Clinical Cancer Research Grants Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, W.
Right arrow Articles by Gorlick, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, W.
Right arrow Articles by Gorlick, R.
Clinical Cancer Research Vol. 5, 621-627, March 1999
© 1999 American Association for Cancer Research

Molecular Oncology, Markers, Clinical Correlates

Mechanisms of Methotrexate Resistance in Osteosarcoma1

Wei Guo, John H. Healey, Paul A. Meyers, Marc Ladanyi, Andrew G. Huvos, Joseph R. Bertino and Richard Gorlick2

Departments of Surgery, Orthopaedic Service [W. G., J. H. H.], Pediatrics [P. A. M., R. G.], Human Genetics [M. L.], Pathology [M. L., A. G. H.], and Molecular Pharmacology and Experimental Therapeutics [J. R. B.], Memorial Sloan-Kettering Cancer Center, New York, New York 10021


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
High-dose methotrexate is a major component of current protocols for the treatment of osteosarcoma, but some tumors seem to be resistant. Potential mechanisms of resistance include decreased transport through the reduced folate carrier (RFC) and increased expression of dihydrofolate reductase (DHFR). To investigate methotrexate resistance, tumors were obtained from 42 patients with high-grade osteosarcoma. RFC and DHFR mRNA expression were studied by semiquantitative reverse transcription-PCR. The RFC and DHFR genes were studied for deletions and amplification by Southern blot. Thirteen of 20 (65%) osteosarcoma samples were found to have decreased RFC expression at the time of initial biopsy. At definitive surgery and relapse, 10 of 22 (45%) were found to have decreased RFC expression. Seventeen of 26 (65%) samples with a poor response to chemotherapy had decreased RFC expression, whereas 5 of 14 (36%) samples with a good response had a decrease (P = 0.03). None of the samples had an RFC gene deletion. Two of 20 samples (10%) showed increased DHFR expression at initial biopsy. The frequency of increased DHFR expression was significantly higher in metastatic or recurrent tumors (62%, P = 0.014). None of the samples showed evidence of DHFR gene amplification. The high frequency of decreased RFC expression in the biopsy material suggests that impaired transport of methotrexate is a common mechanism of intrinsic resistance in osteosarcoma. Increased DHFR expression in the pulmonary metastases may be a mechanism of acquired methotrexate resistance or a difference between primary and metastatic lesions.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
OS3 is the most common primary malignant bone tumor, mainly occurring in children and adolescents. Five-year disease-free survival has increased to >60% with current protocols, including a combination of limb salvage surgery and neoadjuvant chemotherapy (1 , 2) . High-dose MTX with leucovorin rescue is a major component of current protocols for the treatment of OS (1, 2, 3, 4) .

MTX is a potent inhibitor of DHFR, a key enzyme for intracellular folate metabolism, which functions to regenerate tetrahydrofolate from dihydrofolate (5) . In experimental systems, resistance to MTX can occur through a variety of mechanisms, including impaired transport of drug into the cell via the RFC, an increase in DHFR due to gene amplification or increased transcription, and diminished intracellular retention secondary to decreased polyglutamylation (5) . In patients with acute myelocytic leukemia, a disease in which MTX is ineffective, the basis of intrinsic resistance is primarily a result of impaired polyglutamylation leading to lack of drug retention (6) . In patients with relapsed acute lymphocytic leukemia, impaired transport and DHFR amplification are the common mechanisms of acquired resistance (7, 8, 9, 10) .

Although high-dose MTX is frequently used in the treatment of OS, conventional dose therapy is ineffective. Several retrospective studies have suggested that a threshold peak MTX level needs to be achieved to obtain a good histological response to chemotherapy (11, 12, 13, 14) . This relationship suggests OS is intrinsically resistant to conventional doses of MTX that may be overcome by the use of very high doses. To date, little information is available concerning intrinsic or acquired mechanisms of MTX resistance in this disease (15) .

Our hypothesis is that alterations in transport through decreased RFC expression and increased DHFR expression are mechanisms of intrinsic and acquired MTX resistance in OS. These measures relate to patient outcome through determining the tumor’s response or resistance to chemotherapy. We have initially focused on the measurement of RFC and DHFR mRNA expression in fresh tumor samples by semiquantitative RT-PCR. The deletion or amplification of these genes was measured by quantitative Southern blot. Results of these assays are correlated with the histological response of the tumor to preoperative chemotherapy to determine their potential role as prognostic indicators.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Materials.
Tumor samples were obtained at a single institution after obtaining written informed consent according to a protocol approved by the Memorial Hospital Institutional Review Board. All samples were confirmed to have a pathological diagnosis of high grade OS. A total of 42 specimens of OS were obtained from 1990 to 1995. The samples were obtained at the time of initial biopsy (n = 20), excision of the primary lesion which is an en bloc resection following a period of neoadjuvant chemotherapy (n = 13), and at recurrence (n = 8). Of the recurrent samples, six were pulmonary metastases and two were local recurrences. Of the eight patients with recurrent samples, all had received planned chemotherapy before relapse. The majority of patients were treated on the Memorial Sloan-Kettering T12 protocol or the pediatric Intergroup Phase III clinical trial, both of which have been described elsewhere (2 , 16) . Both of these protocols include multiple courses of high-dose MTX therapy. High-dose MTX is administered at a dose of 12 g/m2 over 4 h, with leucovorin rescue initiated at 24 h. Most patients received four courses of MTX in addition to other chemotherapy, prior to excision of the primary lesion, which occurred 7–12 weeks after initial biopsy. Histological response to preoperative chemotherapy was determined by a single pathologist using the Huvos grading system as described previously (17 , 18) . Briefly, grade I indicates no evidence of necrosis, grade II indicates areas of necrotic material with other areas of histologically viable tumor, grade III indicates only scattered foci of viable tumor seen, and grade IV indicates no viable tumor seen in extensive sampling. Numerous studies have confirmed the histological response to preoperative chemotherapy as a prognostic indicator in OS, with patients having a grade III or IV histological response to preoperative chemotherapy having a significantly better event-free survival than patients with a grade I or II histological response (1 , 2 , 4 , 12 , 18) . Most samples at the time of excision with a grade III or IV histological response were excluded because a piece of viable tumor tissue could not be identified for analysis.

RNA and DNA Preparation.
All tumor tissues were snap-frozen in liquid nitrogen immediately after resection. Total RNA was isolated from the frozen tumor tissue using acid guanidinium-isothiocyanate (Tel-Test, Friendswood, TX), followed by phenol-chloroform extraction and isopropanol precipitation. RNA was resuspended in diethylpyrocarbonate-water, quantitated spectrophotometrically, and stored at -70°C. Genomic DNA from these samples was isolated by standard methods and quantitated spectrophotometrically (19) .

Semiquantitative RT-PCR.
The PCR primers for RFC, DHFR, and actin were synthesized by Operon Technologies (Alameda, CA), according to sequences published previously (8 , 20) . The RFC primers used were as follows: RFC617, 5'-CCAAGCGCAGCCTCTTCTTCAACC; and RFC949, 5'-CCAGCAGCGTGGAGGCAGCATCTGCC, which produce an ~300-bp PCR product. The DHFR primers used were as follows: DHFR130, 5' GTAGAAGGTAAACAGAATCTG; and DHFR505, 3'AGAACACCTGGGTATTCTGG. One µg of total RNA was reverse transcribed in a volume of 20 µl with 100 units of Superscript II RT (Life Technologies, Inc., Gaithersburg, MD) and 20 units of RNase inhibitor (Boehringer Mannheim, Indianapolis, IN) at 42°C for 60 min with random primers. After reverse transcription, the enzymes and first-strand cDNA were denatured at 95°C for 5 min and then chilled on ice for 5 min. Each cDNA sample was serially diluted with water as follows: 1:10, 1:102, 1:103, 1:104, and 1:105 and added to a reaction mix including AmpliTaq DNA polymerase (Perkin-Elmer Cetus, Norwalk, CT), deoxynucleotide triphosphate, buffer, [32P]dCTP, and each set of primers in a final volume of 25 µl. Amplification proceeded for 35 cycles of denaturation at 94°C for 1 min, annealing for 1 min, and elongation at 72°C for 1 min, with a final extension at 72°C for 5 min. The annealing temperature was different for each set of primers (RFC at 55°C and DHFR and actin at 60°C). Actin primers were used as a control for the amount of cDNA. The PCR products were electrophoresed on a 6% polyacrylamide gel subsequently dried on a gel dryer. The dried gel was exposed to a film overnight. RFC and DHFR expression was calculated by determining the ratio of RFC and DHFR relative to actin mRNA for each sample. A negative control in which no cDNA was added was included with each sample.

Southern Blot.
Aliquots (~10 µg) of DNA were digested with EcoRI at 37°C for 5 to 20 h, separated on 0.9% agarose gels, and transferred onto nylon membranes using standard methodologies (21) . After UV cross-linking for 5 min, the blots were prehybridized for at least 1 h and subsequently hybridized with a full-length DHFR or RFC cDNA probe, which was digested from a plasmid (RFC plasmid obtained as a kind gift from Wayne Flintoff, University of Western Ontario, London, Ontario, Canada). The cDNA was radiolabeled with [32P]dCTP to a high specific activity using the random primer technique. The filters were washed at high stringency and directly scanned using a phosphor imager (Bio-Rad, Hercules, CA). The D12S2 probe was used as a loading control.

Statistical Analysis.
A {chi}2 test was used to evaluate the difference between two variables.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Adequate RNA and DNA were obtained from 42 OS tumor samples. All tissue was confirmed by routine histological staining to be comprised of at least 80% tumor cells. The clinical data are summarized in Table 1Citation . As mentioned previously, the majority of excision samples with a grade III or IV histological response were excluded because of an inability to identify tissue comprised predominantly of viable tumor cells. To investigate the transport status of MTX in OS, we measured expression of the RFC by semiquantitative RT-PCR (Fig. 1)Citation . Thirteen of 20 (65%) samples were found to have decreased RFC expression at the time of initial biopsy (Table 2)Citation . Decreased RFC expression was defined as a level below which no human leukemia blast sample had normal MTX transport, as determined by a functional assay in a previous study (8) . The human lymphoblast CCRF-CEM cell line was analyzed with the OS samples to serve as a reference. The samples showed a wide range of RFC expression, but the majority of samples with low expression, as defined above, had barely detectable RFC mRNA (Fig. 2)Citation . Including samples from the time of definitive surgery and relapse as well as diagnosis, 23 of 42 (55%) were found to have decreased mRNA levels of the RFC. Seventeen of 26 (65%) samples with a poor histological response (grade I-II) to chemotherapy had decreased RFC expression, whereas 5 of 14 (36%) samples with a good response (III-IV) had a decrease (P = 0.03; Table 3Citation ). Among the biopsy samples, the seven with a poor histological response to chemotherapy had decreased RFC expression. To investigate whether RFC gene deletions or rearrangements were the basis of the decreased expression, we analyzed the samples by Southern blot. No evidence for a RFC gene deletion or rearrangement was observed in any of the samples (Fig. 3)Citation .


View this table:
[in this window]
[in a new window]

  		Table 1 Clinical, histological, and molecular data

 


View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Quantitative RT-PCR for RFC mRNA expression in OS samples. OS21 and OS22 have normal expression. OS23, OS26, and OS28 have decreased expression. Actin expression was used as a control of cDNA amount. Each sample was serially diluted.

 

View this table:
[in this window]
[in a new window]

  		Table 2 The mRNA levels of RFC and DHFR versus type of resection

 


View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. The distribution of the RFC expression in 42 osteosarcoma samples. The RFC level in CCRF-CEM cells was used as a reference.

 

View this table:
[in this window]
[in a new window]

  		Table 3 The mRNA levels of RFC and DHFR versus clinical data

 


View larger version (66K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. Southern blots of the RFC gene in osteosarcoma samples. D12S2 was used as a loading control. PL indicates placental DNA, which is a normal control.

 
Because increased DHFR expression can result in MTX resistance, we also studied the DHFR mRNA levels in the OS samples by semiquantitative RT-PCR ((Fig. 4)Citation . Two of 20 samples (10%) showed increased DHFR expression at initial biopsy (Table 2)Citation . High DHFR was defined as expression levels higher than the CCRF-CEM cell line, which is sensitive to MTX. Increased DHFR expression was observed in 62% of patients (five of eight) with metastatic or recurrent disease (Table 2)Citation . The frequency of increased DHFR expression was significantly higher in these samples as compared to the biopsy material (P = 0.014; Table 3Citation ). To determine whether the increased DHFR expression was a result of gene amplification, Southern blots were performed. No evidence of DHFR gene amplification was found in any of the samples (Fig. 5)Citation .



View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. Quantitative RT-PCR for DHFR mRNA expression in OS samples. OS26 and OS28 have normal expression. OS29 has high expression. The actin expression was used as a control of cDNA amount. Each sample was serially diluted.

 


View larger version (119K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. Southern blots of the DHFR gene in OS samples. D12S2 was used as a loading control. PL, placental DNA, which is a normal control.

 
We divided our samples into four groups based on the level of RFC and DHFR expression to look at the correlation between the expression of these two genes and response to chemotherapy. We found that patients whose tumors had normal levels of RFC and DHFR mRNA had the best response to chemotherapy (Fig. 6Citation ; P = 0.01). Ninety % of cases in this group had no metastatic disease.



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 6. Correlation between the mRNA levels of RFC and DHFR and histological response to chemotherapy in OS.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
DHFR gene amplification and impaired transport of MTX are two common mechanisms of acquired resistance observed in leukemia clinical samples (8, 9, 10) . Although high-dose MTX is a commonly used chemotherapeutic agent in OS, there are few published studies on mechanisms of resistance (15) . In this study, decreased RFC expression was found in 65% of OS biopsy samples. The high frequency of decreased RFC expression suggests that impaired transport of MTX may be an important mechanism of intrinsic resistance in OS. Southern blot analysis did not show evidence of RFC gene deletions or rearrangements, which suggests that the decreased expression may be related to decreased transcription or point mutations in this gene.

In OS, the only definite prognostic factor identified at diagnosis is the presence or absence of detectable metastatic disease (22) . Some studies have suggested that P-glycoprotein, the product of the multidrug resistance (MDR-1) gene, may be a prognostic factor at diagnosis (23 , 24) , whereas other genes that affect therapeutic response have not been investigated. In this study, decreased RFC expression was associated with a worse histological response to preoperative chemotherapy that includes high-dose MTX treatment (P = 0.03). Histological response to preoperative chemotherapy correlates closely with event-free survival in OS (17 , 18) . It may therefore be worthwhile to investigate prospectively whether RFC expression at diagnosis predicts outcome.

Decreased RFC expression may partly explain why conventional dose MTX is ineffective in the treatment of OS because high doses may be needed to allow transport through alternative means, such as passive diffusion. The correlation of RFC expression with histological response to preoperative chemotherapy suggests that transport may not be the only determinant of intrinsic MTX resistance. In this study, MTX polyglutamylation was not investigated in the OS samples. Viable cells are required for these assays and were not available. Measurements of mRNA expression of folylpolyglutamate synthetase and {gamma}-glutamyl hydrolase, the two enzymes responsible for determining MTX polyglutamate chain length, have not consistently correlated with direct determinations of MTX polyglutamylation (25) . It is possible that high-dose MTX is effective in OS because it produces prolonged drug exposure. We are presently investigating MTX polyglutamylation in OS tumor samples.

Although increased expression of DHFR was rare in the biopsy material, it was frequent in the recurrent pulmonary metastases as well as the excision samples. Of the six recurrent metastatic lesions, four had increased DHFR expression. It is possible that the increased DHFR expression represents acquired MTX resistance. This could occur either through an acquired alteration in the tumor cells or through selection of a previously resistant clone. Previous studies in relapsed acute lymphocytic leukemia have demonstrated that approximately one-third of samples had increased levels of DHFR mRNA and enzyme activity (9) . In relapsed acute lymphocytic leukemia, increased DHFR expression is associated with low-level gene amplification in ~25% of patients (9) . This differs from our observation in OS, where none of the samples had evidence of DHFR gene amplification. Other laboratories have made the observation that DHFRamplification is rare in OS tumor samples as well (15) .

An alternative hypothesis to explain the high levels of DHFR expression in the pulmonary metastases is that it may reflect a difference between primary and metastatic tumors. Some reports have suggested the pulmonary metastases in OS are less responsive to chemotherapy than the primary site (12) . The pulmonary metastases of colorectal metastases are less responsive to 5-fluorouracil than other sites of metastases or the primary tumor, most likely secondary to increased thymidylate synthase levels (26 , 27) . Increased thymidylate synthase levels in the pulmonary metastases of colon cancer are associated with increased E2F expression (28) . Because E2F family members are also known to regulate DHFR transcription, elevated levels of E2F in the pulmonary metastases of OS may explain the high levels of DHFR expression (28) . We are presently investigating the relationship of E2F and DHFR expression in the OS samples in the laboratory.

Lack of the retinoblastoma protein may play a role in MTX resistance in OS (29) . In the absence of retinoblastoma protein, E2F levels increase, which results in an increase in transcription of several genes involved in DNA replication, including DHFR (30 , 31) . The retinoblastoma gene is frequently altered in OS, with loss of heterozygosity occurring in 75% of tumor samples (32, 33, 34, 35) . We are also presently investigating the relationship of retinoblastoma pathway alterations in MTX resistance in OS.

The high frequency of decreased RFC expression in the OS biopsy samples may suggest new therapeutic strategies for the treatment of this disease. The high frequency of MTX transport impairments in relapsed acute lymphocytic leukemia led to studies of newer antifolates, such as trimetrexate, which do not depend on the RFC for cell entry. Leukemic cells that are resistant to MTX on the basis of transport are collaterally sensitive to trimetrexate, possibly due to decreased uptake of the natural folates (36 , 37) . To further widen the therapeutic index, trimetrexate can be administered with simultaneous leucovorin. Leucovorin, which uses the RFC for cell entry, protects the host but will not enter the cells with impaired MTX transport (38) . In a Phase I trial of trimetrexate with simultaneous leucovorin, responses were seen in patients with OS (39) . The high frequency of decreased RFC expression in the biopsy OS samples suggests that exploring this strategy further in patients with OS may be warranted.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Mr. and Mrs. Aaron Feldman, Mr. and Mrs. Steven Stern, the National Children’s Cancer Foundation, and the New York Marathon Limb Preservation Fund. R. G. is the recipient of an ASCO Career Development Award. Back

2 To whom requests for reprints should be addressed, at Department of Pediatrics, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, Mailbox 376, New York, NY 10021. Phone: (212) 639-8392; Fax: (212) 639-2767; E-mail: gorlickr{at}mskcc.org Back

3 The abbreviations used are: OS, osteosarcoma; MTX, methotrexate; DHFR, dihydrofolate reductase; RFC, reduced folate carrier; RT-PCR, reverse transcription-PCR. Back

Received 9/15/98; revised 12/15/98; accepted 12/17/98.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Meyers P. A., Heller G., Healey J. H., Huvos A., Lane J., Marcove R., Applewhite A., Vlamis V., Rosen G. Chemotherapy for nonmetastatic osteogenic sarcoma: the Memorial Sloan-Kettering experience. J. Clin. Oncol., 10: 5-15, 1992.[Abstract]
  2. Meyers P. A., Gorlick R., Heller G., Casper E., Lane J., Huvos A., Healey J. Intensification of preoperative chemotherapy for osteogenic sarcoma: the results of the Memorial Sloan-Kettering (T12) protocol. J. Clin. Oncol., 16: 2452-2458, 1998.[Abstract]
  3. Jaffe N., Frei E., Watts H., Traggis D. High-dose methotrexate in osteogenic sarcoma: a 5-year experience. Cancer Treat. Rep., 62: 259-264, 1978.[Medline]
  4. Saeter G., Alvegard T. A., Elomaa I., Stenwig A. E., Holmstrom T., Solheim O. P. Treatment of osteosarcoma of the extremities with the T-10 protocol, with emphasis on the effects of preoperative chemotherapy with single-agent high-dose methotrexate: a Scandinavian Sarcoma Group study. J. Clin. Oncol., 9: 1766-1775, 1991.[Abstract]
  5. Bertino J. R. Karnofsky memorial lecture. Ode to methotrexate. J. Clin. Oncol., 11: 5-14, 1993.[Medline]
  6. Lin J. T., Tong W. P., Trippett T. M., Niedzwiecki D., Tao Y., Tan C., Steinherz P., Schweitzer B. I., Bertino J. R. Basis for natural resistance to methotrexate in human acute non-lymphocytic leukemia. Leukemia Res, 15: 1191-1196, 1991.[Medline]
  7. Gorlick R., Goker E., Trippett T., Wealtham M., Banerjee D., Bertino J. R. Intrinsic and acquired resistance to methotrexate in acute leukemia. N. Engl. J. Med., 335: 1041-1048, 1996.[Free Full Text]
  8. Gorlick R., Goker E., Trippett T., Steinherz P., Elisseyeff Y., Mazumdar M., Flintoff W. F., Bertino J. R. Defective transport is a common mechanism of acquired methotrexate resistance in acute lymphocytic leukemia and is associated with decreased reduced folate carrier expression. Blood., 89: 1013-1018, 1996.[Abstract/Free Full Text]
  9. Goker E., Waltham M., Kheradpour A., Trippett T., Mazumdar M., Elisseyeff Y., Schnieders B., Steinherz P., Tan C., Berman E., Bertino J. R. Amplification of the dihydrofolate reductase gene is a mechanism of acquired resistance to methotrexate in patients with acute lymphoblastic leukemia and is correlated with p53 gene mutations. Blood., 86: 677-684, 1995.[Abstract/Free Full Text]
  10. Matherly L. H., Taub J. E., Wong S. C., Simpson P. M., Ekizian R., Buck S., Williamson M., Amylon M., Pullen J., Camitta B., Ravindranath Y. Increased frequency of expression of elevated dihydrofolate reductase in T-cell versus B-precursor acute lymphoblastic leukemia in children. Blood, 90: 578-589, 1997.[Abstract/Free Full Text]
  11. Ferrari S., Sassoli V., Orlandi M., Strazzari S., Puggiolo C., Battistini A., Bacci G. Serum methotrexate (MTX) concentrations and prognosis in patients with osteosarcoma of the extremities treated with a multidrug neoadjuvant regimen. J. Chemother., 5: 135-141, 1993.[Medline]
  12. Bacci G., Ferrari S., Delepine N., Bertoni F., Picci P., Mercuri M., Bacchini P., Brach del Prever A., Tienghi A., Comandone A., Campanacci M. Predictive factors of histologic response to primary chemotherapy in osteosarcoma of the extremity: study of 272 patients preoperatively treated with high-dose methotrexate, doxorubicin, and cisplatin. J. Clin. Oncol., 16: 658-663, 1998.[Abstract]
  13. Delepine N., Delepine G., Bacci G., Rosen G., Desbois J. C. Influence of methotrexate dose intensity on outcome of patients with high grade osteogenic sarcoma. Cancer (Phila.), 78: 2127-2135, 1996.[Medline]
  14. Leung S., Marshall G. M., Al Mahr M., Tobias V., Lee D. B., Hughes D. O. Prognostic significance of chemotherapy dosage characteristic in children with osteogenic sarcoma. Med. Pediatr. Oncol., 28: 179-182, 1997.[Medline]
  15. Meyer W. H., Loftin S. K., Houghton J. A., Houghton P. J. Accumulation, intracellular metabolism, and antitumor activity of high- and low-dose methotrexate in human osteosarcoma xenografts. Cancer Commun., 2: 219-229, 1990.[Medline]
  16. Meyer P. A., Gorlick R. Osteosarcoma. Pediatric. Clin. North Am., 44: 973-990, 1997.
  17. Huvos A. G., Rosen G., Marcove R. C. Primary osteogenic sarcoma. Pathologic aspects in 20 patients after treatment with chemotherapy, en bloc resection and prosthetic bone replacement. Arch. Pathol. Lab. Med., 101: 14-18, 1977.[Medline]
  18. Rosen G., Caparros B., Huvos A. G., Kosloff C., Nirenberg A., Cacavio A., Marcove R. C., Lane J. M., Mehta B., Urban C. Preoperative chemotherapy for osteogenic sarcoma: selection of postoperative adjuvant chemotherapy based on the response of the primary tumor to preoperative chemotherapy. Cancer (Phila.)., 49: 1221-1230, 1982.[Medline]
  19. Ausubel F. M., Brent R., Kingston R. E. Preparation of genomic DNA from mammalian tissue Ausubel F. M. Brent R. Kingston R. E. Moore D. D. Seidman J. G. Smith J. A. Struhi K. eds. . Current Protocols in Molecular Biology, 2: 2.1-2.2.2, John Wiley & Sons, Inc. New York 1996.
  20. Horikoshi T., Danenberg K. D., Stadlbauer T. H. W., Volkenandt M., Shea L. C., Aigner K., Gustavsson B., Leichman L., Frosing R., Ray M., Danenberg P. Quantitation of thymidylate synthase, dihydrofolate reductase, and DT-diaphorase gene expression in human tumors using the polymerase chain reaction. Cancer Res., 52: 108-113, 1992.[Abstract/Free Full Text]
  21. Southern E. M. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol., 98: 503-508, 1975.[Medline]
  22. Meyers P. A., Heller G., Healey J. H., Huvos A., Applewhite A., Sun M., LaQuaglia M. Osteogenic sarcoma with clinically detectable metastasis at initial presentation. J. Clin. Oncol., 11: 449-453, 1993.[Abstract/Free Full Text]
  23. Scotlandi K., Serra M., Nicoletti G., Vaccari M., Manara M. C., Nini G., Landuzzi L., Colacci A., Bacci G., Bertoni F., Picci P., Campanacci M., Baldini N. Multidrug resistance and malignancy in human osteosarcoma. Cancer Res., 56: 2434-2440, 1996.[Abstract/Free Full Text]
  24. Baldini N., Scotlandi K., Barbanti-Brodano G., Manara M. C., Maurici D., Bacci G., Bertoni F., Picci P., Sottili S., Campanacci M. Expression of P-glycoprotein in high-grade osteosarcomas in relation to clinical outcome. N. Engl. J. Med., 333: 1380-1385, 1995.[Abstract/Free Full Text]
  25. Cole P. D., Gorlick R., Longo G., Deckert P. M., Banerjee D., Bertino J. R. Development of a quantitative RT-PCR assay for the measurement of {gamma}-glutamyl hydrolase (GGH). Proc. Am. Assoc. Cancer Res., 39: 433 1998.
  26. Gorlick R., Metzger R., Danenberg K. D., Salonga D., Miles J. S., Longo G. S. A., Fu J., Banerjee D., Klimstra D., Jhanwar S., Danenberg P. V., Kemeny N., Bertino J. R. Higher levels of thymidylate synthase gene expression are observed in pulmonary as compared with hepatic metastases of colorectal adenocarcinoma. J. Clin. Oncol., 16: 1465-1469, 1998.[Abstract/Free Full Text]
  27. Banerjee D., Gorlick R., Fu J., Danenberg K., Salonga D., Park J. M., Danenberg P., Kemeny N., Bertino J. R. Elevated thymidylate synthase (TS) expression in the metastases of colon cancer correlates with increases in E2F expression. Proc. Am. Assoc. Cancer Res., 39: 433 1998.
  28. Wells J. M., Illenye S., Magae J., Wu C. L., Heintz N. H. Accumulation of E2F-4. DP-1 DNA binding complexes with induction of dhfr gene expression during the G1 to S phase transition. J. Biol. Chem., 272: 4483-4492, 1997.[Abstract/Free Full Text]
  29. Li W. W., Fan J. G., Hochhauser D., Banerjee D., Zielinski Z., Almasan A., Yin Y., Kelly R., Wahl G. M., Bertino J. R. Lack of functional retinoblastoma protein mediates increased resistance to antimetabolites in human sarcoma cell lines. Proc. Natl. Acad. Sci. USA., 92: 10436-10440, 1995.[Abstract/Free Full Text]
  30. Fan J. G., Bertino J. R. Functional roles of E2F in cell cycle regulation. Oncogene., 14: 1191-1200, 1997.[Medline]
  31. Li W. W., Fan J. G., Hochhauser D., Bertino J. R. Overexpression of p21waf1 leads to increased inhibition of E2F-1 phosphorylation and sensitivity to anticancer drugs in retinoblastoma-negative human sarcoma cells. Cancer Res., 57: 2193-2199, 1997.[Abstract/Free Full Text]
  32. Pellin A., Ferrero-Boix J., Carpio D., Lopez-Terrada D., Carda C., Navarro S., Peydro-Olaya A., Triche T. J., Llombart-Bosch A. Molecular alterations of the RB1, TP53, and MDM2 genes in primary and xenografted human osteosarcomas. Diagn. Mol. Pathol., 6: 333-341, 1997.[Medline]
  33. Feugeas O., Guriec N., Babin-Boilletot A., Marcellin L., Simon P., Babin S., Thyss A., Hofman P., Terrier P., Kalifa C., Brunat-Mentigny M., Patricot L. M., Oberling F. Loss of heterozygosity of the RB gene is a poor prognostic factor in patients with osteosarcoma. J. Clin. Oncol., 14: 467-472, 1996.[Abstract/Free Full Text]
  34. Miller C. W., Aslo A., Campbell M. J., Kawamata N., Lampkin B. C., Koeffler H. P. Alterations of the p53, Rb and MDM2 genes in osteosarcoma. J. Cancer Res. Clin. Oncol., 122: 559-565, 1996.[Medline]
  35. Wadayama B., Toguchida J., Shimizu T., Ishizaki K., Sasaki M. S., Kotoura Y., Yamamuro T. Mutation spectrum of the retinoblastoma gene in osteosarcoma. Cancer Res., 54: 3042-3048, 1994.[Abstract/Free Full Text]
  36. Diddens H., Niethammer D., Jackson R. C. Patterns of cross-resistance to the antifolate drugs trimetrexate, metoprine, homofolate, and CB3717 in human lymphoma and osteosarcoma cells resistant to methotrexate. Cancer Res., 43: 5286-5292, 1983.[Abstract/Free Full Text]
  37. Li W. W., Bertino J. R. Inability of leucovorin to rescue a naturally methotrexate resistance human soft tissue sarcoma cell line from trimetrexate cytotoxicity. Cancer Res., 52: 6866-6870, 1992.[Abstract/Free Full Text]
  38. Lacerda J. F., Goker E., Kheradpour A., Dennig D., Elisseyeff Y., Jagiello C., O’Reilly R. J., Bertino J. R. Selective treatment of SCID mice bearing methotrexate transport-resistant human acute lymphoblastic leukemia tumors with trimetrexate and leucovorin protection. Blood., 85: 2675-2679, 1995.[Abstract/Free Full Text]
  39. Tkaczewski L., Tong W. P., Spriggs D., Bertino J. R., Capizzi R. L., Kamen B. A. Trimetrexate (TMTX) oral bioavailability and lack of cross resistance with HD-MTX in patients with recurrent osteosarcoma. Proc. Am. Soc. Clin. Oncol., 15: 1504 1996.



This article has been cited by other articles:


Home page
 Mol. Pharmacol.Home page
R. Zhao, A. Qiu, E. Tsai, M. Jansen, M. H. Akabas, and I. D. Goldman
The Proton-Coupled Folate Transporter: Impact on Pemetrexed Transport and on Antifolates Activities Compared with the Reduced Folate Carrier
Mol. Pharmacol., September 1, 2008; 74(3): 854 - 862.
[Abstract] [Full Text] [PDF]

Home page
 Ann OncolHome page
I. Scionti, F. Michelacci, M. Pasello, C. M. Hattinger, M. Alberghini, M. C. Manara, G. Bacci, S. Ferrari, K. Scotlandi, P. Picci, et al.
Clinical impact of the methotrexate resistance-associated genes C-MYC and dihydrofolate reductase (DHFR) in high-grade osteosarcoma
Ann. Onc., August 1, 2008; 19(8): 1500 - 1508.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
Y. Deng, Z. Hou, L. Wang, C. Cherian, J. Wu, A. Gangjee, and L. H. Matherly
Role of Lysine 411 in Substrate Carboxyl Group Binding to the Human Reduced Folate Carrier, as Determined by Site-Directed Mutagenesis and Affinity Inhibition
Mol. Pharmacol., April 1, 2008; 73(4): 1274 - 1281.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
R. Yang, E. A. Kolb, J. Qin, A. Chou, R. Sowers, B. Hoang, J. H. Healey, A. G. Huvos, P. A. Meyers, and R. Gorlick
The Folate Receptor {alpha} Is Frequently Overexpressed in Osteosarcoma Samples and Plays a Role in the Uptake of the Physiologic Substrate 5-Methyltetrahydrofolate
Clin. Cancer Res., May 1, 2007; 13(9): 2557 - 2567.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
J. Neuzil, M. Tomasetti, Y. Zhao, L.-F. Dong, M. Birringer, X.-F. Wang, P. Low, K. Wu, B. A. Salvatore, and S. J. Ralph
Vitamin E Analogs, a Novel Group of "Mitocans," as Anticancer Agents: The Importance of Being Redox-Silent
Mol. Pharmacol., May 1, 2007; 71(5): 1185 - 1199.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
Y. Ge, C. L. Haska, K. LaFiura, M. Devidas, S. B. Linda, M. Liu, R. Thomas, J. W. Taub, and L. H. Matherly
Prognostic Role of the Reduced Folate Carrier, the Major Membrane Transporter for Methotrexate, in Childhood Acute Lymphoblastic Leukemia: A Report from the Children's Oncology Group
Clin. Cancer Res., January 15, 2007; 13(2): 451 - 457.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Z. Hou, J. Ye, C. L. Haska, and L. H. Matherly
Transmembrane Domains 4, 5, 7, 8, and 10 of the Human Reduced Folate Carrier Are Important Structural or Functional Components of the Transmembrane Channel for Folate Substrates
J. Biol. Chem., November 3, 2006; 281(44): 33588 - 33596.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
H. L. Gomez, S. L. Santillana, C. S. Vallejos, R. Velarde, J. Sanchez, X. Wang, N. L. Bauer, R. D. Hockett, V. J. Chen, C. Niyikiza, et al.
A Phase II Trial of Pemetrexed in Advanced Breast Cancer: Clinical Response and Association with Molecular Target Expression
Clin. Cancer Res., February 1, 2006; 12(3): 832 - 838.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
L. Rothem, B. Berman, M. Stark, G. Jansen, and Y. G. Assaraf
The Reduced Folate Carrier Gene Is a Novel Selectable Marker for Recombinant Protein Overexpression
Mol. Pharmacol., September 1, 2005; 68(3): 616 - 624.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
W. M. Spees, T. P.F. Gade, G. Yang, W. P. Tong, W. G. Bornmann, R. Gorlick, and J. A. Koutcher
An 19F Magnetic Resonance-Based In Vivo Assay of Solid Tumor Methotrexate Resistance: Proof of Principle
Clin. Cancer Res., February 15, 2005; 11(4): 1454 - 1461.
[Abstract] [Full Text] [PDF]

Home page
 The OncologistHome page
N. Marina, M. Gebhardt, L. Teot, and R. Gorlick
Biology and Therapeutic Advances for Pediatric Osteosarcoma
Oncologist, July 1, 2004; 9(4): 422 - 441.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Rothem, M. Stark, Y. Kaufman, L. Mayo, and Y. G. Assaraf
Reduced Folate Carrier Gene Silencing in Multiple Antifolate-resistant Tumor Cell Lines Is Due to a Simultaneous Loss of Function of Multiple Transcription Factors but Not Promoter Methylation
J. Biol. Chem., January 2, 2004; 279(1): 374 - 384.
[Abstract] [Full Text] [PDF]

Home page
 Ann OncolHome page
M. Serra, G. Reverter-Branchat, D. Maurici, S. Benini, J.-N. Shen, T. Chano, C.-M. Hattinger, M.-C. Manara, M. Pasello, K. Scotlandi, et al.
Analysis of dihydrofolate reductase and reduced folate carrier gene status in relation to methotrexate resistance in osteosarcoma cells
Ann. Onc., January 1, 2004; 15(1): 151 - 160.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
R. Gorlick, P. Anderson, I. Andrulis, C. Arndt, G. P. Beardsley, M. Bernstein, J. Bridge, N.-K. Cheung, J. S. Dome, D. Ebb, et al.
Biology of Childhood Osteogenic Sarcoma and Potential Targets for Therapeutic Development: Meeting Summary
Clin. Cancer Res., November 15, 2003; 9(15): 5442 - 5453.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
R. Sowers, J. Toguchida, J. Qin, P. A. Meyers, J. H. Healey, A. Huvos, D. Banerjee, J. R. Bertino, and R. Gorlick
mRNA Expression Levels of E2F Transcription Factors Correlate with Dihydrofolate Reductase, Reduced Folate Carrier, and Thymidylate Synthase mRNA Expression in Osteosarcoma
Mol. Cancer Ther., June 1, 2003; 2(6): 535 - 541.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Rothem, A. Aronheim, and Y. G. Assaraf
Alterations in the Expression of Transcription Factors and the Reduced Folate Carrier as a Novel Mechanism of Antifolate Resistance in Human Leukemia Cells
J. Biol. Chem., March 7, 2003; 278(11): 8935 - 8941.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
R. Yang, R. Sowers, B. Mazza, J. H. Healey, A. Huvos, H. Grier, M. Bernstein, G. P. Beardsley, M. D. Krailo, M. Devidas, et al.
Sequence Alterations in the Reduced Folate Carrier Are Observed in Osteosarcoma Tumor Samples
Clin. Cancer Res., February 1, 2003; 9(2): 837 - 844.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. R. Whetstine, T. L. Witt, and L. H. Matherly
The Human Reduced Folate Carrier Gene Is Regulated by the AP2 and Sp1 Transcription Factor Families and a Functional 61-Base Pair Polymorphism
J. Biol. Chem., November 8, 2002; 277(46): 43873 - 43880.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Sadlish, F. M. R. Williams, and W. F. Flintoff
Functional Role of Arginine 373 in Substrate Translocation by the Reduced Folate Carrier
J. Biol. Chem., October 25, 2002; 277(44): 42105 - 42112.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
I. D. Goldman
Membrane Transport of Chemotherapeutics and Drug Resistance: Beyond the ABC Family of Exporters to the Role of Carrier-mediated Processes
Clin. Cancer Res., January 1, 2002; 8(1): 4 - 6.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Worm, A. F. Kirkin, K. N. Dzhandzhugazyan, and P. Guldberg
Methylation-dependent Silencing of the Reduced Folate Carrier Gene in Inherently Methotrexate-resistant Human Breast Cancer Cells
J. Biol. Chem., October 19, 2001; 276(43): 39990 - 40000.
[Abstract] [Full Text] [PDF]

Home page
 JBJSHome page
H. Takeshita, K. Kusuzaki, T. Ashihara, M. C. Gebhardt, H. J. Mankin, and Y. Hirasawa
Intrinsic Resistance to Chemotherapeutic Agents in Murine Osteosarcoma Cells
J. Bone Joint Surg. Am., July 1, 2000; 82(7): 963 - 963.
[Abstract] [Full Text]

Home page
 J. Biol. Chem.Home page
J. R. Whetstine and L. H. Matherly
The Basal Promoters for the Human Reduced Folate Carrier Gene Are Regulated by a GC-box and a cAMP-response Element/AP-1-like Element. BASIS FOR TISSUE-SPECIFIC GENE EXPRESSION
J. Biol. Chem., February 23, 2001; 276(9): 6350 - 6358.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, W.
Right arrow Articles by Gorlick, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, W.
Right arrow Articles by Gorlick, R.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online