell cultures reached 7080% confluence, cell medium was changed to serum-free RPMI with 100 nM antisense or control mismatch ODN with 10 µl of lipofectin (Life Technologies, Inc.). After 6 h, cell medium was changed to RPMI + 1% charcoal-stripped serum for 18 h. Additional 6-h incubations were performed every 24 h for 5 days. Controls were treated with equivalent concentrations of lipofectin (Life Technologies, Inc.) or medium alone. After 5 days, cells were harvested and assayed for DNA fragmentation and flow cytometry. DNA fragmentation was used to detect apoptosis induced by ODN treatment and was analyzed by agarose gel electrophoresis (24)
. Flow cytometric evaluation for apoptosis was performed as described previously (25)
.
In Vitro Mitogenic Assays.
Effects of antisense Bcl-2 ODN on LNCaP cell growth in vitro was assessed using a 96-well assay based on the uptake and elution of crystal violet dye by the cells in each well (21)
. Three thousand LNCaP cells were plated/well in 96-well plates (Falcon) in RPMI with 5% FBS, and the cell media was changed to various concentrations of antisense or mismatch ODN (500 nM, 1 µM, 5 µM, and 10 µM plus lipofectin) 24 h later. One week later, the cells were fixed in 1% glutararalydehyde (Sigma), stained with 0.5% crystal violet (Sigma), and eluted with 100 µl of Sorensens solution (9 mg of trisodium citrate in 305 ml of distilled H2O, 195 ml of 0.1 N HCl, and 500 ml of 90% ethanol). Absorbance of each well was measured by a Titertek Multiskan TCC/340 (Flow Laboratories, McLean, VA) at 560 nm.
Bcl-2 Western Blot Analysis.
LNCaP cells were cultured in 5% FBS until 7080% confluence, and media was changed to RPMI + 1% charcoal-stripped FBS with 50, 100, or 500 nM antisense or control mismatch ODN plus 10 µl of lipofectin (Life Technologies, Inc.) for 6 h, or androgen (10 nM R1881) for 24 h. Additional 6-h incubations were performed every 24 h for 4 days. Controls were treated with equivalent concentrations of lipofectin or medium alone. After 5 days, cells were harvested directly into lysis buffer containing NP40 and 40 µg of protein from each transfection were separated on 12% acrylamide gel. After blotting onto an Immobilon membrane (Millipore, Bedford, MD), Bcl-2 protein or
-tubulin were detected using monoclonal mouse anti-human Bcl-2 antibodies (DAKO, Mississauga, Ontario, Canada) or
-tubulin antibody (Chemicon International Inc., Tumecula, CA).
Northern Blot Analysis.
Northern analysis was used to define changes in Bcl-2 expression in LNCaP tumors in vivo. Total cellular RNA for PSA and polyA for Bcl-2 were prepared from cultured LNCaP cells or LNCaP tumors using the 4 M guanidinium thiocyanate extraction method. Electrophoresis, blotting, hybridization, and densitometric analyses were carried out as reported previously (21
, 22)
. The cDNA probe for PSA was a 1.4-kb EcoRI fragment of PSA cDNA (21)
. The cDNA probe for Bcl-2 was generated using primers with the following sequence: sense 5'-AGATAGTGATGAAGTACATCCATTA-3' and antisense 5'-TCCGTTATCCTGGATCCAGGTGTGCA-3'. Density of bands for PSA and Bcl-2 were normalized against that of GAPDH (sense, TGCTTTTAACTCTGGTAAAGT; antisense, ATATTTGGCAGGTTTTTCTGAT).
Assessment of in Vivo Tumor Growth.
LNCaP cells (1 x 106) were inoculated s.c. with 0.1 ml of Matrigel (Becton Dickinson Labware, Bedford, MA) in the flank region of male athymic nude mice, 68 weeks of age, via a 27-gauge needle under methoxyfluorane anesthesia. Tumors were thereafter measured twice weekly and their volumes were calculated by the formula L x W x H x 0.5236 (22)
. Mice bearing tumors between 100200 mm3 in volume were castrated via a scrotal approach and randomly assigned to a treatment arm. Mice were treated beginning 1 or 7 days after castration with 12.5 mg/kg ODN i.p. twice daily in the first experiment and with 12.5 mg/kg ODN i.p. once daily for the second experiment. Tumor volume and serum PSA measurements were performed weekly. Data points for both sets of experiments were expressed as average tumor volumes ± SEs of the mean based on at least five determinations.
Determination of Serum PSA Levels.
Blood samples were obtained with tail vein incisions of mice before treatment and then once weekly after starting ODN treatment. Serum PSA levels were determined by an enzymatic immunoassay kit with a lower limit of sensitivity of 0.2 µg/liter (Abbott IMX, Montreal, Quebec, Canada), according to the manufacturers protocol. PSA velocity is defined as the rate of change of serum PSA over time, whereas PSA doubling time is defined as the number of doubings of serum PSA over the treatment period. Time to androgen-independent PSA regulation was defined as the duration of time required after castration for serum PSA levels to return to or increase above precastrate levels. Data points were expressed as average tumor volumes ± SEs of the mean based on at least five determinations.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
Effects of Bcl-2 ODN on LNCaP Tumor Growth Rates in Vivo.
In the first set of in vivo experiments, a two-base mismatch Bcl-2 ODN was compared with two groups receiving antisense Bcl-2 ODN, one beginning 1 day and the other 7 days after castration. Changes in LNCaP tumor growth and serum PSA are compared in Fig. 6
. LNCaP tumor growth rates were 5-fold higher in mismatch ODN controls compared with antisense Bcl-2 ODN-treated mice. Tumor volume in mismatch controls increased 2.5-fold (range, 1.53.2) by 6 weeks after castration and 5-fold (range, 36.2) by 12 weeks after castration. In contrast, tumor volume in both antisense Bcl-2 ODN groups gradually decreased during the first 23 weeks after castration of treatment, with stabilization thereafter. By 6 weeks after castration, mean tumor volume in group 1 was 53% of baseline (range, 4259%) and 61% in group 2 (range, 4875%). By 12 weeks after castration, tumor volume remained below precastrate baseline tumor volumes in both groups (75% of baseline in group 1 and 95% in group 2). Changes in serum PSA levels paralleled changes in tumor volume. Mean pretreatment PSA levels were 156 µg/liter, 143 µg/liter, and 153 µg/liter for the mismatch ODN and the two groups receiving antisense ODN, respectively. After castration, serum PSA decreased by 6070% in all three groups to nadir levels by 1 week after castration. In the mismatch ODN group, serum PSA increased beginning 2 weeks after castration to a mean of 400 µg/liter by 12 weeks after castration. In contrast, serum PSA levels stabilized or regressed compared with controls over the treatment period in mice treated with adjuvant antisense Bcl-2 ODN. By 12 weeks after castration, mean serum PSA levels were 75% lower (group 1, 92 µg/liter; group 2, 115 µg/liter) than control (400 µg/liter) levels. By 12 weeks after castration mean serum PSA increased 2.5-fold above precastrate levels in controls compared with remaining 30% lower than precastrate levels in the two antisense ODN groups. No significant toxicity (i.e., changes in weight, activity, death) was observed in any treatment group.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Controlled investigation of the molecular mechanisms mediating androgen-independent progression has proved difficult because of a paucity of animal models that mimick the course of the clinical disease. Of the available human prostate cancer cell lines, only the LNCaP cell line is androgen responsive, PSA secreting, and immortalized in vitro (27) . Like in human prostate cancer, serum PSA levels in the LNCaP tumor model are initially regulated by androgen, are directly proportional to tumor volume, and increase after prolonged periods of growth after castration to signal progression to androgen independence (4 , 22) . Apoptotic tumor regression does not consistently occur after castration, but tumor growth is inhibited and serum and tumor-cell PSA levels decrease by 80% for several weeks after castration, after which LNCaP tumor growth rates increase and PSA expression rises above precastrate levels. Nonandrogen-regulated PSA gene expression in LNCaP tumors after castration is one example of how other transacting factors can replace androgens and alter gene regulation during progression to androgen independence (28) . Characterization of androgen-repressed genes that are up-regulated after androgen withdrawal and play a causative role in progression to androgen indepen-dence is a critical step in developing targeted therapies that may prevent hormone-refractory prostate cancer.
Bcl-2 is one gene that has emerged as a putative mediator of resistance to chemotherapy and hormonal therapies and serves as a logical therapeutic target to delay progression after castration in prostate cancer. The Bcl-2 gene was originally identified at the chromosomal breakpoint of the translocation of a portion of chromosome 18 to 14 in B-cell lymphomas (7) . Bcl-2 is a critical regulator of apoptosis in a variety of cell systems and is now known to belong to a growing family of apoptosis regulatory gene products, which may either be death antagonists (Bcl-2, Bcl-Xl, Bcl-W, Bfl-1, Brag-1, and Mcl-1) or death agonists (Bax, Bak, Bcl-XS, Bad, Bid, Bik, and Hrk; Refs. (7, 8, 9, 10 ). The ratio of death antagonists to death agonists determines how a cell will respond to an apoptotic signal. In the prostate gland, Bcl-2 is expressed in the less differentiated basal cell layer of prostatic acini, but not in benign differentiated luminal cells or androgen-dependent prostate cancer cells (13, 14, 15, 16) . In prostate cancer cells, Bcl-2 is up-regulated during progression to androgen independence and may play an active role in resistance to apoptosis (17) . In view of the high prevalence of Bcl-2 in androgen-independent prostate cancers and its antiapoptosis function, we hypothesize that Bcl-2 plays a protective role in preventing castration-induced apoptosis initiated by androgen withdrawal, thereby accelerating progression to androgen independence. Hence, preventing Bcl-2 up-regulation after androgen withdrawal may enhance castration-induced apoptosis and delay progression to androgen independence.
Antisense ODNs offer one strategy to specifically target Bcl-2 gene expression. Phosphorothioate ODNs are water-soluble, stable agents manufactured to resist nuclease digestion. After parenteral administration, phosphorothioate ODNs become associated with high-capacity, low-affinity serum-binding proteins (19) . Recent studies have shown that antisense Bcl-2 ODNs induce apoptosis in Bcl-2-positive small-cell lung cancer cell lines in vitro (29) and increase chemosensitivity of melanoma cells in vitro and in vivo (30) . Hammerhead anti-Bcl-2 ribozyme treatment of LNCaP cells reduces Bcl-2 levels and induces apoptosis in low-Bcl-2-expressing LNCaP variants in vitro, but in vivo activity has not yet been reported (31) . A Phase I dose-escalation trial using antisense Bcl-2 ODNs in nine patients with lymphoma reported objective and subjective responses with no significant toxicity (32) . Taken together, the preclinical and early clinical data support the hypothesis that targeting Bcl-2 gene expression using antisense ODNs may be a valid therapeutic strategy. Indeed, in the androgen-dependent mouse Shionogi tumor model, which undergoes complete apoptotic regression with increased Bcl-2 gene expression after castration, followed by recurrence of androgen-refractory tumors, we have recently reported that adjuvant treatment with mouse antisense Bcl-2 ODN enhances castration-induced apo-ptosis and delays time to recurrence (33) .
Previous studies have focused on treatment strategies combining antisense Bcl-2 ODNs with chemotherapeutic agents (30) . The objectives of our studies were to evaluate the effects of androgen on Bcl-2 expression in androgen-sensitive LNCaP cells and whether the combination of antisense Bcl-2 ODN and androgen withdrawal therapy could delay progression to androgen independence. Increased levels of bcl-2 expression during progression from early untreated to hormone-refractory tumors may result from either clonal selection of Bcl-2-expressing clones or adaptative up-regulation of Bcl-2 gene expression in response to androgen depletion. Our data in LNCaP cells suggest that Bcl-2 is an androgen-repressed gene that is up-regulated after withdrawal of androgens both in vitro and in vivo. Physiological levels of androgens almost completely down-regulate Bcl-2 gene expression within 24 h. The reversible, androgen-repressed Bcl-2 expression demonstrated in this study, in addition to the sequence-specific in vitro and in vivo effects of antisense Bcl-2 ODNs in LNCaP cells, further supports the hypothesis that Bcl-2 up-regulation after androgen ablation helps mediate progression to androgen independence, presumably by inhibiting castration-induced apoptosis.
The sequence specificity of Bcl-2 mRNA suppression observed in our in vitro and in vivo studies supports an antisense mechanism of action for the antisense ODN, although additional therapeutically beneficial, sequence-independent, nonantisense interactions can not be ruled out (34 , 35) . For example, nonspecific phosphorothioate immunostimulation can occur via natural killer cell activation (36) . Phosphorothioates have also been shown to competitively inhibit a variety of nucleases and polymerases (37 , 38) and interact with heparin-binding growth factors (39) . However, nonspecific in vivo activity was not observed in our studies using two similar phosphorothioate control ODNs. Despite distinct sequence-specific Bcl-2 suppression and significant in vivo activity, a cytotoxic effect of antisense Bcl-2 ODNs could not be demonstrated in vitro. Other investigators have reported induction of apoptosis after treatment with antisense bcl-2 ODN (29 , 30) or ribozymes (31) . This disparity may result from varying sensitivity to specific apoptotic stimuli depending on growth conditions. Tumor cell sensitivity to antisense ODNs vary from tissue type and cell subline (28, 29, 30) . The relative balance between death antagonists and death agonists after androgen withdrawal may differ under in vitro and in vivo conditions. Second, androgen-regulated gene expression and growth sensitivity is significantly altered in androgen-dependent tissues when transferred to in vitro monolayer culture (40 , 41) . Finally, DNA fragmentation may not be a reliable marker of apoptosis in epithelial cells (42) , although lack of measurable apoptosis was also observed using flow cytometry.
In summary, the data reported herein provides additional evidence that Bcl-2 helps mediate progression to androgen independence. Antisense Bcl-2 ODNs decrease Bcl-2 mRNA and protein levels in LNCaP cells in vitro and inhibit tumor growth and serum PSA increases in vivo after castration in a sequence-specific manner. These data provide the first direct evidence that targeting a putative molecular mediator of androgen-independent progression using antisense ODN can delay progression.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by Grant 009002 from the National Cancer Institute of Canada. ![]()
2 To whom requests for reprints should be addressed, at D-9, 2733 Heather Street, Vancouver Hospital and Health Sciences Centre, Vancouver, British Columbia V5Z 3J5, Canada. Phone: (604) 875-5003; Fax: (604) 875-5604. ![]()
3 The abbreviations used are: PSA, prostate-specific antigen; ODN, oligodeoxynucleotide; FBS, fetal bovine serum; RT-PCR, reverse transcription-PCR. ![]()
Received 2/22/99; revised 7/19/99; accepted 7/30/99.
| REFERENCES |
|---|
|
|
|---|
protein in human B lymphoblastoid cell. Oncogene, 4: 1331-1336, 1989.[Medline]
irradiation leads to DNA fragmentation in lymphocytes. J. Immunol., 39: 3199-3206, 1987.
This article has been cited by other articles:
![]() |
S. Narita, A. So, S. Ettinger, N. Hayashi, M. Muramaki, L. Fazli, Y. Kim, and M. E. Gleave GLI2 Knockdown Using an Antisense Oligonucleotide Induces Apoptosis and Chemosensitizes Cells to Paclitaxel in Androgen-Independent Prostate Cancer Clin. Cancer Res., September 15, 2008; 14(18): 5769 - 5777. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Locke, E. S. Guns, A. A. Lubik, H. H. Adomat, S. C. Hendy, C. A. Wood, S. L. Ettinger, M. E. Gleave, and C. C. Nelson Androgen Levels Increase by Intratumoral De novo Steroidogenesis during Progression of Castration-Resistant Prostate Cancer Cancer Res., August 1, 2008; 68(15): 6407 - 6415. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Iguchi, M. Ito, S. Usui, A. Mizokami, M. Namiki, and K. Hirano Downregulation of Thymosin {beta}4 Expression by Androgen in Prostate Cancer LNCaP Cells J Androl, March 1, 2008; 29(2): 207 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Mocanu, K. W. Yip, J. Skliarenko, W. Shi, P. Busson, K.-W. Lo, C. Bastianutto, and F.-F. Liu Imaging and Modulating Antisense Microdistribution in Solid Human Xenograft Tumor Models Clin. Cancer Res., October 1, 2007; 13(19): 5935 - 5941. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang, J. Wang, B. Pang, R.-x. Liang, S. Li, P.-t. Huang, R. Wang, L. W.K. Chung, H. E. Zhau, C. Huang, et al. PC-1/PrLZ Contributes to Malignant Progression in Prostate Cancer Cancer Res., September 15, 2007; 67(18): 8906 - 8913. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Y. Khor, J. Moughan, T. Al-Saleem, E. H. Hammond, V. Venkatesan, S. A. Rosenthal, M. A. Ritter, H. M. Sandler, G. E. Hanks, W. U. Shipley, et al. Bcl-2 and Bax Expression Predict Prostate Cancer Outcome in Men Treated with Androgen Deprivation and Radiotherapy on Radiation Therapy Oncology Group Protocol 92-02 Clin. Cancer Res., June 15, 2007; 13(12): 3585 - 3590. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Anai, S. Goodison, K. Shiverick, Y. Hirao, B. D. Brown, and C. J. Rosser Knock-down of Bcl-2 by antisense oligodeoxynucleotides induces radiosensitization and inhibition of angiogenesis in human PC-3 prostate tumor xenografts Mol. Cancer Ther., January 1, 2007; 6(1): 101 - 111. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kamada, A. So, M. Muramaki, P. Rocchi, E. Beraldi, and M. Gleave Hsp27 knockdown using nucleotide-based therapies inhibit tumor growth and enhance chemotherapy in human bladder cancer cells Mol. Cancer Ther., January 1, 2007; 6(1): 299 - 308. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Inoue, T. Yoshida, Y. Shimizu, T. Kobayashi, T. Yamasaki, Y. Toda, T. Segawa, T. Kamoto, E. Nakamura, and O. Ogawa Requirement of Androgen-Dependent Activation of Protein Kinase C{zeta} for Androgen-Dependent Cell Proliferation in LNCaP Cells and Its Roles in Transition to Androgen-Independent Cells Mol. Endocrinol., December 1, 2006; 20(12): 3053 - 3069. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Cheng, R. Snoek, F. Ghaidi, M. E. Cox, and P. S. Rennie Short Hairpin RNA Knockdown of the Androgen Receptor Attenuates Ligand-Independent Activation and Delays Tumor Progression Cancer Res., November 1, 2006; 66(21): 10613 - 10620. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Maluf, C Cordon-Cardo, D. Verbel, J. Satagopan, M. Boyle, H Herr, and D. Bajorin Assessing interactions between mdm-2, p53, and bcl-2 as prognostic variables in muscle-invasive bladder cancer treated with neo-adjuvant chemotherapy followed by locoregional surgical treatment Ann. Onc., November 1, 2006; 17(11): 1677 - 1686. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tang, M. A. Khan, O. Goloubeva, D. I. Lee, D. Jelovac, A. M. Brodie, and A. Hussain Docetaxel Followed by Castration Improves Outcomes in LNCaP Prostate Cancer-Bearing Severe Combined Immunodeficient Mice Clin. Cancer Res., January 1, 2006; 12(1): 169 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Rocchi, E. Beraldi, S. Ettinger, L. Fazli, R. L. Vessella, C. Nelson, and M. Gleave Increased Hsp27 after Androgen Ablation Facilitates Androgen-Independent Progression in Prostate Cancer via Signal Transducers and Activators of Transcription 3-Mediated Suppression of Apoptosis Cancer Res., December 1, 2005; 65(23): 11083 - 11093. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yamanaka, P. Rocchi, H. Miyake, L. Fazli, B. Vessella, U. Zangemeister-Wittke, and M. E. Gleave A novel antisense oligonucleotide inhibiting several antiapoptotic Bcl-2 family members induces apoptosis and enhances chemosensitivity in androgen-independent human prostate cancer PC3 cells Mol. Cancer Ther., November 1, 2005; 4(11): 1689 - 1698. [Abstract] [Full Text] [PDF] |
||||
![]() |
K-M Rau, H-Y Kang, T-L Cha, S A Miller, and M-C Hung The mechanisms and managements of hormone-therapy resistance in breast and prostate cancers Endocr. Relat. Cancer, September 1, 2005; 12(3): 511 - 532. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Tolcher, K. Chi, J. Kuhn, M. Gleave, A. Patnaik, C. Takimoto, G. Schwartz, I. Thompson, K. Berg, S. D'Aloisio, et al. A Phase II, Pharmacokinetic, and Biological Correlative Study of Oblimersen Sodium and Docetaxel in Patients with Hormone-Refractory Prostate Cancer Clin. Cancer Res., May 15, 2005; 11(10): 3854 - 3861. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Rocchi, A. So, S. Kojima, M. Signaevsky, E. Beraldi, L. Fazli, A. Hurtado-coll, K. Yamanaka, and M. Gleave Heat Shock Protein 27 Increases after Androgen Ablation and Plays a Cytoprotective Role in Hormone-Refractory Prostate Cancer Cancer Res., September 15, 2004; 64(18): 6595 - 6602. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Tolcher, J. Kuhn, G. Schwartz, A. Patnaik, L. A. Hammond, I. Thompson, H. Fingert, D. Bushnell, S. Malik, J. Kreisberg, et al. A Phase I Pharmacokinetic and Biological Correlative Study of Oblimersen Sodium (Genasense, G3139), an Antisense Oligonucleotide to the Bcl-2 mRNA, and of Docetaxel in Patients with Hormone-Refractory Prostate Cancer Clin. Cancer Res., August 1, 2004; 10(15): 5048 - 5057. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Ettinger, R. Sobel, T. G. Whitmore, M. Akbari, D. R. Bradley, M. E. Gleave, and C. C. Nelson Dysregulation of Sterol Response Element-Binding Proteins and Downstream Effectors in Prostate Cancer during Progression to Androgen Independence Cancer Res., March 15, 2004; 64(6): 2212 - 2221. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kiyama, K. Morrison, T. Zellweger, M. Akbari, M. Cox, D. Yu, H. Miyake, and M. E. Gleave Castration-Induced Increases in Insulin-Like Growth Factor-Binding Protein 2 Promotes Proliferation of Androgen-independent Human Prostate LNCaP Tumors Cancer Res., July 1, 2003; 63(13): 3575 - 3584. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Zellweger, K. Chi, H. Miyake, H. Adomat, S. Kiyama, K. Skov, and M. E. Gleave Enhanced Radiation Sensitivity in Prostate Cancer by Inhibition of the Cell Survival Protein Clusterin Clin. Cancer Res., October 1, 2002; 8(10): 3276 - 3284. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Ciardiello and G. Tortora Inhibition of bcl-2 as cancer therapy Ann. Onc., April 1, 2002; 13(4): 501 - 502. [Full Text] [PDF] |
||||
![]() |
K. N. Chi, M. E. Gleave, R. Klasa, N. Murray, C. Bryce, D. E. Lopes de Menezes, S. D'Aloisio, and A. W. Tolcher A Phase I Dose-finding Study of Combined Treatment with an Antisense Bcl-2 Oligonucleotide (Genasense) and Mitoxantrone in Patients with Metastatic Hormone-refractory Prostate Cancer Clin. Cancer Res., December 1, 2001; 7(12): 3920 - 3927. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Huang, J. C. Cheville, Y. Pan, P. C. Roche, L. J. Schmidt, and D. J. Tindall PTEN Induces Chemosensitivity in PTEN-mutated Prostate Cancer Cells by Suppression of Bcl-2 Expression J. Biol. Chem., October 12, 2001; 276(42): 38830 - 38836. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Zellweger, H. Miyake, S. Cooper, K. Chi, B. S. Conklin, B. P. Monia, and M. E. Gleave Antitumor Activity of Antisense Clusterin Oligonucleotides Is Improved in Vitro and in Vivo by Incorporation of 2'-O-(2-Methoxy)Ethyl Chemistry J. Pharmacol. Exp. Ther., September 1, 2001; 298(3): 934 - 940. [Abstract] [Full Text] |
||||
![]() |
G. Tortora, R. Caputo, V. Damiano, R. Bianco, G. Fontanini, S. Cuccato, S. De Placido, A. R. Bianco, and F. Ciardiello Combined Blockade of Protein Kinase A and Bcl-2 by Antisense Strategy Induces Apoptosis and Inhibits Tumor Growth and Angiogenesis Clin. Cancer Res., August 1, 2001; 7(8): 2537 - 2544. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Smith, T. Xie, Z.-Z. Zhou, and I. Joshi Efficacy of Treatment with Antisense Oligonucleotides Complementary to Immunoglobulin Sequences of bcl-2/Immunoglobulin Fusion Transcript in a t(14;18) Human Lymphoma-scid Mouse Model Clin. Cancer Res., February 1, 2001; 7(2): 400 - 406. [Abstract] [Full Text] |
||||
![]() |
C. Abate-Shen and M. M. Shen Molecular genetics of prostate cancer Genes & Dev., October 1, 2000; 14(19): 2410 - 2434. [Full Text] |
||||
![]() |
H. Miyake, K. N. Chi, and M. E. Gleave Antisense TRPM-2 Oligodeoxynucleotides Chemosensitize Human Androgen-independent PC-3 Prostate Cancer Cells Both in Vitro and in Vivo Clin. Cancer Res., May 1, 2000; 6(5): 1655 - 1663. [Abstract] [Full Text] |
||||
![]() |
H. Miyake, C. Nelson, P. S. Rennie, and M. E. Gleave Testosterone-repressed Prostate Message-2 Is an Antiapoptotic Gene Involved in Progression to Androgen Independence in Prostate Cancer Cancer Res., January 1, 2000; 60(1): 170 - 176. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |