
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Oncology, Markers, Clinical Correlates |
Departments of Neurosurgery [C. R.], Laboratory Medicine and Pathology [L. F., R. B. J., C. D. J.], and Statistics [J. R. O., P. A-S.], Mayo Clinic and Foundation, Rochester, Minnesota 55905, and Department of Pathology, Washington University School of Medicine, St. Louis, Missouri 63110 [A. P.]
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The majority of work that has been published on PMAs involves the TP53 tumor suppressor gene (5, 6, 7, 8, 9, 10) , and with reference to these studies, there is considerable variation in the reported TP53 mutation rates. This problem is typical of much of the literature dealing with molecular genetics of PMAs; consequently, it is unclear whether the gene alterations associated with the development of adult astrocytomas occur at comparable frequencies in their pediatric counterparts.
This dearth of information concerning the genetic etiology of PMAs is particularly unfortunate because there is no other group of brain tumors for which patient outcome is so poor. With respect to clinical implications, there are at least two major benefits that would likely result from their genetic analysis. The first involves the identification of markers useful for predicting the clinical course of the disease and length of survival. The other involves the ability of molecular genetic investigations to provide insights concerning the fundamental mechanisms of tumor development and, in doing so, provide information about potential therapeutic targets.
With regard to outcome analyses, hundreds of studies have been published that address survival as a function of tumor genotype. For malignant astrocytomas, such studies have generally involved adult tumor cohorts, and the related investigations have usually failed to demonstrate a consistent relationship between tumor genotype and patient survival when the prognostic significance of specific gene alterations is viewed in the context of other clinical parameters. In particular, tumor malignancy grade and patient age are invariably identified as the most reliable predictors of outcome (11 , 12) . It is because of the contribution of increasing age to the decreased survival of adult astrocytoma patients that genetic outcome analyses of PMA patients should be particularly interesting; a comparable age effect is not anticipated in pediatric patients because their overall health condition should not be adversely affected by increasing age.
In association with the preceding considerations, we have examined a relatively large cohort of PMAs for gene alterations that commonly occur in adult astrocytomas. Our results suggest a significant distinction in the molecular etiology of PMAs with respect to their adult counterparts and further indicate that genetic testing of these tumors may be useful for predicting their clinical behavior.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Assessment of Gene Dosage.
Competitive (multiplex) amplifications were performed in 50-µl volumes containing 200 µM of each dNTP, 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 0.001% gelatin, and 1.25 units of Amplitaq Gold (Perkin-Elmer, Foster City, CA) and the following primer (target and reference gene) amounts: (a) 8 and 12 pmol of EGFR and CF primer pairs, respectively; (b) 10 pmol each for CDK4 and DR primer pairs; (c) 13.3 and 6.7 pmol of MDM2 and DR primer pairs, respectively; and (d) 10 pmol each of CDKN2A and APEX primer pairs. Reaction conditions for CDKN2A amplifications were for 43 cycles using a touchdown profile previously described by Burns et al. (13)
. For analysis of EGFR, CDK4, and MDM2 amplification, the PCR profiles were 95°C for 9 min; followed by 43 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min; followed by extension at 72°C for 10 min. With the exception of CDK4, all primer sequences have been described previously (13
, 14)
. For CDK4, the primers used were AGTTCGTGAGGTGGCTTTACTGAGG (forward) and CTCTCATTATTTCCTCAGGGTCCCC (reverse).
Amplification products were separated in 4% agarose gels that were stained in 0.5 µg/ml ethidium bromide for 30 min at room temperature and then destained in deionized water for 30 min before quantitation of band intensities using a Gel Doc 1000 photodocumentation system (Bio-Rad) and its associated software (Molecular Analyst). The procedure used to assess CDKN2A gene dosage is essentially as we have described previously for the detection of PTEN homozygous deletions (15) . In brief, standard curves were generated from a series of samples containing varying proportions of normal DNA mixed with DNA from a glioblastoma cell line having a CDKN2A homozygous deletion (U87; American Type Culture Collection). Normalized CDKN2A signal intensities (CDKN2A:APEX signal ratios) from tumor DNAs were plotted against standard curves, and cases having less than 20% the CDKN2A signal found in normal DNA were scored as having homozygous deletions. EGFR, CDK4, and MDM2 reaction products from tumor DNAs were normalized against the signal produced by the fragment for the internal reference gene, and these ratios were compared against the corresponding ratios derived from normal DNAs and from DNAs extracted from tissue sections of adult astrocytomas that had been previously identified as having either EGFR, CDK4, or MDM2 amplification (16) . Specimens with target:reference gene signal ratios that were more than three times that determined in normal DNAs were scored as having gene amplification (14) .
Preparatory PCR for DNA Sequencing.
To prepare PCR products for sequencing, 1 µl of stock DNAs was amplified in a 50-µl volume containing 20 pmol of forward and reverse primer, 200 µM of each dNTP, 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 0.001% gelatin, 5% DMSO, and 1.25 units of Amplitaq Gold (Perkin-Elmer). Reactions were carried out in a Perkin-Elmer 9600 under the following conditions: 95°C hold for 9 min; followed by 50 cycles of 95°C for 30 s, 55°C or 48°C for 30 s, and 72°C for 1 min; followed by a 10-min hold at 72°C. The primers used for the amplification of PTEN coding sequences (each of the nine exons) and TP53 coding sequences (exons 58) have been described previously (17
, 18)
.
Sequencing.
Sequencing reactions (6.5 µl) were prepared that contained 100 ng of PCR product from the preparatory PCRs, 2 pmol of primer, 18 mM Tris-HCl (pH 9.5), 4.5 mM MgCl2, 2.3 µM cold dNTPs, 0.023 µM[
-33P]dideoxynucleotide triphosphates, and 8 units of ThermoSequenase DNA polymerase (Amersham Life Science, Inc., Arlington Heights, IL). Sequencing reactions were amplified for 30 cycles at 95°C for 20 s, 58°C for 30 s, and 72°C for 1 min using a 1 min ramp time between annealing and elongation phases. After sample denaturation, reaction products were loaded onto a 6% sequencing gel (19:1 acrylamide, 7 M urea, 0.5 x Tris-borate EDTA, and 15% formamide). Electrophoresis was at 75 W at room temperature for 1 h, after which the gels were dried and exposed to Kodak XAR film. Establishment of a tumor mutation was based on the identification of the same sequence alteration in two separate PCR templates generated from the same sample.
Statistical Analysis.
Survival distributions from the date of tissue acquisition were estimated with Kaplan-Meier curves. Comparisons of patient subsets for each clinical or genetic variable were performed using log-rank tests.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
Patients with amplification of CDK4 or a homozygous deletion of the gene encoding the cdk4 inhibitor p16 did not show a significant difference in survival relative to patients whose tumors did not have either of these alterations (P = 0.60; Fig. 2C
). In contrast, the presence of a PTEN mutation (examples are shown in Fig. 3
) was strongly associated with decreased survival among grade 3 and grade 4 tumor patients (P = 0.006; Fig. 2D
).
|
| DISCUSSION |
|---|
|
|
|---|
Gene alterations leading to increased cdk4 activity, either CDKN2A homozygous deletion or CDK4 amplification, have not been examined previously in PMAs. Here these alterations were observed in 17.6% (3 of 17) and 13.3% (2 of 15) of grade 3 and grade 4 tumors, respectively. In previous investigations of adult astrocytomas, CDKN2A homozygous deletion and CDK4 amplification have primarily been identified in grade 3 and grade 4 malignant astrocytomas (27 , 28) , and our data are consistent with these findings because no CDKN2A or CDK4 alterations were identified in grade 2 tumors. As was the case for alterations affecting p53 function, alterations leading to increased cdk4 activity were not predictive of survival for PMA patients.
PTEN mutations were observed in 20% of the grade 4 tumors (3 of 15), 5.9% of the grade 3 tumors (1 of 17), and 0% of the grade 2 tumors. These data are consistent with results associated with the study of adult astrocytomas that indicate that PTEN mutations are highly correlated with increasing malignancy grade and occur primarily in tumors of grade 4 malignancy (29)
. Of the genes examined in this study, mutations of PTEN represent the only alteration that shows a significant association with survival (P = 0.006; Fig. 2D
). The potential importance of this observation is underscored by the lack of prognostic significance associated with grade 3 versus grade 4 malignancy for these tumors (Fig. 2A)
, and these are the only malignancy grades of astrocytoma in which PTEN mutations have been observed. Due to the small size of this series of PMAs, it will be necessary to perform a validation study with a larger cohort of tumors to address the reliability of this finding, as well as the findings involving the other gene alterations we have investigated. It is worth noting, however, that our results involving PTEN are consistent with data presented in a recent study of adult grade 4 astrocytomas that indicate that PTEN deletions are a negative prognostic indicator (30)
.
In comparing the incidence of specific gene alterations in this cohort of PMAs against data published from the study of adult astrocytomas, the only result that supports an important difference between the genetic etiologies of the two groups of tumors concerns the incidence of EGFR amplification. None of the 15 grade 4 or the 17 grade 3 tumors showed evidence of this gene alteration, and this result is significantly different from the results one would anticipate from the analysis of a series of adult astrocytomas having a similar size and malignancy grade composition. Two other studies have reported data from the analysis of EGFR amplification in PMAs. In one study (5) , amplified EGFR was identified in one of four glioblastomas (25%) and in zero of two anaplastic astrocytomas; analysis of this number of specimens did not allow for a meaningful comparison of the frequency of EGFR amplification in adult versus pediatric tumors. In the second study, no EGFR amplifications were observed among 11 anaplastic astrocytomas and 13 glioblastomas (31) . Our data are consistent with the results presented in the latter report because there were no amplifications of EGFR in a combined 32 cases of grade 3 and grade 4 tumors: this finding points to an important difference between the development of pediatric and adult malignant astrocytomas.
The lack of EGFR amplification in these tumors has important implications for the clinical management of PMAs. Several experimental strategies for the treatment of adult malignant astrocytomas are based on the elevated expression of either mutant or wild-type epidermal growth factor receptor (32, 33, 34, 35) ; the results presented here suggest that such therapeutic approaches may not be effective if used on children with malignant astrocytomas. Conversely, it appears as though TP53 mutations occur at similar frequencies in both pediatric and adult astrocytomas and that therapies designed to exploit aberrant p53 function in tumors cells (36) may be effective for treating some of the astrocytic tumors in both age groups.
This investigation was based entirely on the analysis of DNA extracted from paraffin-embedded material because the utilization of this type of tissue does not require a lengthy prospective collection of specimens that should be anticipated for a relatively rare type of tumor. The lack of reference (normal) DNA for such a study is unfortunate because one might expect constitutional genetic lesions to play a significant role in childhood cancer as compared to cancer occurring in an elderly population. For instance, patients with Cowdens syndrome are known to be predisposed to tumor development as a result of inheriting a defective PTEN gene (37) . Although our analysis of clinical information for the four patients with PTEN mutations gave no indication of a familial history of cancer, the possibility of individuals in this study having germ-line PTEN or TP53 mutations persists. However, the need to establish a foundation for understanding of the genetic basis of PMAs offsets the liability associated with the lack of reference DNA, and we have demonstrated that extrapolations from the study of adult astrocytomas can lead to erroneous conclusions regarding the molecular etiology of PMAs. Further determination of both the similarities and differences between pediatric and adult astrocytomas will aid in the development of targeted, individualized therapies that will be of benefit to all individuals afflicted with this type of cancer.
| FOOTNOTES |
|---|
1 Supported in part by National Cancer Institute Grants CA-55728 (to C. D. J.) and CA-50905 (to R. B. J.) and by a grant from the Pediatric Brain Tumor Association of the United States (to C. D. J.). ![]()
2 To whom requests for reprints should be addressed, at Mayo Clinic, 200 First Street SW, Hilton Building, Room 820-D, Rochester, MN 55905. Phone: (507) 284-8989; Fax: (507) 266-5193; E-mail: james.charles{at}mayo.edu ![]()
3 The abbreviations used are: PMA, pediatric malignant astrocytoma; dNTP, deoxynucleotide triphosphate. ![]()
Received 6/14/99; revised 9/ 8/99; accepted 9/10/99.
| REFERENCES |
|---|
|
|
|---|
, and epidermal growth factor and their expression in human gliomas in vivo. Cancer Res., 51: 2164-2172, 1991.This article has been cited by other articles:
![]() |
H. K. Thorarinsdottir, M. Santi, R. McCarter, E. J. Rushing, R. Cornelison, A. Jales, and T. J. MacDonald Protein Expression of Platelet-Derived Growth Factor Receptor Correlates with Malignant Histology and PTEN with Survival in Childhood Gliomas Clin. Cancer Res., June 1, 2008; 14(11): 3386 - 3394. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Warren Pediatric High-grade Gliomas ASCO Educational Book, January 1, 2008; 2008(1): 472 - 477. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Faury, A. Nantel, S. E. Dunn, M.-C. Guiot, T. Haque, P. Hauser, M. Garami, L. Bognar, Z. Hanzely, P. P. Liberski, et al. Molecular Profiling Identifies Prognostic Subgroups of Pediatric Glioblastoma and Shows Increased YB-1 Expression in Tumors J. Clin. Oncol., April 1, 2007; 25(10): 1196 - 1208. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nakamura, K. Shimada, E. Ishida, T. Higuchi, H. Nakase, T. Sakaki, and N. Konishi Molecular pathogenesis of pediatric astrocytic tumors Neuro-oncol, April 1, 2007; 9(2): 113 - 123. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. F. Pollack, R. L. Hamilton, R. W. Sobol, J. Burnham, A. J. Yates, E. J. Holmes, T. Zhou, and J. L. Finlay O6-Methylguanine-DNA Methyltransferase Expression Strongly Correlates With Outcome in Childhood Malignant Gliomas: Results From the CCG-945 Cohort J. Clin. Oncol., July 20, 2006; 24(21): 3431 - 3437. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Reardon, J. N. Rich, H. S. Friedman, and D. D. Bigner Recent Advances in the Treatment of Malignant Astrocytoma J. Clin. Oncol., March 10, 2006; 24(8): 1253 - 1265. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Abdel-Rahman, Y. Yang, X.-P. Zhou, E. L. Craig, F. H. Davidorf, and C. Eng High Frequency of Submicroscopic Hemizygous Deletion Is a Major Mechanism of Loss of Expression of PTEN in Uveal Melanoma J. Clin. Oncol., January 10, 2006; 24(2): 288 - 295. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Broniscer and A. Gajjar Supratentorial High-Grade Astrocytoma and Diffuse Brainstem Glioma: Two Challenges for the Pediatric Oncologist Oncologist, April 1, 2004; 9(2): 197 - 206. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Backlund, B. R. Nilsson, H. M. Goike, E. E. Schmidt, L. Liu, K. Ichimura, and V. P. Collins Short Postoperative Survival for Glioblastoma Patients with a Dysfunctional Rb1 Pathway in Combination with No Wild-type PTEN Clin. Cancer Res., September 15, 2003; 9(11): 4151 - 4158. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Gilbertson, D. A. Hill, R. Hernan, M. Kocak, R. Geyer, J. Olson, A. Gajjar, L. Rush, R. L. Hamilton, S. D. Finkelstein, et al. ERBB1 Is Amplified and Overexpressed in High-grade Diffusely Infiltrative Pediatric Brain Stem Glioma Clin. Cancer Res., September 1, 2003; 9(10): 3620 - 3624. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Khatua, K. M. Peterson, K. M. Brown, C. Lawlor, M. R. Santi, B. LaFleur, D. Dressman, D. A. Stephan, and T. J. MacDonald Overexpression of the EGFR/FKBP12/HIF-2{alpha} Pathway Identified in Childhood Astrocytomas by Angiogenesis Gene Profiling Cancer Res., April 15, 2003; 63(8): 1865 - 1870. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. B. Knobbe, A. Merlo, and G. Reifenberger Pten signaling in gliomas Neuro-oncol, July 1, 2002; 4(3): 196 - 211. [Abstract] [PDF] |
||||
![]() |
R. P. Ermoian, C. S. Furniss, K. R. Lamborn, D. Basila, M. S. Berger, A. R. Gottschalk, M. K. Nicholas, D. Stokoe, and D. A. Haas-Kogan Dysregulation of PTEN and Protein Kinase B Is Associated with Glioma Histology and Patient Survival Clin. Cancer Res., May 1, 2002; 8(5): 1100 - 1106. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. F. Pollack, S. D. Finkelstein, J. Woods, J. Burnham, E. J. Holmes, R. L. Hamilton, A. J. Yates, J. M. Boyett, J. L. Finlay, R. Sposto, et al. Expression of p53 and Prognosis in Children with Malignant Gliomas N. Engl. J. Med., February 7, 2002; 346(6): 420 - 427. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. F. Pollack, S. D. Finkelstein, J. Burnham, E. J. Holmes, R. L. Hamilton, A. J. Yates, J. L. Finlay, and R. Sposto Age and TP53 Mutation Frequency in Childhood Malignant Gliomas: Results in a Multi-institutional Cohort Cancer Res., October 1, 2001; 61(20): 7404 - 7407. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Smith, I. Tachibana, S. M. Passe, B. K. Huntley, T. J. Borell, N. Iturria, J. R. O'Fallon, P. L. Schaefer, B. W. Scheithauer, C. D. James, et al. PTEN Mutation, EGFR Amplification, and Outcome in Patients With Anaplastic Astrocytoma and Glioblastoma Multiforme J Natl Cancer Inst, August 15, 2001; 93(16): 1246 - 1256. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sasaki, M. C. Zlatescu, R. A. Betensky, Y. Ino, J. G. Cairncross, and D. N. Louis PTEN Is a Target of Chromosome 10q Loss in Anaplastic Oligodendrogliomas and PTEN Alterations Are Associated with Poor Prognosis Am. J. Pathol., July 1, 2001; 159(1): 359 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, A. Perry, C. D. James, and D. H. Gutmann Cancer-related gene expression profiles in NF1-associated pilocytic astrocytomas Neurology, April 10, 2001; 56(7): 885 - 890. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wen, J. Stolarov, M. P. Myers, J. D. Su, M. H. Wigler, N. K. Tonks, and D. L. Durden PTEN controls tumor-induced angiogenesis PNAS, April 10, 2001; 98(8): 4622 - 4627. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |