Clinical Cancer Research Meeting Calendar Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Raffel, C.
Right arrow Articles by James, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Raffel, C.
Right arrow Articles by James, C. D.
Clinical Cancer Research Vol. 5, 4085-4090, December 1999
© 1999 American Association for Cancer Research


Molecular Oncology, Markers, Clinical Correlates

Analysis of Oncogene and Tumor Suppressor Gene Alterations in Pediatric Malignant Astrocytomas Reveals Reduced Survival for Patients with PTEN Mutations1

Corey Raffel, Lori Frederick, Judith R. O’Fallon, Pamela Atherton-Skaff, Arie Perry, Robert B. Jenkins and C. David James2

Departments of Neurosurgery [C. R.], Laboratory Medicine and Pathology [L. F., R. B. J., C. D. J.], and Statistics [J. R. O., P. A-S.], Mayo Clinic and Foundation, Rochester, Minnesota 55905, and Department of Pathology, Washington University School of Medicine, St. Louis, Missouri 63110 [A. P.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although common among adult intracranial neoplasms, pediatric malignant astrocytomas (PMAs) comprise a relatively small proportion of the brain tumors that occur in children. The scarcity of such cases generally requires that molecular analyses of PMAs are based on the utilization of paraffin-embedded material, and here we have used 39 such specimens to examine the incidence and prognostic significance of oncogene and tumor suppressor gene alterations (including amplifications of EGFR, CDK4, and MDM2 as well as inactivating mutations of CDKN2A, TP53, and PTEN) in these tumors. In general, the frequency of alteration for the genes we have studied fell within ranges that have been reported for adult astrocytomas. However, EGFR amplification, which is usually observed in approximately 40% and 15% of adult grade 4 and grade 3 astrocytomas, respectively, was not detected in any member of this series. With regard to prognosis, PTEN mutations were significantly associated with decreased survival among grade 3 and grade 4 PMA patients, a potentially important observation because neither patient age nor tumor malignancy grade was correlated with outcome for these individuals. In total, our data suggest at least one significant distinction between the genetic etiology of pediatric and adult astrocytomas and additionally reveal that analysis of PTEN mutations in PMA patients may be useful in the differential diagnosis of these tumors.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
During the past 10 years, a fairly extensive body of literature has developed from the analysis of gene alterations in adult malignant astrocytomas (reviewed in Refs. 1 and 2 ). However, there is little information available on the genetics of corresponding tumors from the pediatric population. The emphasis on studying adult malignant astrocytomas for gene alterations is a consequence of the relatively low frequency of cancer in children combined with the fact that PMAs3 constitute a small proportion of brain tumors in children: perhaps 5–10% of childhood intracranial neoplasms are of this type (3 , 4) .

The majority of work that has been published on PMAs involves the TP53 tumor suppressor gene (5, 6, 7, 8, 9, 10) , and with reference to these studies, there is considerable variation in the reported TP53 mutation rates. This problem is typical of much of the literature dealing with molecular genetics of PMAs; consequently, it is unclear whether the gene alterations associated with the development of adult astrocytomas occur at comparable frequencies in their pediatric counterparts.

This dearth of information concerning the genetic etiology of PMAs is particularly unfortunate because there is no other group of brain tumors for which patient outcome is so poor. With respect to clinical implications, there are at least two major benefits that would likely result from their genetic analysis. The first involves the identification of markers useful for predicting the clinical course of the disease and length of survival. The other involves the ability of molecular genetic investigations to provide insights concerning the fundamental mechanisms of tumor development and, in doing so, provide information about potential therapeutic targets.

With regard to outcome analyses, hundreds of studies have been published that address survival as a function of tumor genotype. For malignant astrocytomas, such studies have generally involved adult tumor cohorts, and the related investigations have usually failed to demonstrate a consistent relationship between tumor genotype and patient survival when the prognostic significance of specific gene alterations is viewed in the context of other clinical parameters. In particular, tumor malignancy grade and patient age are invariably identified as the most reliable predictors of outcome (11 , 12) . It is because of the contribution of increasing age to the decreased survival of adult astrocytoma patients that genetic outcome analyses of PMA patients should be particularly interesting; a comparable age effect is not anticipated in pediatric patients because their overall health condition should not be adversely affected by increasing age.

In association with the preceding considerations, we have examined a relatively large cohort of PMAs for gene alterations that commonly occur in adult astrocytomas. Our results suggest a significant distinction in the molecular etiology of PMAs with respect to their adult counterparts and further indicate that genetic testing of these tumors may be useful for predicting their clinical behavior.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Isolation of DNA.
H&E-stained tissue sections were reviewed, and areas of embedded tissues that contained at least 70% tumor cells were identified. These areas were dissected from the corresponding unstained sections, and tissues were deparaffinized in Histoclear (National Diagnostics, Atlanta, GA) for 10 min before DNA extraction with the QIAamp Tissue Extraction Kit (QIAGEN Inc., Arlington Heights, IL).

Assessment of Gene Dosage.
Competitive (multiplex) amplifications were performed in 50-µl volumes containing 200 µM of each dNTP, 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 0.001% gelatin, and 1.25 units of Amplitaq Gold (Perkin-Elmer, Foster City, CA) and the following primer (target and reference gene) amounts: (a) 8 and 12 pmol of EGFR and CF primer pairs, respectively; (b) 10 pmol each for CDK4 and DR primer pairs; (c) 13.3 and 6.7 pmol of MDM2 and DR primer pairs, respectively; and (d) 10 pmol each of CDKN2A and APEX primer pairs. Reaction conditions for CDKN2A amplifications were for 43 cycles using a touchdown profile previously described by Burns et al. (13) . For analysis of EGFR, CDK4, and MDM2 amplification, the PCR profiles were 95°C for 9 min; followed by 43 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min; followed by extension at 72°C for 10 min. With the exception of CDK4, all primer sequences have been described previously (13 , 14) . For CDK4, the primers used were AGTTCGTGAGGTGGCTTTACTGAGG (forward) and CTCTCATTATTTCCTCAGGGTCCCC (reverse).

Amplification products were separated in 4% agarose gels that were stained in 0.5 µg/ml ethidium bromide for 30 min at room temperature and then destained in deionized water for 30 min before quantitation of band intensities using a Gel Doc 1000 photodocumentation system (Bio-Rad) and its associated software (Molecular Analyst). The procedure used to assess CDKN2A gene dosage is essentially as we have described previously for the detection of PTEN homozygous deletions (15) . In brief, standard curves were generated from a series of samples containing varying proportions of normal DNA mixed with DNA from a glioblastoma cell line having a CDKN2A homozygous deletion (U87; American Type Culture Collection). Normalized CDKN2A signal intensities (CDKN2A:APEX signal ratios) from tumor DNAs were plotted against standard curves, and cases having less than 20% the CDKN2A signal found in normal DNA were scored as having homozygous deletions. EGFR, CDK4, and MDM2 reaction products from tumor DNAs were normalized against the signal produced by the fragment for the internal reference gene, and these ratios were compared against the corresponding ratios derived from normal DNAs and from DNAs extracted from tissue sections of adult astrocytomas that had been previously identified as having either EGFR, CDK4, or MDM2 amplification (16) . Specimens with target:reference gene signal ratios that were more than three times that determined in normal DNAs were scored as having gene amplification (14) .

Preparatory PCR for DNA Sequencing.
To prepare PCR products for sequencing, 1 µl of stock DNAs was amplified in a 50-µl volume containing 20 pmol of forward and reverse primer, 200 µM of each dNTP, 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 0.001% gelatin, 5% DMSO, and 1.25 units of Amplitaq Gold (Perkin-Elmer). Reactions were carried out in a Perkin-Elmer 9600 under the following conditions: 95°C hold for 9 min; followed by 50 cycles of 95°C for 30 s, 55°C or 48°C for 30 s, and 72°C for 1 min; followed by a 10-min hold at 72°C. The primers used for the amplification of PTEN coding sequences (each of the nine exons) and TP53 coding sequences (exons 5–8) have been described previously (17 , 18) .

Sequencing.
Sequencing reactions (6.5 µl) were prepared that contained 100 ng of PCR product from the preparatory PCRs, 2 pmol of primer, 18 mM Tris-HCl (pH 9.5), 4.5 mM MgCl2, 2.3 µM cold dNTPs, 0.023 µM[{alpha}-33P]dideoxynucleotide triphosphates, and 8 units of ThermoSequenase DNA polymerase (Amersham Life Science, Inc., Arlington Heights, IL). Sequencing reactions were amplified for 30 cycles at 95°C for 20 s, 58°C for 30 s, and 72°C for 1 min using a 1 min ramp time between annealing and elongation phases. After sample denaturation, reaction products were loaded onto a 6% sequencing gel (19:1 acrylamide, 7 M urea, 0.5 x Tris-borate EDTA, and 15% formamide). Electrophoresis was at 75 W at room temperature for 1 h, after which the gels were dried and exposed to Kodak XAR film. Establishment of a tumor mutation was based on the identification of the same sequence alteration in two separate PCR templates generated from the same sample.

Statistical Analysis.
Survival distributions from the date of tissue acquisition were estimated with Kaplan-Meier curves. Comparisons of patient subsets for each clinical or genetic variable were performed using log-rank tests.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A total of 48 PMAs obtained from patients treated at the Mayo Clinic since 1985 were identified through a review of pathology registries and an examination of H&E-stained tissue sections. Blocks containing tissue that yielded DNA of sufficient quantity and quality to support the analysis of all genes of interest were available for 39 of these cases (Table 1)Citation . With only one exception, each of the 39 tumors was classified as an astrocytoma; case OA2-1 was determined to be of mixed composition, but it was included in this cohort as a result of its predominant astrocytic character.


View this table:
[in this window]
[in a new window]

 
Table 1 PMA clinical and genetic data

For EGFR, CDK4, MDM2, and CDKN2A/ARF, a + indicates a specimen having an alteration for the indicated gene.

 
Two types of molecular genetic analyses were performed on the DNAs extracted from the archival tissue: (a) competitive PCR reactions to detect tumor-associated alterations in the EGFR, CDK4, MDM2, and CDKN2A gene copy number; and (b) sequence analysis of PCR fragments containing the TP53 and PTEN coding sequence. Because CDKN2A exon 2 sequence was targeted in competitive PCR reactions for dosage analyses of this tumor suppressor gene, specimens determined to have a CDKN2A homozygous deletion would also have homozygous deletion of ARF (19) . Results from the genetic analysis of individual tumors are presented in Table 1Citation , and the cumulative data are summarized in Table 2Citation . Most notable is the absence of EGFR amplification in each and every specimen (Fig. 1)Citation . Based on the incidence of EGFR amplification in adult malignant astrocytomas (20, 21, 22) , one would expect to find eight to nine cases with EGFR amplification in a series of this size and malignancy grade composition.


View this table:
[in this window]
[in a new window]

 
Table 2 Gene alteration frequencies in PMAs

 


View larger version (59K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Representative data from competitive PCR reactions showing lack of EGFR amplification in grade 3 and 4 astrocytomas and the coamplification of MDM2 and CDK4 in tumor A3-7. In each panel, the upper fragment is the result of amplification of the indicated oncogene target, whereas the lower fragment results from amplification of the internal reference gene (see "Materials and Methods"). +C, positive control (DNA extracted from a tissue section of an adult astrocytoma that had been previously determined to have amplification of the indicated gene; Ref. 16 ). NTC, normal tissue control.

 
To create a standard with which to compare the results of gene alteration-survival analyses, patient survival was examined in the context of tumor malignancy grade, a variable that represents one of the most important prognostic factors for adult astrocytomas. Although there was a significant difference in the length of survival when all three malignancy grades were considered (P = 0.002), this significance was not evident when the comparison only involved the grade 3 and grade 4 tumor groups (P = 0.27; Fig. 2ACitation ). There was no correlation between patient age and survival for this series of tumors (data not shown).



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Kaplan-Meier survival curves (in weeks) for pediatric patients with grade 3 or grade 4 astrocytomas. The variable used for distinguishing patient groups in each plot is indicated in bold in the top right corner.

 
Because of the lack of a significant association between survival and grade 3 versus grade 4 malignancy classification, we restricted our gene alteration-survival analyses to these two groups of tumors to determine whether the status of any of the genes we had examined might prove useful in predicting outcome for patients with intermediate or high-grade astrocytoma. For patients with TP53 mutations, there was no significant difference in survival compared with patients whose tumors showed only wild-type TP53 sequence (P = 0.49; Fig. 2BCitation ). Because MDM2 amplification and ARF homozygous deletion have been suggested to result in the functional inactivation of p53 (23 , 24) , we also compared the survival of patients with either TP53 mutation, MDM2 amplification, or ARF homozygous deletion with the survival of patients whose tumors lacked each of these alterations. This analysis also failed to reveal a significant difference in survival between groups defined in such a manner (P = 0.80).

Patients with amplification of CDK4 or a homozygous deletion of the gene encoding the cdk4 inhibitor p16 did not show a significant difference in survival relative to patients whose tumors did not have either of these alterations (P = 0.60; Fig. 2CCitation ). In contrast, the presence of a PTEN mutation (examples are shown in Fig. 3Citation ) was strongly associated with decreased survival among grade 3 and grade 4 tumor patients (P = 0.006; Fig. 2DCitation ).



View larger version (77K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Examples of a frameshift (A4-12) and a missense (A3-17) mutation of PTEN.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
With the exception of the data involving TP53 mutations, there is little in the published literature with which to compare the results of this study for consistency . For TP53 alterations in PMAs, mutation frequencies between 0% and 66% have been reported in grade 4 astrocytomas, and mutation frequencies between 0% and 50% have been reported anaplastic astrocytomas (5, 6, 7, 8, 9, 10) . Based on data from these studies, the cumulative calculated TP53 mutation frequencies are 31.3% (19 of 51) and 9.7% (3 of 31) in grade 4 and grade 3 PMAs, respectively. These values could lead one to believe that TP53 mutations are associated with increasing astrocytoma malignancy and might therefore suggest that this gene alteration is linked with tumor progression. The opposite is thought to be true for adult astrocytomas, where TP53 mutation frequencies are highest in grade 2 and grade 3 tumors, and, consequently, this gene alteration is generally considered to represent an early event in the development of adult astrocytoma (25 , 26) . In this study, TP53 mutation frequencies of 20% and 24% were observed in grade 4 and grade 3 astrocytomas, respectively; one of seven grade 2 tumors examined showed a TP53 mutation. Importantly, there was no indication that TP53 mutations, or what have been described as functionally equivalent gene alterations (MDM2 amplification or ARF homozygous deletion; Refs. 23 and 24 ), were predictive of outcome for PMA patients. Consequently, these data contrast with results presented in a previous report that indicated that TP53 mutations are correlated with reduced survival for children with malignant astrocytoma (8) .

Gene alterations leading to increased cdk4 activity, either CDKN2A homozygous deletion or CDK4 amplification, have not been examined previously in PMAs. Here these alterations were observed in 17.6% (3 of 17) and 13.3% (2 of 15) of grade 3 and grade 4 tumors, respectively. In previous investigations of adult astrocytomas, CDKN2A homozygous deletion and CDK4 amplification have primarily been identified in grade 3 and grade 4 malignant astrocytomas (27 , 28) , and our data are consistent with these findings because no CDKN2A or CDK4 alterations were identified in grade 2 tumors. As was the case for alterations affecting p53 function, alterations leading to increased cdk4 activity were not predictive of survival for PMA patients.

PTEN mutations were observed in 20% of the grade 4 tumors (3 of 15), 5.9% of the grade 3 tumors (1 of 17), and 0% of the grade 2 tumors. These data are consistent with results associated with the study of adult astrocytomas that indicate that PTEN mutations are highly correlated with increasing malignancy grade and occur primarily in tumors of grade 4 malignancy (29) . Of the genes examined in this study, mutations of PTEN represent the only alteration that shows a significant association with survival (P = 0.006; Fig. 2DCitation ). The potential importance of this observation is underscored by the lack of prognostic significance associated with grade 3 versus grade 4 malignancy for these tumors (Fig. 2A)Citation , and these are the only malignancy grades of astrocytoma in which PTEN mutations have been observed. Due to the small size of this series of PMAs, it will be necessary to perform a validation study with a larger cohort of tumors to address the reliability of this finding, as well as the findings involving the other gene alterations we have investigated. It is worth noting, however, that our results involving PTEN are consistent with data presented in a recent study of adult grade 4 astrocytomas that indicate that PTEN deletions are a negative prognostic indicator (30) .

In comparing the incidence of specific gene alterations in this cohort of PMAs against data published from the study of adult astrocytomas, the only result that supports an important difference between the genetic etiologies of the two groups of tumors concerns the incidence of EGFR amplification. None of the 15 grade 4 or the 17 grade 3 tumors showed evidence of this gene alteration, and this result is significantly different from the results one would anticipate from the analysis of a series of adult astrocytomas having a similar size and malignancy grade composition. Two other studies have reported data from the analysis of EGFR amplification in PMAs. In one study (5) , amplified EGFR was identified in one of four glioblastomas (25%) and in zero of two anaplastic astrocytomas; analysis of this number of specimens did not allow for a meaningful comparison of the frequency of EGFR amplification in adult versus pediatric tumors. In the second study, no EGFR amplifications were observed among 11 anaplastic astrocytomas and 13 glioblastomas (31) . Our data are consistent with the results presented in the latter report because there were no amplifications of EGFR in a combined 32 cases of grade 3 and grade 4 tumors: this finding points to an important difference between the development of pediatric and adult malignant astrocytomas.

The lack of EGFR amplification in these tumors has important implications for the clinical management of PMAs. Several experimental strategies for the treatment of adult malignant astrocytomas are based on the elevated expression of either mutant or wild-type epidermal growth factor receptor (32, 33, 34, 35) ; the results presented here suggest that such therapeutic approaches may not be effective if used on children with malignant astrocytomas. Conversely, it appears as though TP53 mutations occur at similar frequencies in both pediatric and adult astrocytomas and that therapies designed to exploit aberrant p53 function in tumors cells (36) may be effective for treating some of the astrocytic tumors in both age groups.

This investigation was based entirely on the analysis of DNA extracted from paraffin-embedded material because the utilization of this type of tissue does not require a lengthy prospective collection of specimens that should be anticipated for a relatively rare type of tumor. The lack of reference (normal) DNA for such a study is unfortunate because one might expect constitutional genetic lesions to play a significant role in childhood cancer as compared to cancer occurring in an elderly population. For instance, patients with Cowden’s syndrome are known to be predisposed to tumor development as a result of inheriting a defective PTEN gene (37) . Although our analysis of clinical information for the four patients with PTEN mutations gave no indication of a familial history of cancer, the possibility of individuals in this study having germ-line PTEN or TP53 mutations persists. However, the need to establish a foundation for understanding of the genetic basis of PMAs offsets the liability associated with the lack of reference DNA, and we have demonstrated that extrapolations from the study of adult astrocytomas can lead to erroneous conclusions regarding the molecular etiology of PMAs. Further determination of both the similarities and differences between pediatric and adult astrocytomas will aid in the development of targeted, individualized therapies that will be of benefit to all individuals afflicted with this type of cancer.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by National Cancer Institute Grants CA-55728 (to C. D. J.) and CA-50905 (to R. B. J.) and by a grant from the Pediatric Brain Tumor Association of the United States (to C. D. J.). Back

2 To whom requests for reprints should be addressed, at Mayo Clinic, 200 First Street SW, Hilton Building, Room 820-D, Rochester, MN 55905. Phone: (507) 284-8989; Fax: (507) 266-5193; E-mail: james.charles{at}mayo.edu Back

3 The abbreviations used are: PMA, pediatric malignant astrocytoma; dNTP, deoxynucleotide triphosphate. Back

Received 6/14/99; revised 9/ 8/99; accepted 9/10/99.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Darling J. L., Warr T. J. Biology and genetics of malignant brain tumours. Curr. Opin. Neurol., 11: 619-625, 1998.[Medline]
  2. Ng H. K., Lam P. Y. The molecular genetics of central nervous system tumors. Pathology, 30: 196-202, 1998.[Medline]
  3. Pollack I. Current concepts: brain tumors in children. N. Engl. J. Med., 331: 1500-1507, 1994.[Free Full Text]
  4. Finlay J. L. Chemotherapeutic strategies for high-grade astrocytomas of childhood Packer R. J. Bleyer W. A. Pochedly C. eds. . Pediatric Neuro-Oncology, 3: 176-206, Harwood Academic Publishers Chur, Switzerland 1992.
  5. Rasheed B. K., McLendon R. E., Herndon J. E., Friedman H. S., Friedman A. H., Bigner D. D., Bigner S. H. Alterations of the TP53 gene in human gliomas. Cancer Res., 54: 1324-1330, 1994.[Abstract/Free Full Text]
  6. Litofsky N. S., Hinton D., Raffel C. The lack of a role for p53 in astrocytomas in pediatric patients. Neurosurgery, 3: 967-972, 1994.
  7. Felix C. A., Slavec I., Dunn M., Strauss E. A., Phillips P. C., Rorke L. B., Sutton L., Bunin G. R., Biegel J. A. p53 gene mutations in pediatric brain tumors. Med. Ped. Oncol., 25: 431-436, 1995.[Medline]
  8. Pollack I. F., Hamilton R. L., Finkelstein S. D., Campbell J. W., Martinez A. J., Sherwin R. N., Bozik M. E., Gollin S. M. The relationship between TP53 mutations and overexpression of p53 and prognosis in malignant gliomas of childhood. Cancer Res., 57: 304-309, 1997.[Abstract/Free Full Text]
  9. Sure U., Ruedi D., Tachibana O., Yonekawa Y., Ohgaki H., Kleihues P., Hegi M. E. Determination of p53 mutations, EGFR overexpression, and loss of p16 expression in pediatric glioblastomas. J. Neuropathol. Exp. Neurol., 56: 782-789, 1997.[Medline]
  10. Bhattacharjee M. B., Bruner J. M. p53 protein in pediatric malignant astrocytomas: a study of 21 patients. J. Neuro-Oncol., 32: 225-233, 1997.[Medline]
  11. Salminen E., Nuutinen J. M., Huhtala S. Multivariate analysis of prognostic factors in 106 patients with malignant glioma. Eur. J. Cancer, 32A: 1918-1923, 1996.
  12. Salcman M., Scholtz H., Kaplan R. S., Kulik S. Long-term survival in patients with malignant astrocytoma. Neurosurgery, 34: 213-219, 1994.[Medline]
  13. Burns K. L., Ueki K., Jhung S. L., Koh J., Louis D. N. Molecular genetic correlates of p16, cdk4, and pRb immunohistochemistry in glioblastomas. J. Neuropathol. Exp. Neurol., 57: 122-130, 1998.[Medline]
  14. Hunter S. B., Abbott K., Varma V. A., Olson J. J., Barnett D. W., James C. D. Reliability of differential PCR for the detection of EGFR and MDM2 gene amplification in DNA extracted from FFPE glioma tissue. J. Neuropathol. Exp. Neurol., 54: 57-64, 1995.[Medline]
  15. Liu W., James C. D., Frederick L., Alderete B., Jenkins R. B. PTEN/MMAC1 mutations and EGFR amplification in glioblastomas. Cancer Res., 57: 5254-5257, 1997.[Abstract/Free Full Text]
  16. Olson J. J., Barnett D., Yang J., Assietti R., Cotsonis G., James C. D. Gene amplification as a prognostic factor in primary brain tumors. Clin. Cancer Res., 4: 215-222, 1998.[Abstract]
  17. Sommer S. S., Cunningham J., McGovern R. M., Saitoh S., Schroeder J. J., Wold L. E., Kovach J. S. Pattern of p53 gene mutations in breast cancers of women of the midwestern United States. J. Natl. Cancer Inst., 84: 246-252, 1992.[Abstract/Free Full Text]
  18. Brat D. J., James C. D., Jedlicka A. E., Connolly D. C., Cho K. R., Chang E., Castellani R. J., Schmid M., Schiller M., Carson D. A., Burger P. C. Molecular genetic alterations in radiation-induced astrocytomas. Am. J. Pathol., 154: 1431-1438, 1999.[Abstract/Free Full Text]
  19. Mao L., Merlo A., Bedi G., Shapiro G. I., Edwards C. D., Rollins B. J., Sidransky D. A novel p16INK4A transcript. Cancer Res., 55: 2995-2997, 1995.[Abstract/Free Full Text]
  20. Wong A. J., Bigner S. H., Bigner D. D., Kinzler K. W., Hamilton S. R., Vogelstein B. Increased expression of the epidermal growth factor receptor gene in malignant gliomas is invariably associated with gene amplification. Proc. Natl. Acad. Sci. USA, 84: 6899-6903, 1987.[Abstract/Free Full Text]
  21. Ekstrand A. J., James C. D., Cavenee W. K., Seliger B., Pettersson R. F., Collins V. P. Genes for epidermal growth factor receptor, transforming growth factor {alpha}, and epidermal growth factor and their expression in human gliomas in vivo. Cancer Res., 51: 2164-2172, 1991.[Abstract/Free Full Text]
  22. Schlegel J., Merdes A., Stumm G., Albert F. K., Forsting M., Hynes N., Kiessling M. Amplification of the epidermal-growth-factor-receptor gene correlates with different growth behaviour in human glioblastoma. Int. J. Cancer, 56: 72-77, 1994.[Medline]
  23. Oliner J. D., Kinzler K. W., Meltzer P. S., George D. L., Vogelstein B. Amplification of a gene encoding a p53-associated protein in human sarcomas. Nature (Lond.), 358: 80-83, 1992.[Medline]
  24. Zhang Y., Xiong Y., Yarbrough W. G. ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways. Cell, 92: 725-734, 1998.[Medline]
  25. Sidransky D., Mikkelsen T., Schwechheimer K., Rosenblum M. L., Cavanee W., Vogelstein B. Clonal expansion of p53 mutant cells is associated with brain tumour progression. Nature (Lond.), 355: 846-847, 1992.[Medline]
  26. Fults D., Brockmeyer D., Tullous M. W., Pedone C. A., Cawthon R. M. p53 mutation and loss of heterozygosity on chromosomes 17 and 10 during human astrocytoma progression. Cancer Res., 52: 674-679, 1992.[Abstract/Free Full Text]
  27. Sonoda Y., Yoshimoto T., Sekiya T. Homozygous deletion of the MTS1/p16 and MTS2/p15 genes and amplification of the CDK4 gene in glioma. Oncogene, 11: 2145-2149, 1995.[Medline]
  28. Ueki K., Ono Y., Henson J. W., Efird J. T., von Deimling A., Louis D. N. CDKN2/p16 or RB alterations occur in the majority of glioblastomas and are inversely correlated. Cancer Res., 56: 150-153, 1996.[Abstract/Free Full Text]
  29. Rasheed B. K., Stenzel T. T., McLendon R. E., Parsons R., Friedman A. H., Friedman H. S., Bigner D. D., Bigner S. H. PTEN gene mutations are seen in high-grade but not in low-grade gliomas. Cancer Res., 57: 4187-4190, 1997.[Abstract/Free Full Text]
  30. Lin H., Bondy N. L., Langford L. A., Hess K. R., Delclos G. L., Wu X. F., Chan W. Y., Pershouse M. A., Yung W. K. A., Steck P. A. Allelic deletion analyses of MMAC1/PTEN and DMBT1 loci in gliomas: relationship to prognostic significance. Clin. Cancer Res., 4: 2447-2454, 1998.[Abstract/Free Full Text]
  31. Cheng Y., Ng H. K., Pang J. Alterations of p53, PTEN, EGFR, chromosome 9p21 and microsatellite instability in pediatric high-grade astrocytomas. Proc. Am. Assoc. Cancer Res., 40: 3991-, 1999.
  32. Yang W., Barth R. F., Adams D. M., Soloway A. H. Intratumoral delivery of boronated epidermal growth factor for neutron capture therapy of brain tumors. Cancer Res., 57: 4333-4339, 1997.[Abstract/Free Full Text]
  33. O’Rourke D. M., Qian X., Zhang H. T., Davis J. G., Nute E., Meinkoth J., Greene M. I. Trans receptor inhibition of human glioblastoma cells by erbB family ectodomains. Proc. Natl. Acad. Sci. USA, 94: 3250-3255, 1997.[Abstract/Free Full Text]
  34. Wersall P., Ohlsson I., Biberfeld P., Collins V. P., von Krusenstjerna S., Larsson S., Mellstedt H., Boethius J. Intratumoral infusion of the monoclonal antibody, mAb 425, against the epidermal-growth-factor receptor in patients with advanced malignant glioma. Cancer Immunol. Immunother., 44: 157-164, 1997.[Medline]
  35. Penar P. L., Khoshyomn S., Bhushan A., Tritton T. R. Inhibition of epidermal growth factor receptor-associated tyrosine kinase blocks glioblastoma invasion of the brain. Neurosurgery, 40: 141-151, 1997.[Medline]
  36. Heise C., Sampson-Johannes A., Williams A., McCormick F., Von Hoff D. D., Kirn D. H. ONYX-015, an E1B gene-attenuated adenovirus, causes tumor-specific cytolysis and antitumoral efficacy that can be augmented by standard chemotherapeutic agents. Nat. Med., 3: 639-645, 1997.[Medline]
  37. Liaw D., Marsh D. J., Li J., Dahia P. L., Wang S. I., Zheng Z., Bose S., Call K. M., Tsou H. C., Peacocke M., Eng C., Parsons R. Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat. Genet., 16: 64-67, 1997.[Medline]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
A. Broniscer, S. J. Baker, C. F. Stewart, T. E. Merchant, F. H. Laningham, P. Schaiquevich, M. Kocak, E. B. Morris, R. Endersby, D. W. Ellison, et al.
Phase I and Pharmacokinetic Studies of Erlotinib Administered Concurrently with Radiotherapy for Children, Adolescents, and Young Adults with High-Grade Glioma
Clin. Cancer Res., January 15, 2009; 15(2): 701 - 707.
[Abstract] [Full Text] [PDF]


Home page
Neuro OncolHome page
V. Suri, P. Das, A. Jain, M. C. Sharma, S. A. Borkar, A. Suri, D. Gupta, and C. Sarkar
Pediatric glioblastomas: A histopathological and molecular genetic study
Neuro-oncol, January 1, 2009; 11(3): 274 - 280.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. K. Thorarinsdottir, M. Santi, R. McCarter, E. J. Rushing, R. Cornelison, A. Jales, and T. J. MacDonald
Protein Expression of Platelet-Derived Growth Factor Receptor Correlates with Malignant Histology and PTEN with Survival in Childhood Gliomas
Clin. Cancer Res., June 1, 2008; 14(11): 3386 - 3394.
[Abstract] [Full Text] [PDF]


Home page
Am Soc Clin Oncol Ed BookHome page
K. E. Warren
Pediatric High-grade Gliomas
ASCO Educational Book, January 1, 2008; 2008(1): 472 - 477.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
D. Faury, A. Nantel, S. E. Dunn, M.-C. Guiot, T. Haque, P. Hauser, M. Garami, L. Bognar, Z. Hanzely, P. P. Liberski, et al.
Molecular Profiling Identifies Prognostic Subgroups of Pediatric Glioblastoma and Shows Increased YB-1 Expression in Tumors
J. Clin. Oncol., April 1, 2007; 25(10): 1196 - 1208.
[Abstract] [Full Text] [PDF]


Home page
Neuro OncolHome page
M. Nakamura, K. Shimada, E. Ishida, T. Higuchi, H. Nakase, T. Sakaki, and N. Konishi
Molecular pathogenesis of pediatric astrocytic tumors
Neuro-oncol, April 1, 2007; 9(2): 113 - 123.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
I. F. Pollack, R. L. Hamilton, R. W. Sobol, J. Burnham, A. J. Yates, E. J. Holmes, T. Zhou, and J. L. Finlay
O6-Methylguanine-DNA Methyltransferase Expression Strongly Correlates With Outcome in Childhood Malignant Gliomas: Results From the CCG-945 Cohort
J. Clin. Oncol., July 20, 2006; 24(21): 3431 - 3437.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
D. A. Reardon, J. N. Rich, H. S. Friedman, and D. D. Bigner
Recent Advances in the Treatment of Malignant Astrocytoma
J. Clin. Oncol., March 10, 2006; 24(8): 1253 - 1265.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. H. Abdel-Rahman, Y. Yang, X.-P. Zhou, E. L. Craig, F. H. Davidorf, and C. Eng
High Frequency of Submicroscopic Hemizygous Deletion Is a Major Mechanism of Loss of Expression of PTEN in Uveal Melanoma
J. Clin. Oncol., January 10, 2006; 24(2): 288 - 295.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
A. Broniscer and A. Gajjar
Supratentorial High-Grade Astrocytoma and Diffuse Brainstem Glioma: Two Challenges for the Pediatric Oncologist
Oncologist, April 1, 2004; 9(2): 197 - 206.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. M. Backlund, B. R. Nilsson, H. M. Goike, E. E. Schmidt, L. Liu, K. Ichimura, and V. P. Collins
Short Postoperative Survival for Glioblastoma Patients with a Dysfunctional Rb1 Pathway in Combination with No Wild-type PTEN
Clin. Cancer Res., September 15, 2003; 9(11): 4151 - 4158.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. J. Gilbertson, D. A. Hill, R. Hernan, M. Kocak, R. Geyer, J. Olson, A. Gajjar, L. Rush, R. L. Hamilton, S. D. Finkelstein, et al.
ERBB1 Is Amplified and Overexpressed in High-grade Diffusely Infiltrative Pediatric Brain Stem Glioma
Clin. Cancer Res., September 1, 2003; 9(10): 3620 - 3624.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Khatua, K. M. Peterson, K. M. Brown, C. Lawlor, M. R. Santi, B. LaFleur, D. Dressman, D. A. Stephan, and T. J. MacDonald
Overexpression of the EGFR/FKBP12/HIF-2{alpha} Pathway Identified in Childhood Astrocytomas by Angiogenesis Gene Profiling
Cancer Res., April 15, 2003; 63(8): 1865 - 1870.
[Abstract] [Full Text] [PDF]


Home page
Neuro OncolHome page
C. B. Knobbe, A. Merlo, and G. Reifenberger
Pten signaling in gliomas
Neuro-oncol, July 1, 2002; 4(3): 196 - 211.
[Abstract] [PDF]


Home page
Clin. Cancer Res.Home page
R. P. Ermoian, C. S. Furniss, K. R. Lamborn, D. Basila, M. S. Berger, A. R. Gottschalk, M. K. Nicholas, D. Stokoe, and D. A. Haas-Kogan
Dysregulation of PTEN and Protein Kinase B Is Associated with Glioma Histology and Patient Survival
Clin. Cancer Res., May 1, 2002; 8(5): 1100 - 1106.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
I. F. Pollack, S. D. Finkelstein, J. Woods, J. Burnham, E. J. Holmes, R. L. Hamilton, A. J. Yates, J. M. Boyett, J. L. Finlay, R. Sposto, et al.
Expression of p53 and Prognosis in Children with Malignant Gliomas
N. Engl. J. Med., February 7, 2002; 346(6): 420 - 427.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. F. Pollack, S. D. Finkelstein, J. Burnham, E. J. Holmes, R. L. Hamilton, A. J. Yates, J. L. Finlay, and R. Sposto
Age and TP53 Mutation Frequency in Childhood Malignant Gliomas: Results in a Multi-institutional Cohort
Cancer Res., October 1, 2001; 61(20): 7404 - 7407.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
J. S. Smith, I. Tachibana, S. M. Passe, B. K. Huntley, T. J. Borell, N. Iturria, J. R. O'Fallon, P. L. Schaefer, B. W. Scheithauer, C. D. James, et al.
PTEN Mutation, EGFR Amplification, and Outcome in Patients With Anaplastic Astrocytoma and Glioblastoma Multiforme
J Natl Cancer Inst, August 15, 2001; 93(16): 1246 - 1256.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
H. Sasaki, M. C. Zlatescu, R. A. Betensky, Y. Ino, J. G. Cairncross, and D. N. Louis
PTEN Is a Target of Chromosome 10q Loss in Anaplastic Oligodendrogliomas and PTEN Alterations Are Associated with Poor Prognosis
Am. J. Pathol., July 1, 2001; 159(1): 359 - 367.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
J. Li, A. Perry, C. D. James, and D. H. Gutmann
Cancer-related gene expression profiles in NF1-associated pilocytic astrocytomas
Neurology, April 10, 2001; 56(7): 885 - 890.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Wen, J. Stolarov, M. P. Myers, J. D. Su, M. H. Wigler, N. K. Tonks, and D. L. Durden
PTEN controls tumor-induced angiogenesis
PNAS, April 10, 2001; 98(8): 4622 - 4627.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Raffel, C.
Right arrow Articles by James, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Raffel, C.
Right arrow Articles by James, C. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online