
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Oncology, Markers, Clinical Correlates |
Departments of Surgery, Orthopaedic Service [W. G., J. H. H.], Pediatrics [P. A. M., R. G.], Human Genetics [M. L.], Pathology [M. L., A. G. H.], and Molecular Pharmacology and Experimental Therapeutics [J. R. B.], Memorial Sloan-Kettering Cancer Center, New York, New York 10021
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
MTX is a potent inhibitor of DHFR, a key enzyme for intracellular folate metabolism, which functions to regenerate tetrahydrofolate from dihydrofolate (5) . In experimental systems, resistance to MTX can occur through a variety of mechanisms, including impaired transport of drug into the cell via the RFC, an increase in DHFR due to gene amplification or increased transcription, and diminished intracellular retention secondary to decreased polyglutamylation (5) . In patients with acute myelocytic leukemia, a disease in which MTX is ineffective, the basis of intrinsic resistance is primarily a result of impaired polyglutamylation leading to lack of drug retention (6) . In patients with relapsed acute lymphocytic leukemia, impaired transport and DHFR amplification are the common mechanisms of acquired resistance (7, 8, 9, 10) .
Although high-dose MTX is frequently used in the treatment of OS, conventional dose therapy is ineffective. Several retrospective studies have suggested that a threshold peak MTX level needs to be achieved to obtain a good histological response to chemotherapy (11, 12, 13, 14) . This relationship suggests OS is intrinsically resistant to conventional doses of MTX that may be overcome by the use of very high doses. To date, little information is available concerning intrinsic or acquired mechanisms of MTX resistance in this disease (15) .
Our hypothesis is that alterations in transport through decreased RFC expression and increased DHFR expression are mechanisms of intrinsic and acquired MTX resistance in OS. These measures relate to patient outcome through determining the tumors response or resistance to chemotherapy. We have initially focused on the measurement of RFC and DHFR mRNA expression in fresh tumor samples by semiquantitative RT-PCR. The deletion or amplification of these genes was measured by quantitative Southern blot. Results of these assays are correlated with the histological response of the tumor to preoperative chemotherapy to determine their potential role as prognostic indicators.
| MATERIALS AND METHODS |
|---|
|
|
|---|
RNA and DNA Preparation.
All tumor tissues were snap-frozen in liquid nitrogen immediately after resection. Total RNA was isolated from the frozen tumor tissue using acid guanidinium-isothiocyanate (Tel-Test, Friendswood, TX), followed by phenol-chloroform extraction and isopropanol precipitation. RNA was resuspended in diethylpyrocarbonate-water, quantitated spectrophotometrically, and stored at -70°C. Genomic DNA from these samples was isolated by standard methods and quantitated spectrophotometrically (19)
.
Semiquantitative RT-PCR.
The PCR primers for RFC, DHFR, and actin were synthesized by Operon Technologies (Alameda, CA), according to sequences published previously (8
, 20)
. The RFC primers used were as follows: RFC617, 5'-CCAAGCGCAGCCTCTTCTTCAACC; and RFC949, 5'-CCAGCAGCGTGGAGGCAGCATCTGCC, which produce an
300-bp PCR product. The DHFR primers used were as follows: DHFR130, 5' GTAGAAGGTAAACAGAATCTG; and DHFR505, 3'AGAACACCTGGGTATTCTGG. One µg of total RNA was reverse transcribed in a volume of 20 µl with 100 units of Superscript II RT (Life Technologies, Inc., Gaithersburg, MD) and 20 units of RNase inhibitor (Boehringer Mannheim, Indianapolis, IN) at 42°C for 60 min with random primers. After reverse transcription, the enzymes and first-strand cDNA were denatured at 95°C for 5 min and then chilled on ice for 5 min. Each cDNA sample was serially diluted with water as follows: 1:10, 1:102, 1:103, 1:104, and 1:105 and added to a reaction mix including AmpliTaq DNA polymerase (Perkin-Elmer Cetus, Norwalk, CT), deoxynucleotide triphosphate, buffer, [32P]dCTP, and each set of primers in a final volume of 25 µl. Amplification proceeded for 35 cycles of denaturation at 94°C for 1 min, annealing for 1 min, and elongation at 72°C for 1 min, with a final extension at 72°C for 5 min. The annealing temperature was different for each set of primers (RFC at 55°C and DHFR and actin at 60°C). Actin primers were used as a control for the amount of cDNA. The PCR products were electrophoresed on a 6% polyacrylamide gel subsequently dried on a gel dryer. The dried gel was exposed to a film overnight. RFC and DHFR expression was calculated by determining the ratio of RFC and DHFR relative to actin mRNA for each sample. A negative control in which no cDNA was added was included with each sample.
Southern Blot.
Aliquots (
10 µg) of DNA were digested with EcoRI at 37°C for 5 to 20 h, separated on 0.9% agarose gels, and transferred onto nylon membranes using standard methodologies (21)
. After UV cross-linking for 5 min, the blots were prehybridized for at least 1 h and subsequently hybridized with a full-length DHFR or RFC cDNA probe, which was digested from a plasmid (RFC plasmid obtained as a kind gift from Wayne Flintoff, University of Western Ontario, London, Ontario, Canada). The cDNA was radiolabeled with [32P]dCTP to a high specific activity using the random primer technique. The filters were washed at high stringency and directly scanned using a phosphor imager (Bio-Rad, Hercules, CA). The D12S2 probe was used as a loading control.
Statistical Analysis.
A
2 test was used to evaluate the difference between two variables.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
In OS, the only definite prognostic factor identified at diagnosis is the presence or absence of detectable metastatic disease (22) . Some studies have suggested that P-glycoprotein, the product of the multidrug resistance (MDR-1) gene, may be a prognostic factor at diagnosis (23 , 24) , whereas other genes that affect therapeutic response have not been investigated. In this study, decreased RFC expression was associated with a worse histological response to preoperative chemotherapy that includes high-dose MTX treatment (P = 0.03). Histological response to preoperative chemotherapy correlates closely with event-free survival in OS (17 , 18) . It may therefore be worthwhile to investigate prospectively whether RFC expression at diagnosis predicts outcome.
Decreased RFC expression may partly explain why conventional dose MTX is ineffective in the treatment of OS because high doses may be needed to allow transport through alternative means, such as passive diffusion. The correlation of RFC expression with histological response to preoperative chemotherapy suggests that transport may not be the only determinant of intrinsic MTX resistance. In this study, MTX polyglutamylation was not investigated in the OS samples. Viable cells are required for these assays and were not available. Measurements of mRNA expression of folylpolyglutamate synthetase and
-glutamyl hydrolase, the two enzymes responsible for determining MTX polyglutamate chain length, have not consistently correlated with direct determinations of MTX polyglutamylation (25)
. It is possible that high-dose MTX is effective in OS because it produces prolonged drug exposure. We are presently investigating MTX polyglutamylation in OS tumor samples.
Although increased expression of DHFR was rare in the biopsy material, it was frequent in the recurrent pulmonary metastases as well as the excision samples. Of the six recurrent metastatic lesions, four had increased DHFR expression. It is possible that the increased DHFR expression represents acquired MTX resistance. This could occur either through an acquired alteration in the tumor cells or through selection of a previously resistant clone. Previous studies in relapsed acute lymphocytic leukemia have demonstrated that approximately one-third of samples had increased levels of DHFR mRNA and enzyme activity (9)
. In relapsed acute lymphocytic leukemia, increased DHFR expression is associated with low-level gene amplification in
25% of patients (9)
. This differs from our observation in OS, where none of the samples had evidence of DHFR gene amplification. Other laboratories have made the observation that DHFRamplification is rare in OS tumor samples as well (15)
.
An alternative hypothesis to explain the high levels of DHFR expression in the pulmonary metastases is that it may reflect a difference between primary and metastatic tumors. Some reports have suggested the pulmonary metastases in OS are less responsive to chemotherapy than the primary site (12) . The pulmonary metastases of colorectal metastases are less responsive to 5-fluorouracil than other sites of metastases or the primary tumor, most likely secondary to increased thymidylate synthase levels (26 , 27) . Increased thymidylate synthase levels in the pulmonary metastases of colon cancer are associated with increased E2F expression (28) . Because E2F family members are also known to regulate DHFR transcription, elevated levels of E2F in the pulmonary metastases of OS may explain the high levels of DHFR expression (28) . We are presently investigating the relationship of E2F and DHFR expression in the OS samples in the laboratory.
Lack of the retinoblastoma protein may play a role in MTX resistance in OS (29) . In the absence of retinoblastoma protein, E2F levels increase, which results in an increase in transcription of several genes involved in DNA replication, including DHFR (30 , 31) . The retinoblastoma gene is frequently altered in OS, with loss of heterozygosity occurring in 75% of tumor samples (32, 33, 34, 35) . We are also presently investigating the relationship of retinoblastoma pathway alterations in MTX resistance in OS.
The high frequency of decreased RFC expression in the OS biopsy samples may suggest new therapeutic strategies for the treatment of this disease. The high frequency of MTX transport impairments in relapsed acute lymphocytic leukemia led to studies of newer antifolates, such as trimetrexate, which do not depend on the RFC for cell entry. Leukemic cells that are resistant to MTX on the basis of transport are collaterally sensitive to trimetrexate, possibly due to decreased uptake of the natural folates (36 , 37) . To further widen the therapeutic index, trimetrexate can be administered with simultaneous leucovorin. Leucovorin, which uses the RFC for cell entry, protects the host but will not enter the cells with impaired MTX transport (38) . In a Phase I trial of trimetrexate with simultaneous leucovorin, responses were seen in patients with OS (39) . The high frequency of decreased RFC expression in the biopsy OS samples suggests that exploring this strategy further in patients with OS may be warranted.
| FOOTNOTES |
|---|
1 Supported by Mr. and Mrs. Aaron Feldman, Mr. and Mrs. Steven Stern, the National Childrens Cancer Foundation, and the New York Marathon Limb Preservation Fund. R. G. is the recipient of an ASCO Career Development Award. ![]()
2 To whom requests for reprints should be addressed, at Department of Pediatrics, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, Mailbox 376, New York, NY 10021. Phone: (212) 639-8392; Fax: (212) 639-2767; E-mail: gorlickr{at}mskcc.org ![]()
3 The abbreviations used are: OS, osteosarcoma; MTX, methotrexate; DHFR, dihydrofolate reductase; RFC, reduced folate carrier; RT-PCR, reverse transcription-PCR. ![]()
Received 9/15/98; revised 12/15/98; accepted 12/17/98.
| REFERENCES |
|---|
|
|
|---|
-glutamyl hydrolase (GGH). Proc. Am. Assoc. Cancer Res., 39: 433 1998.
This article has been cited by other articles:
![]() |
R. Zhao, A. Qiu, E. Tsai, M. Jansen, M. H. Akabas, and I. D. Goldman The Proton-Coupled Folate Transporter: Impact on Pemetrexed Transport and on Antifolates Activities Compared with the Reduced Folate Carrier Mol. Pharmacol., September 1, 2008; 74(3): 854 - 862. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Scionti, F. Michelacci, M. Pasello, C. M. Hattinger, M. Alberghini, M. C. Manara, G. Bacci, S. Ferrari, K. Scotlandi, P. Picci, et al. Clinical impact of the methotrexate resistance-associated genes C-MYC and dihydrofolate reductase (DHFR) in high-grade osteosarcoma Ann. Onc., August 1, 2008; 19(8): 1500 - 1508. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Deng, Z. Hou, L. Wang, C. Cherian, J. Wu, A. Gangjee, and L. H. Matherly Role of Lysine 411 in Substrate Carboxyl Group Binding to the Human Reduced Folate Carrier, as Determined by Site-Directed Mutagenesis and Affinity Inhibition Mol. Pharmacol., April 1, 2008; 73(4): 1274 - 1281. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yang, E. A. Kolb, J. Qin, A. Chou, R. Sowers, B. Hoang, J. H. Healey, A. G. Huvos, P. A. Meyers, and R. Gorlick The Folate Receptor {alpha} Is Frequently Overexpressed in Osteosarcoma Samples and Plays a Role in the Uptake of the Physiologic Substrate 5-Methyltetrahydrofolate Clin. Cancer Res., May 1, 2007; 13(9): 2557 - 2567. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Neuzil, M. Tomasetti, Y. Zhao, L.-F. Dong, M. Birringer, X.-F. Wang, P. Low, K. Wu, B. A. Salvatore, and S. J. Ralph Vitamin E Analogs, a Novel Group of "Mitocans," as Anticancer Agents: The Importance of Being Redox-Silent Mol. Pharmacol., May 1, 2007; 71(5): 1185 - 1199. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ge, C. L. Haska, K. LaFiura, M. Devidas, S. B. Linda, M. Liu, R. Thomas, J. W. Taub, and L. H. Matherly Prognostic Role of the Reduced Folate Carrier, the Major Membrane Transporter for Methotrexate, in Childhood Acute Lymphoblastic Leukemia: A Report from the Children's Oncology Group Clin. Cancer Res., January 15, 2007; 13(2): 451 - 457. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Hou, J. Ye, C. L. Haska, and L. H. Matherly Transmembrane Domains 4, 5, 7, 8, and 10 of the Human Reduced Folate Carrier Are Important Structural or Functional Components of the Transmembrane Channel for Folate Substrates J. Biol. Chem., November 3, 2006; 281(44): 33588 - 33596. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Gomez, S. L. Santillana, C. S. Vallejos, R. Velarde, J. Sanchez, X. Wang, N. L. Bauer, R. D. Hockett, V. J. Chen, C. Niyikiza, et al. A Phase II Trial of Pemetrexed in Advanced Breast Cancer: Clinical Response and Association with Molecular Target Expression Clin. Cancer Res., February 1, 2006; 12(3): 832 - 838. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Rothem, B. Berman, M. Stark, G. Jansen, and Y. G. Assaraf The Reduced Folate Carrier Gene Is a Novel Selectable Marker for Recombinant Protein Overexpression Mol. Pharmacol., September 1, 2005; 68(3): 616 - 624. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. M. Spees, T. P.F. Gade, G. Yang, W. P. Tong, W. G. Bornmann, R. Gorlick, and J. A. Koutcher An 19F Magnetic Resonance-Based In Vivo Assay of Solid Tumor Methotrexate Resistance: Proof of Principle Clin. Cancer Res., February 15, 2005; 11(4): 1454 - 1461. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Marina, M. Gebhardt, L. Teot, and R. Gorlick Biology and Therapeutic Advances for Pediatric Osteosarcoma Oncologist, July 1, 2004; 9(4): 422 - 441. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Rothem, M. Stark, Y. Kaufman, L. Mayo, and Y. G. Assaraf Reduced Folate Carrier Gene Silencing in Multiple Antifolate-resistant Tumor Cell Lines Is Due to a Simultaneous Loss of Function of Multiple Transcription Factors but Not Promoter Methylation J. Biol. Chem., January 2, 2004; 279(1): 374 - 384. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Serra, G. Reverter-Branchat, D. Maurici, S. Benini, J.-N. Shen, T. Chano, C.-M. Hattinger, M.-C. Manara, M. Pasello, K. Scotlandi, et al. Analysis of dihydrofolate reductase and reduced folate carrier gene status in relation to methotrexate resistance in osteosarcoma cells Ann. Onc., January 1, 2004; 15(1): 151 - 160. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gorlick, P. Anderson, I. Andrulis, C. Arndt, G. P. Beardsley, M. Bernstein, J. Bridge, N.-K. Cheung, J. S. Dome, D. Ebb, et al. Biology of Childhood Osteogenic Sarcoma and Potential Targets for Therapeutic Development: Meeting Summary Clin. Cancer Res., November 15, 2003; 9(15): 5442 - 5453. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sowers, J. Toguchida, J. Qin, P. A. Meyers, J. H. Healey, A. Huvos, D. Banerjee, J. R. Bertino, and R. Gorlick mRNA Expression Levels of E2F Transcription Factors Correlate with Dihydrofolate Reductase, Reduced Folate Carrier, and Thymidylate Synthase mRNA Expression in Osteosarcoma Mol. Cancer Ther., June 1, 2003; 2(6): 535 - 541. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Rothem, A. Aronheim, and Y. G. Assaraf Alterations in the Expression of Transcription Factors and the Reduced Folate Carrier as a Novel Mechanism of Antifolate Resistance in Human Leukemia Cells J. Biol. Chem., March 7, 2003; 278(11): 8935 - 8941. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yang, R. Sowers, B. Mazza, J. H. Healey, A. Huvos, H. Grier, M. Bernstein, G. P. Beardsley, M. D. Krailo, M. Devidas, et al. Sequence Alterations in the Reduced Folate Carrier Are Observed in Osteosarcoma Tumor Samples Clin. Cancer Res., February 1, 2003; 9(2): 837 - 844. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Whetstine, T. L. Witt, and L. H. Matherly The Human Reduced Folate Carrier Gene Is Regulated by the AP2 and Sp1 Transcription Factor Families and a Functional 61-Base Pair Polymorphism J. Biol. Chem., November 8, 2002; 277(46): 43873 - 43880. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sadlish, F. M. R. Williams, and W. F. Flintoff Functional Role of Arginine 373 in Substrate Translocation by the Reduced Folate Carrier J. Biol. Chem., October 25, 2002; 277(44): 42105 - 42112. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. D. Goldman Membrane Transport of Chemotherapeutics and Drug Resistance: Beyond the ABC Family of Exporters to the Role of Carrier-mediated Processes Clin. Cancer Res., January 1, 2002; 8(1): 4 - 6. [Full Text] [PDF] |
||||
![]() |
J. Worm, A. F. Kirkin, K. N. Dzhandzhugazyan, and P. Guldberg Methylation-dependent Silencing of the Reduced Folate Carrier Gene in Inherently Methotrexate-resistant Human Breast Cancer Cells J. Biol. Chem., October 19, 2001; 276(43): 39990 - 40000. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Takeshita, K. Kusuzaki, T. Ashihara, M. C. Gebhardt, H. J. Mankin, and Y. Hirasawa Intrinsic Resistance to Chemotherapeutic Agents in Murine Osteosarcoma Cells J. Bone Joint Surg. Am., July 1, 2000; 82(7): 963 - 963. [Abstract] [Full Text] |
||||
![]() |
J. R. Whetstine and L. H. Matherly The Basal Promoters for the Human Reduced Folate Carrier Gene Are Regulated by a GC-box and a cAMP-response Element/AP-1-like Element. BASIS FOR TISSUE-SPECIFIC GENE EXPRESSION J. Biol. Chem., February 23, 2001; 276(9): 6350 - 6358. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |