Clinical Cancer Research CR Surrogrates Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, Z.-P.
Right arrow Articles by Panasci, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Z.-P.
Right arrow Articles by Panasci, L. C.
Clinical Cancer Research Vol. 5, 4186-4190, December 1999
© 1999 American Association for Cancer Research

Experimental Therapeutics, Preclinical Pharmacology

Extraneuronal Monoamine Transporter Expression and DNA Repair Vis-à-Vis 2-Chloroethyl-3-sarcosinamide-1-nitrosourea Cytotoxicity in Human Tumor Cell Lines1

Zhong-Ping Chen, Joanna Remack, Thomas P. Brent, Gérard Mohr and Lawrence C. Panasci2

Lady Davis Institute for Medical Research, Sir Mortimer B. Davis-Jewish General Hospital, Montreal, Quebec, Canada H3T 1E2 [Z. P. C., G. M., L. C. P.], and Department of Molecular Pharmacology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105-2794 [J. R., T. P. B.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We previously found that 2-chloroethyl-3-sarcosinamide-1-nitrosourea (SarCNU), a new chloroethylnitrosourea analogue presently in phase I clinical trials, is a selective cytotoxin that enters cells via the extraneuronal transporter for monoamine transmitters (EMT). In this study, we assessed whether EMT expression correlates with SarCNU cytotoxicity by determining EMT expression in 23 human tumor cell lines with reverse-transcription PCR. Western blot analysis was used to measure protein levels of the DNA repair genes, O6-methylguanine-DNA methyltransferase (MGMT), and excision repair cross-complementing rodent repair deficiency gene 2 (ERCC2). SarCNU cytotoxicity was determined by the sulforhodamine B colorimetric anticancer-drug screening assay and correlated with gene expression. Almost all of the cell lines screened were positive for EMT expression. However, seven cell lines (MGR-1, MGR-2, T98-G, SKI-1, SKNSH, 297, and GBM) expressed low levels of EMT. Although there was no linear correlation between SarCNU cytotoxicity and EMT expression, SarCNU cytotoxicity significantly correlated with ERCC2 protein levels, and MGMT-rich (Mer+) cell lines (MGMT protein level >0.1) were more resistant to SarCNU than MGMT-poor (Mer-) cell lines (MGMT protein level <0.1). Moreover, multiple regression analysis indicated that the best correlation with SarCNU cytotoxicity was attainable with EMT plus MGMT and ERCC2 expression. This study suggests that in human tumor cell lines both EMT and DNA repair factors, specifically, MGMT and ERCC2, are important determinants of SarCNU activity. Because EMT is expressed in a wide variety of human tumors, SarCNU should be a more widely effective alternative chemotherapeutic agent.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Nitrosoureas, such as BCNU3 and 1-(2-chloroethyl)-3- cyclohexyl-1-nitrosourea, have long been used as standard chemotherapeutic compounds, specifically for the treatment of central nervous system tumors (1) . However, their clinical usefulness is restricted by dose-related toxicity that produces delayed and cumulative myelosuppression (2) . In the search for novel analogues with increased antitumor activity and decreased toxicity, SarCNU, a novel derivative of CENU, was found to have interesting characteristics (3) . SarCNU contains an amino acid amide group (4) , N-methylglycinamide, known as sarcosinamide, that allows the drug to enter cells via the EMT, i.e., extraneuronal noradrenaline transporter or uptake2, which has recently been characterized molecularly (5) .

Our previous in vitro and in vivo studies demonstrated that SarCNU was more effective than BCNU against human gliomas (6, 7, 8, 9) . Using the relatively SarCNU-resistant SKI-1 human glioma cell line and the SarCNU-sensitive SKMG-1 human glioma cell line, we previously demonstrated that SarCNU uptake was more rapid and was saturable in the SKMG-1 cells (10) . Furthermore, the characteristic of SarCNU uptake suggested that drug uptake was via the EMT (11) . However, the relationship between EMT expression and SarCNU activity in human tumors has of yet to be clarified. In the present study, using reverse transcription-PCR, we determined human EMT expression for 23 human tumor cell lines. Because DNA repair has been related to CENU resistance in human tumors (12 , 13) , we thus also determined DNA repair protein levels, specifically MGMT and the NER gene ERCC2, and correlated these factors to SarCNU cytotoxicity.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines.
Twenty-three established human tumor cell lines were used in this study: SF-295, HT-29, ACHN, A-498, 786-0, CAKI-1, SW-620, and SF-767 (National Cancer Institute, Bethesda, MD); T98-G (Dr. D. Yarosh, Applied Genetics Inc., New York, NY); SKMG-1 and SKMG-4 (Dr. G. Cairncross, University of Western Ontario, Ontario, Canada); SKI-1 (Dr. J. Shapiro, Barrow Neurological Institute, Phoenix, AZ); UWR-7, UW-28, MGR-1, MGR-2, and MGR-3 (Dr. F. Ali-Osman, University of Texas M.D. Anderson Cancer Center, Houston, TX); SKNSH (Dr. E. Shoubridge, Montreal Neurological Institute, Montreal, Canada); MCF-7 (Dr. Gerald Batist, Jewish General Hospital, Montreal, Canada); SHG-44, GBM, and 297 (Dr. Q. Huang, Suzhou Medical College, Suzhou Peoples Republic of China), and HepG2. All cell lines were grown and maintained as cell monolayers in appropriate medium (McCoy’s 5A supplemented with 10% FBS, RPMI 1640 supplemented with 5% FBS, or DMEM supplemented with 10% FBS), containing 10 µg/ml gentamicin, in a humidified 5% CO2 atmosphere at 37°C.

SRB Cytotoxicity Assay.
SarCNU cytotoxicity was determined using a modified SRB colorimetric anticancer-drug screening assay (14) . Briefly, appropriate amounts of cells were seeded onto 24-well flat-bottomed plates in 0.5 ml of medium. After a 16-h incubation (day 2), the cells were treated with different concentrations of SarCNU (dissolved in 1 mM sodium citrate, pH 4). On day 4, 1.5 ml of medium was added to each well, followed by incubation for 4 more days at 37°C, 5% CO2. The medium was then aspirated, and cells were fixed onto the plastic substructure by the addition of 1 ml of 10% trichloroacetic acid in 0.9% NaCl and incubation for 1 h at 4°C. The plates were washed five times with water to remove trichloroacetic acid and air-dried for at least 1 h. This was followed by staining with 1 ml of 0.4% SRB in 1% acetic acid for 30 min at room temperature, washing five times with 1% acetic acid to remove unbound dye, and subsequently air-drying. Bound dye was solubilized with 2 ml of 10 mM unbuffered Tris base (pH 10.5). Absorbance was read using a spectrophotometer at 540 nm, and the IC90 in µM was obtained by exponential curve fit of the linear portion of the cytotoxicity curve using CA-Cricket Graph III version 1.01 (Computer Associates International, Inc., Islandia, NY).

Determination of EMT Expression.
RT-PCR was used to determine EMT expression in the cell lines. Total RNA was extracted using the RNeasy Midi Kit (Qiagen Inc., Valencia, CA) following manufacturer’s protocol. The cDNA was synthesized as described previously (13 , 14) . Primers for the EMT PCR reaction were designed by Steve Rozen and Helen J. Skaletky (1996–1997) using the primer 3 program and synthesized by Canadian Life Technologies (Burlington, ON). The left primer spun from positions 631 to 650 (5'-3', gcaccaaacttccctgtgtt), and the right primer spun from positions 963 to 944 (5'-3', agcaatgcgtctcaggatct). The PCR reaction was performed in a total volume of 50 µl consisting of 2.5 µl of 2.5 mM dNTPs, 2 units of DNA polymerase AmpliTaq (Pharmacia), 20 pmol of each primer, and 2 µl of 1st strand cDNA (reverse transcribed from 0.2 µg of total RNA) in 1x PCR buffer (Pharmacia). The PCR cycle comprised 35 cycles of denaturation at 94°C for 1 min, annealing at 160°C for 30 s, and elongation at 72°C for 45 s and was run using a PTC-100TM programmable thermal controller (MJ Research Inc., Watertown, MA). {beta}-Actin expression was determined as described previously and was used for normalization (13 , 14) . The PCR products were run on 1% agarose gel and were quantitated with the Scion Image program using an HP ScanJet 5100C Scanner (Hewlett Packard Company, Greeley, Colorado). EMT expression for each cell line was determined by dividing the EMT absorbance value by the {beta}-actin absorbance value. Both EMT and {beta}-actin were in the linear range of PCR amplification. The EMT expression results are the mean of three separate determinations.

Determination of DNA Repair Protein.
DNA repair protein MGMT and protein levels coded by one of the NER genes, ERCC2, were detected by Western blotting as described previously (15) . Similarly, {alpha}-tubulin expression was determined. For each cell line, gene expression was normalized by dividing by {alpha}-tubulin expression.

Statistical Analysis.
The correlation between gene expression and SarCNU cytotoxicity was analyzed using linear regression (StatView 512+ version 1.2). Multiple linear regression analysis that improved P were sought. For MGMT expression, the cell lines were divided into two groups, MGMT-rich (Mer+) and MGMT-poor (Mer-). The SarCNU cytotoxicity for the Mer+ and Mer- groups was analyzed using Student’s t test.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
EMT Expression in Human Tumor Cell Lines.
Almost all of the cell lines screened tested positive for EMT expression, although seven cell lines (MGR-1, MGR-2, T98-G, SKI-1, SKNSH, 297, and GBM) were very low EMT expressers (Fig. 1)Citation . Eighteen of 23 cell lines with corresponding SarCNU cytotoxicity data were used in linear regression analysis (Table 1)Citation . The human hepatoma cell line HepG2 expresses high levels of EMT and thus was used as a positive control.



View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Human EMT expression in 23 human tumor cell lines. A 1% agarose gel shows the 333-bp EMT PCR product and the 315-bp {beta}-actin PCR product.

 

View this table:
[in this window]
[in a new window]

  		Table 1 Screening of a panel of 18 human tumor cell lines for SarCNU cytotoxicity and ERCC2, MGMT, and EMT gene expression

 
DNA Repair Protein Expression in Human Tumor Cell Lines.
MGMT and ERCC2 protein levels in 18 human tumor cell lines as determined by Western blot analysis are listed in Table 1Citation (each value represents the mean of at least three separate experiments). The protein levels of MGMT and ERCC2 as determined by Western blot analysis correlates with the mRNA levels (r = 0.888; P = 0.0001 for MGMT; and r = 0.674, P = 0.0022 for ERCC2). The mRNA levels for MGMT and ERCC2 were determined by using the same reverse transcription-PCR technique used in this study for determination of EMT expression (data not show).

SarCNU Cytotoxicity.
The SarCNU cytotoxicity in 18 human tumor cell lines was expressed as the IC90 (µM). Each value corresponds to the mean of at least three separate experiments (Table 1)Citation .

Comparison of EMT Expression with SarCNU Cytotoxicity in Tumor Cell Lines.
There was no significant linear correlation between SarCNU cytotoxicity and EMT expression in 18 tumor cell lines. We previously have demonstrated that both MGMT and ERCC2 contribute to BCNU drug resistance in human tumors (13 , 14 , 16 , 17) . In the present study, SarCNU cytotoxicity significantly correlated with ERCC2 protein levels but failed to correlate with MGMT protein levels (Table 2)Citation . However, Mer+ cell lines (MGMT protein level >0.1) were more resistant to SarCNU than Mer- cell lines (MGMT protein level <0.1; IC90: Mer+, 222.1 ± 45.5 µM; Mer-, 63.9 ± 22.8 µM; t = 3.15; P = 0.003). Moreover, EMT and MGMT improved the correlation between SarCNU cytotoxicity and ERCC2, and the best correlation was generated using all three factors (Table 2)Citation .


View this table:
[in this window]
[in a new window]

  		Table 2 Correlation between SarCNU cytotoxicity and gene expression in 18 human tumor cell lines

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
EMT uptake activity has been determined for four human tumor cell lines: SKI-1, SF-295, SKMG-1, and CAKI-1 (5 , 10 , 11) ; 4 the activity levels were nondetectable, borderline, high, and high, respectively. Unfortunately, at present we are not able to determine protein levels for EMT because the antibody is not yet available. However, the PCR result of EMT expression in these cell lines as determined in this study correlates with their pump activity. Grundemann et al. (5) demonstrated that EMT cDNA transfected into the EMT-negative cell line 293 increased the uptake of known substrates of EMT.

Our previous in vitro and in vivo studies demonstrated that SarCNU was more effective than BCNU in human tumors (6, 7, 8, 9) . Using transport studies with radiolabeled SarCNU, we demonstrated that the uptake and accumulation of SarCNU in SKMG-1 cells are significantly greater than in SKI-1 cells, which corresponded with their EMT expression and correlated with the increased sensitivity of SK-MG-1 cells to SarCNU compared with SKI-1 cells (10 , 11) . SarCNU antitumor activity was also evaluated in vivo with the human glioma xenografts, SF-295, U-251, and SHG-44 (8 , 9) . SarCNU was more effective than BCNU against these tumors, which have been confirmed to be EMT positive, suggesting that EMT is important in the in vivo response to SarCNU.

In the present investigation, we did not find a linear correlation between SarCNU cytotoxicity and EMT expression. This suggests that EMT expression is not the dominant factor in SarCNU cytotoxicity. However, multiple regression analysis demonstrated that the best correlation was generated with EMT expression plus MGMT and ERCC2 expression, indicating that both DNA repair (MGMT and ERCC2) and EMT are important in determining the sensitivity to SarCNU. It has been documented by both laboratory and clinical evidence that MGMT plays an important role in CENU drug resistance (12 , 18, 19, 20, 21) . We have also demonstrated that NER, specifically ERCC2, expression correlates with CENU resistance in human tumor cell lines (13 , 14 , 16) . In the present study, we found a significant correlation between ERCC2 protein levels and SarCNU cytotoxicity, and Mer+ cell lines were more resistant to SarCNU than Mer- cell lines. It thus seems that the absence of a linear correlation between SarCNU cytotoxicity and EMT expression in these human tumor cell lines may be due, at least in part, to the presence of DNA repair factors such as MGMT and ERCC2. Thus, whereas MGMT and ERCC2 decrease SarCNU activity by repairing damaged DNA, the presence of EMT appears to increase SarCNU activity. This suggests that EMT is an important determinant of SarCNU activity, possibly by enhanced cellular uptake via EMT and thus higher intracellular SarCNU levels.

The EMT exists in various cells, including glia cells of the human central nervous system and some tumor cells (5 , 22) . In this panel of 23 human tumor cell lines of different origin, the majority (~70%) are EMT-high expressers. We recently also examined 30 primary human brain tumor specimens for EMT expression and found that only 3 samples have no detectable EMT expression.5 Because the majority of human tumors express EMT, SarCNU should be a more widely effective alternative chemotherapeutic agent. The presence of the EMT could serve as a marker to identify cancer patients who may be potential responders to SarCNU in the clinic. This bears direct clinical relevance because SarCNU is in phase I clinical trials.


   ACKNOWLEDGMENTS
 
This work was presented in part at the 90th annual meeting of the American Association for Cancer Research, April 10–14, 1999, in Philadelphia, PA. We thank Areti Malapetsa for editorial assistance with this manuscript.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by NCI (USA) Grant RO3-CA 78205-01 and a private donation from Helen and Nicki Lang. Back

2 To whom requests for reprints should be addressed, at Lady Davis Institute for Medical Research, Sir Mortimer B. Davis-Jewish General Hospital, McGill University, 3755 Côte Ste Catherine, Montreal, Quebec, H3T 1E2, Canada. Phone: (514) 340-8260, ext. 5281; Fax: (514) 340-7502; E-mail: Lpanasci{at}hotmail.com Back

3 The abbreviations used are: BCNU, 1, 3-bis(2-chloroethyl)-1-nitrosourea; SarCNU, 2-chloroethyl-3-sarcosinamide-1-nitrosourea; CENU, chloroethylnitrosourea; EMT, extraneuronal transporter for monoamine transmitters; MGMT, O6-methylguanine-DNA methyltransferase; NER, nucleotide excision repair; FBS, fetal bovine serum; SRB, sulforhodamine B; IC90, inhibitory concentration leading to 90% cell death. Back

4 Zhong-Ping Chen and Lawrence C. Panasci, unpublished data. Back

5 Zhong-Ping Chen and Lawrence C. Panasci, unpublished data. Back

Received 7/29/99; revised 9/23/99; accepted 9/23/99.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lesser G. J., Grossman S. The chemotherapy of high-grade astrocytomas. Semin. Oncol., 21: 220-235, 1994.[Medline]
  2. Carter S. K., Schabel F. M., Jr., Broder L. E., Johnston T. P. 1,3-Bis(2-chloroethyl)-1-nitrosourea (BCNU) and other nitrosoureas in cancer treatment: a review. Adv. Cancer Res., 16: 273-332, 1972.[Medline]
  3. Panasci L. C., Marcantonio D., Noë A. J. SarCNU (2-chloroethyl-3-sarcosinamide-1-nitrosourea): a novel analogue of chloroethylnitrosourea that is transported by the catecholamine uptake2 carrier, which mediates increased cytotoxicity. Cancer Chemother. Pharmacol., 37: 505-508, 1996.[Medline]
  4. Suami T., Kato T., Takino H., Hisamatsu T. (2-Chloroethyl) nitrosourea congeners of amino acid amides. J. Med. Chem., 25: 829-832, 1982.[Medline]
  5. Grundemann D., Schechinger B., Rappold G. A., Schomig E. Molecular identification of the corticosterone-sensitive extraneuronal catecholamine transporter. Nat. Neurosci., 1: 349-351, 1998.[Medline]
  6. Skalski V., Rivas J., Panasci L., McQuillan A., Feindel W. The cytotoxicity of sarcosinamide chloroethylnitrosourea (SarCNU) and BCNU in primary gliomas and glioma cell lines: analysis of data in reference to theoretical peak plasma concentrations in man. Cancer Chemother. Pharmacol., 22: 137-140, 1988.[Medline]
  7. Panasci L. C., Dufour M., Chevalier L., Isabel G., Lazarus P., McQuillan A., Arbit E., Brem S., Feindel W. Utilization of the HTSCA and CFU-C assay to identify two new 2-chloroethylnitrosourea congeners of amino acid amides with increased in vitro activity against human glioma compared with BCNU. Cancer Chemother. Pharmacol., 14: 156-159, 1985.[Medline]
  8. Marcantonio D., Panasci L. C., Hollingshead M. G., Alley M. C., Camalier R. F., Sausville E. A., Dykes D. J., Carter C. A., Malspeis L. 2-Chloroethyl-3-sarcosinamide-1-nitrosourea a novel chloroethylnitrosourea analogue with enhanced antitumor activity against human glioma xenografts. Cancer Res., 57: 3895-3898, 1997.[Abstract/Free Full Text]
  9. Chen, Z. P., Wang, G., Huang, Q., Sun, Z. F., Zhou, L. Y., Wang, A. D., and Panasci, L. C. Enhanced antitumor activity of SarCNU in comparison to BCNU in an extraneuronal monoamine transporter positive human glioma xenograft model. J. Neuro-oncol., in press, 1999.
  10. Noë A. J., Malapetsa A., Panasci L. C. Altered cytotoxicity of (2-chloroethyl)-3-sarcosinamide-1-nitrosourea in human glioma cell lines SK-MG-1 and SKI-1 correlates with differential transport kinetics. Cancer Res., 54: 1491-1496, 1994.[Abstract/Free Full Text]
  11. Noë A. J., Marcantonio D., Barton J., Malapetsa A., Panasci L. C. Characterization of the catecholamine extraneuronal uptake2 carrier in human glioma cell lines SK-MG-1 and SKI-1 in relation to (2-chloroethyl)-3-sarcosinamide-1-nitrosourea (SarCNU) selective cytotoxicity. Biochem. Pharmacol., 51: 1639-1648, 1996.[Medline]
  12. Brent T. P., Houghton P. J., Houghton J. A. O6-Alkylguanine-DNA alkyltransferase activity correlates with the therapeutic response of human rhabdomyosarcoma xenografts to 1-(2-chloroethyl)-3-(trans-4-methylcyclohexyl)-1-nitrosourea. Proc. Natl. Acad. Sci. USA, 82: 2985-2989, 1985.[Abstract/Free Full Text]
  13. Chen Z. P., Malapetsa A., Marcantonio D., Mohr G., Brien S., Panasci L. C. Correlation of chloroethylnitrosourea resistance with ERCC-2 expression in human tumor cell lines as determined by quantitative competitive polymerase chain reaction. Cancer Res., 56: 2475-2478, 1996.[Abstract/Free Full Text]
  14. Chen Z. P., McQuillan A., Mohr G., Panasci L. C. Excision repair cross-complementing rodent repair deficiency gene 2 expression and chloroethylnitrosourea resistance in human glioma cell lines. Neurosurgery, 42: 1112-1119, 1998.[Medline]
  15. Chen Z. P., Malapetsa A., Mohr G., Brien S., Panasci L. C. Quantitation of ERCC-2 gene expression in human tumor cell lines by reverse transcription-polymerase chain reaction in comparison to northern blot analysis. Anal. Biochem., 244: 50-54, 1997.[Medline]
  16. Chen Z. P., Malapetsa A., McQuillan A., Marcantonio D., Bello V., Mohr G., Remack J., Brent T. P., Panasci L. C. Evidence for nucleotide excision repair as a modifying factor of O6-methylguanine-DNA methyltransferase-mediated innate chloroethylnitrosourea resistance in human tumor cell lines. Mol. Pharmacol., 52: 815-820, 1997.[Abstract/Free Full Text]
  17. Chen Z. P., Yarosh D., Garcia Y., Tampieri D., Langleben A., Mohr G., Malapetsa A., Panasci L. C. Relationship between O6-methylguanine-DNA methylferase levels and clinical response induced by chloroethylnitrosourea therapy in glioma patients. Can. J. Neurol. Sci., 26: 104-109, 1999.[Medline]
  18. Mitchell R. B., Moschel R. C., Dolan M. E. Effect of O6-benzylguanine on the sensitivity of human tumor xenografts to 1,3-bis(2-chloroethyl)-1-nitrosourea and on DNA interstrand cross-link formation. Cancer Res., 52: 1171-1175, 1992.[Abstract/Free Full Text]
  19. Phillips W. P., Jr., Willson J. K., Markowitz S. D., Zborowska E., Zaidi N. H., Liu L., Gordon N. H., Gerson S. L. O6-methylguanine-DNA methyltransferase (MGMT) transfectants of a 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU)-sensitive colon cancer cell line selectively repopulate heterogeneous MGMT+/MGMT- xenografts after BCNU and O6-benzylguanine plus BCNU. Cancer Res., 57: 4817-4823, 1997.[Abstract/Free Full Text]
  20. Jaeckle K. A., Eyre H. J., Townsend J. J., Schulman S., Knudson H. M., Belanich M., Yarosh D. B., Bearman S. I., Giroux D. J., Schold S. C. Correlation of tumor O6-methylguanine-DNA methyltransferase levels with survival of malignant astrocytoma patients treated with bis-chloroethylnitrosourea: a Southwest Oncology Group study. J. Clin. Oncol., 16: 3310-3315, 1998.[Abstract]
  21. Belanich M., Pastor M., Randall T., Guerra D., Kibitel J., Alas L., Li B., Citron M., Wasserman P., White A., Eyre H., Jaeckle K., Schulman S., Rector D., Prados M., Coons S., Shapiro W., Yarosh D. Retrospective study of the correlation between the DNA repair protein alkyltransferase and survival of brain tumor patients treated with carmustine. Cancer Res., 56: 783-788, 1996.[Abstract/Free Full Text]
  22. Streich S., Bruss M., Bonisch H. Expression of the extraneuronal monoamine transporter (uptake2) in human glioma cells. Naunyn-Schmiedebergs Arch. Pharmacol., 353: 328-333, 1996.[Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
J. Jiang, X. Chen, J. Shen, Y. Wei, T. Wu, Y. Yang, H. Wang, H. Zong, J. Yang, S. Zhang, et al.
beta1,4-Galactosyltransferase V Functions as a Positive Growth Regulator in Glioma
J. Biol. Chem., April 7, 2006; 281(14): 9482 - 9489.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
F. Giles, D. Thomas, G. Garcia-Manero, S. Faderl, J. Cortes, S. Verstovsek, A. Ferrajoli, S. Jeha, M. Beran, C. Koller, et al.
A Phase I and Pharmacokinetic Study of VNP40101M, a Novel Sulfonylhydrazine Alkylating Agent, in Patients with Refractory Leukemia
Clin. Cancer Res., May 1, 2004; 10(9): 2908 - 2917.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
L. Panasci, S.F. Stinson, D. Melnychuk, V. Sandor, W.H. Miller Jr, G. Batist, F. Patenaude, N. Bangash, L. Panarello, M. Alaoui-Jamali, et al.
SarCNU, a Nitrosourea Analog on a Day 1, 5, and 9 Oral Schedule: A Phase I and Pharmacokinetic Study in Patients With Advanced Solid Tumors
J. Clin. Oncol., January 15, 2003; 21(2): 232 - 240.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
Z.-P. Chen, Z.-M. Wang, C. A. Carter, M. C. Alley, G. Mohr, and L. C. Panasci
Both Extraneuronal Monoamine Transporter and O6-Methylguanine-DNA Methyltransferase Expression Influence the Antitumor Efficacy of 2-Chloroethyl-3-sarcosinamide- 1-nitrosourea in Human Tumor Xenografts
J. Pharmacol. Exp. Ther., March 1, 2001; 296(3): 712 - 715.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, Z.-P.
Right arrow Articles by Panasci, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Z.-P.
Right arrow Articles by Panasci, L. C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online