| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cancer Biology, Immunology, Cytokines |
Departments of Immunology [R. G. U., P. R., V. K., P. E. C., T. B., A. M. W., L. M., C. T., L. J. W., J. H. F.], Urology [R. G. U., P. E. C., A. M. W., A. C. N., J. H. F.], Clinical Pathology [R. T., E. D. H.], and Hematology-Oncology [R. B., J. H. F.], The Cleveland Clinic Foundation, Lerner Research Institute, Cleveland, Ohio 44195, and Department of Urology, Division of Urologic Oncology, The New York Hospital-Cornell University Medical Center [N. H. B.], New York, New York 10021
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Interactions between the Fas receptor (Apo-1/CD95) and its ligand, FasL,3 (L/CD95L) have been implicated in a number of normal and pathological processes regulating T-cell function. FasL is used by lymphocytes not only as a cytotoxic effector mechanism to induce apoptosis in Fas-expressing targets (11 , 12) , but also to diminish the immune response once the targeted antigen has been eliminated (13 , 14) . Fas/FasL-mediated induction of apoptosis is an effective mechanism of T-cell homeostasis whereby self-reactive clones can be eliminated (15) , conditions of tolerance and immune sanctuaries can be achieved (16 , 17) , and overexuberance of the immune response can be prevented (18) . However, tumor cells may take advantage of these mechanisms to escape immune destruction. Malignant cells from an increasing number of solid tumors including melanoma (19) , colon carcinoma (8 , 20) , esophageal carcinoma (21 , 22) , ovarian carcinoma (23) , hepatocellular carcinoma (24) , and astrocytoma (9) have been reported to express FasL. T-TILs are potential targets for these FasL-expressing tumor cells (25) .
Here we defined Fas and FasL expression on T cells derived from the peripheral blood and tumor of RCC patients. The expression of these molecules was also defined in renal tumor cells in situ and in cultured cell lines. Additional experiments determined the susceptibility of patient T cells to apoptosis. Our findings provide support for tumor-induced apoptosis of T cells via the expression of FasL in RCCs. First, FasL+ RCC cell lines induced apoptosis in activated T cells but not in resting T cells after coculture. Moreover, antibodies to FasL partially blocked the apoptosis of T cells. Second, a subset of tumor-infiltrating and peripheral blood-derived T cells from RCC patients expressed Fas. Third, in situ TUNEL staining of RCC demonstrated apoptosis in a subset of T-TILs. Finally, T cells from the peripheral blood of RCC patients but not those from normal individuals were susceptible to activation-induced apoptosis when stimulated with PMA/ionomycin or antibodies against CD3/CD28.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Establishment of Short-Term RCC Tumor Cultures.
Primary RCC tumor specimens were obtained from eight patients undergoing nephrectomy, and short-term epithelial cell cultures were established in RPMI 1640 supplemented with 10% fetal bovine serum (Hyclone, Logan, UT), L-glutamine (2 mM), sodium pyruvate (1 mM), nonessential amino acids (0.1 mM), and gentamicin (50 µg/ml; Life Technologies, Inc., Grand Island, NY). Monoclonal staining of short-term epithelial cultures was performed using antibodies against URO-2 (Signet, Dedham, MA) and RCC (Monosan, Inc., San Francisco, CA) to confirm the establishment of cultures of renal cell origin. Cultures were maintained at 37°C with 5% CO2. All cell lines were trypsinized (1000 units/ml; Worthington, Freehold, NJ) upon confluence, and aliquots were frozen at -80°C in 90% fetal bovine serum and 10% DMSO (Sigma). Frozen aliquots were resuspended in supplemented cloning media and maintained in culture for 3–5 days before the measurement of CD95/CD95L expression. All short-term RCC cultures studied were passage 4 or less. Five established and well-characterized RCC cell lines were obtained from Dr. Neil Bander (SK-RCC-7, -26b, -28, -48, and -54; The New York Hospital- Cornell University Medical College). Additionally, a human colon epithelial cancer cell line (SW-620), which has previously been shown to express FasL (8)
, was obtained from the American Type Culture Collection (Rockville, MD).
Immunocytometry Analysis of T-Cell and RCC Epithelial-Cell Surface Antigens.
T-PBLs, T-TILs, and Jurkat cells were stained with antibody to external epitopes of CD3, CD4, CD8, CD95, and CD95L. Short-term RCC epithelial cultures and freshly isolated RCC epithelial cells were stained with anti-CD95/CD95L only. Monoclonal antibodies were purchased as FITC (anti-CD95; Becton Dickinson, Mountain View, CA) or PerCP (anti-CD3, anti-CD4, and anti-CD8; Becton Dickinson) conjugates. For all experiments, matched isotype controls were used for each particular subclass of immunoglobulin and system used. Cells were washed in HBSS (Biowhittaker), and individual samples were split into two tubes, one for autofluorescence, and the other stained with the appropriate antibodies. In the case of the biotinylated anti-CD95L, (catalogue number 65322X; PharMingen, San Diego, CA), streptavidin-PE (Becton Dickinson) was used as a secondary antibody for fluorescence. Cells were then fixed in 1% paraformaldehyde and analyzed by flow cytometry (FACScalibur; Becton Dickinson; Ref. 26
). Live gating of the forward and orthogonal scatter channels was used to exclude debris and to selectively acquire lymphocyte or epithelial cell events. Individual fluorescence data were determined through the use of acquisition and quadrant analysis software (CELLQUEST; Becton Dickinson). Percentages of cells expressing CD95 and CD95L were calculated, and statistical analyses were performed using the Kruskal-Wallis and Wilcoxon’s rank-sum tests.
mRNA Analysis by RT-PCR.
RNA was isolated by the guanidine isothiocyanate/cesium chloride method, followed by ethanol precipitation and storage at -70°C. cDNA was synthesized using a specific antisense primer and avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI). The undiluted reverse transcription reaction products were used for PCR amplification, using 20 µM sense and antisense primers and Taq polymerase. PCR reactions were conducted in a Perkin-Elmer/Cetus DNA Thermal Cycler for 35 cycles (denaturation, 2 min, 94°C; annealing, 1 min, 60°C; amplification, 3 min, 72°C). The following sense and antisense primers were used: (a) FasL, TGAGCCACAAGGTCTACATGAGG and GGAAAGAATCCCAAAGTGCTTCTC; and (b) GAPDH, GAAGGTGAAGGTCGGAGTC and GAAGATGGTGATGGGATTTC. The PCR products were separated by agarose gel electrophoresis and visualized by Southern hybridization analysis using radiolabeled oligonucleotide probes. The probe sequences used were as follows: (a) FasL, CTCTCTGGTCAATTTTGAGGAATCTCAGACG; and (b) GAPDH, CAAGCTTCCCGTTCTCAGCCTTGACGGTG.
Analysis of FasL Expression by Immunohistochemistry.
The identification of FasL expressed by RCC was performed on fixed short- and long-term cell line cytospins and embedded tumor sections. For cytospins, cells were fixed in acetone. Paraffin-embedded tumor sections were subjected to microwave antigen retrieval in 10 mM citrate buffer (pH 6.0). In both instances, the primary antibody to FasL (catalogue number F37720; Transduction Laboratories, Lexington, KY) was used at a 1:40 dilution. Immunoperoxidase staining was performed with an automated immunostainer (Ventana 320; Ventana Medical Systems). Equivalently concentrated nonimmune isotype-matched mouse IgG was used as a control for nonspecific staining.
Western Blotting.
Whole cell lysate protein samples (10–20 µg) were mixed with an equal amount of 2x Laemmli sample buffer, boiled, and resolved by electrophoresis in 10% SDS-polyacrylamide gels. Proteins were transferred to nitrocellulose membranes that were incubated in 5% nonfat dry milk in Tris-buffered saline overnight. Thereafter, membranes were incubated sequentially with anti-FasL antibody (Transduction Laboratories) and then with horseradish peroxidase-conjugated sheep antimouse IgG for 30 min. Membranes were developed with enhanced chemiluminescence (ECL Western Blotting Kit; Amersham).
Coculture of Allogeneic T Cells with FasL-expressing RCC Cell Lines.
T-PBLs were preincubated with PMA (10 ng/ml; Sigma) plus ionomycin (0.75 µg/ml; Sigma) for 3–5 days, which is known to up-regulate surface expression of Fas (CD95; 27
). Jurkat T cells were obtained from the American Type Culture Collection and maintained in culture. The sensitivity of Jurkat cells to Fas-mediated killing has been demonstrated (28
, 29)
. Here, T cells were incubated in medium alone or with the transactivating anti-Fas antibody (50 ng/ml; catalogue number 05-201; Upstate Biotechnology, Lake Placid, NY). T-cell preparations were also cocultured with FasL-expressing tumor cells at a T cell:tumor cell ratio of 10:1 for 24–72 h. Neutralization studies were performed using antihuman FasL antibody (catalogue number D041-3; MBL International, Watertown, MA). After incubation, the nonadherent T cells were removed and stained for viability with trypan blue (Sigma) or fixed for the TUNEL assay.
Quantitation of DNA Fragmentation by TUNEL Assay.
Fixed cells (1% paraformaldehyde) were stained and analyzed for apoptosis using the APO-BRDU kit system (Phoenix Flow Systems, San Diego, CA; Ref. 30
). Briefly, cells were labeled with 50 µl of DNA solution containing 10 µl of TdT reaction buffer (0.75 µl of TdT enzyme and 8 µl of Br—dUTP and dH20). Cells were rinsed before resuspending in 0.1 ml of solution containing fluorescein PRB-1 antibody. Propidium iodide/RNase A solution (0.5 ml) was added to each sample before incubation at room temperature for 30 min. Flow cytometric analysis was performed within 2 h of sample staining. Apoptotic HL60 promyelocytic leukemia cells induced with camptothecin were used as positive controls, whereas uninduced cells served as negative controls. The percentages of apoptotic T cells were obtained using quadrant analysis software (LYSIS II; Becton Dickinson).
In situ TUNEL assays were performed on formalin- and B5-fixed RCC tumor tissue from 10 patients undergoing nephrectomy. Paraffin-embedded samples were deparaffinized and rehydrated in xylene for 5 min at room temperature. Samples were immersed and fixed in graded alcohol washes (100% to 70% pure ethanol) and then permeabilized using proteinase K (1 µl of a 2 mg/ml solution diluted 1:100 in 10 mM Tris). TUNEL assays were performed using portions of a DNA fragmentation detection kit (31; Oncogene Research Products, Cambridge, MA) coupled to automated chromogenic detection on the Ventana Gen II in situ hybridization instrument (Ventana Medical Systems). Briefly, the 3'-hydroxyl ends of fragmented DNA were labeled with biotinylated dUTP catalyzed by TdT. Labeled DNA breaks were detected with an alkaline phosphatase-streptavidin conjugate followed by nitroblue tetrazolium and nuclear fast red counterstaining. HL60 cells and HL60 cells incubated with 0.5 µg/ml actinomycin D for 19 h were used as negative and positive controls, respectively. Specimens were then double-stained with anti-CD3 using the Ventana 320 automated immunostainer. Apoptosis in T-TILs was assessed using conventional light microscopy.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. The observation that the tumor cells themselves express FasL is supported by immunostaining of tumor sections with the anti-FasL antibody. Immunostaining demonstrates that FasL protein was expressed in five of five RCC tumors tested, although the level of expression varied among the tumors examined (Fig. 1B)
. In contrast, isotype control antibody did not stain any tumor cells in situ (data not shown).
|
). Protein was also detectable by both immunoblotting of whole cell lysates (11 of 12) and immunostaining of cytospins (5 of 5; Fig. 2, B and C
). Furthermore, immunocytometry with the 
-Fas ligand antibody could also detect surface expression on three of eight RCC cell lines, whereas isotype controls were negative (Fig. 2D)
.
|
The FasL Expressed on RCC Is Functional and Can Induce Apoptosis in Activated T Lymphocytes.
The initial experiments determined the susceptibility of unstimulated and preactivated T cells as well as the Jurkat T cell line to Fas-mediated killing. Median percentages of apoptotic T cells induced by culturing in media with or without transactivating anti-Fas monoclonal antibody are illustrated in Fig. 3A
. In the absence of antibody, apoptosis levels were low in all cell populations including preactivated normal cells. In the presence of anti-Fas, both Jurkat and preactivated T cells underwent significantly more apoptosis than unstimulated cells (P = 0.03), demonstrating the increased sensitivity of these cell populations to Fas-mediated death.
|
, no significant apoptosis was observed in resting T cells exposed to FasL+ tumor cells or FasL- control cell lines. In addition, stimulated T cells, which have up-regulated Fas expression, were not killed by FasL- control cultures (Fig. 3B)
. However, activated T cells and Jurkat cells displayed increased apoptosis when cultured in the presence of FasL+ RCC tumors. (Fig. 3, B and C)
. Blocking experiments with neutralizing anti-FasL antibody demonstrated that the tumor-induced apoptosis of activated T cells was FasL dependent. The inclusion of anti-FasL antibody in the T cell/tumor cultures caused a marked (>45%) reduction in both the percentage of trypan blue-positive T cells and the percentage of T cells with DNA breaks TUNEL assay; (Fig. 4)
. Isotype-matched control IgG had no effect on reducing apoptosis in T cells (data not shown).
|
). After 24–72 h of stimulation with PMA/ionomycin, Fas expression increased progressively over unstimulated populations (data not shown). Immunocytometry analysis of peripheral blood T cells from both patients and controls demonstrated that a greater percentage of CD4+ cells than CD8+ cells expressed Fas (P < 0.001).
|
. Very little expression of the ligand was observed on resting T cells from normal individuals (median, 0.8% positive cells), as noted previously by others (32, 33, 34)
. Only a minority of T cells from the blood and tumor of RCC patients were FasL+ [median, 11.1% (T-PBLs) and 15.7% (T-TILs)]. These findings also show that a higher percentage of resting CD4+ and CD8+ T cells from RCC patients and normal individuals express Fas than FasL.
In Situ Detection of Apoptosis in T Cells Infiltrating RCC.
Our findings show that FasL+ RCCs can induce apoptosis of activated T cells. Furthermore, a subset of T cells from the tumor and blood of RCC patients expresses Fas. These results raise the possibility that TILs may undergo apoptosis in the tumor environment after exposure to FasL+ tumor cells, as has been recently demonstrated in esophageal and other solid tumor systems (22)
. We therefore examined tumor-infiltrating T cells in situ for evidence of apoptosis. RCC tumors contain a significant accumulation of CD4+ and CD8+ T cells (35)
. The in situ TUNEL assay was performed on renal tumors from 10 patients, and representative data are presented in Fig. 5
. T-TIL apoptosis was heterogeneously distributed within the tumor bed. In all cases, the patchy pattern of TUNEL-positive T cells was observed throughout areas of viable tumor, including areas that appeared to be well vascularized. Approximately 15–20% of the total lymphoid population within the tumor bed was found to be apoptotic. Double staining with the anti-CD3 antibody verified that the apoptotic cells were CD3+ T lymphocytes.
|
). We also examined whether patient T cells would undergo apoptosis after culturing in medium for 24 h. After 24 h, the percentage of patient T cells expressing DNA breaks (median, 7.3%; range, 1.4–21.4%; n = 12) was slightly higher than the results observed in normal T cells (median, 4.5%; range, 4.2–7.8%; n = 7); however, this difference was not significant (P > 0.05; Fig. 6
). Because peripheral blood T cells from RCC patients did not display DNA breaks, we determined whether they expressed an earlier marker of apoptosis, the externalization of phosphatidyl-serine from the inner leaflet of the membrane bilayer (36)
. Freshly isolated purified T cells from patients with RCC and normal controls were stained with annexin V, which has an affinity for phosphatidyl-serine. Our findings (n = 6) indicate that the level of annexin V staining was clearly higher in patient (median, 27.31%; range, 18.9–37.3%) than in normal T cells (median, 6.8%; range, 1.8–9.7%; P < 0.05; data not shown). These results suggest that although DNA breaks are not evident in peripheral T cells, an apoptotic program has been initiated. More importantly, we have found that DNA breaks can be induced in patient T cells after activation. As shown in Fig. 6B
, DNA breaks were observed in peripheral blood T cells of patients stimulated with PMA/ionomycin (median, 20.6%; range, 10.5–85.0%; n = 18). In contrast, no increase in apoptosis was observed in normal donor T cells after a similar stimulation (median, 5.0%; range, 2.6–6.8%; n = 8). In T-PBLs from 34% (6 of 18) of the patients examined, stimulation resulted in >40% apoptosis of T cells (range, 42.8–85%). The induction of DNA breaks was not unique to stimulation with PMA/ionomycin because comparable results were observed when T cells were costimulated with antibodies to CD3/CD28 or incubated with TNF- (Fig. 7)
. Thus, in a subset of patients, peripheral T cells appear to be susceptible to apoptosis upon activation.
|
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Initial evidence that tumors express FasL came from studies of malignancies of cells that normally express FasL upon activation, such as NK lymphomas and T cell-type large granular lymphocyte leukemias (41) . These observations have now been extended to melanomas (19) and solid tumors from several organs including the lung (42) , liver (20) , esophagus (21 , 22) , colon (8 , 20) , and ovary (23) . We provide the first evidence that FasL is expressed on adenocarcinomas of the kidney. Because of the recent controversy over the specificity of certain commercially available anti-FasL antibodies (43) , we have documented FasL in RCC using multiple techniques. Freshly isolated RCC tumor as well as all short-term and established RCC cell lines tested expressed FasL mRNA by RT-PCR, and all but one short-term cell line demonstrated FasL protein by Western blotting. Additionally, immunostaining of both cell line cytospins and tumor tissue detected FasL, as did immunocytometry in some cell lines. It was noted that expression of FasL by tumor cells in situ was patchy, with some cells expressing high levels, whereas others appeared negative for FasL. The presence of apoptotic T cells in the tumor bed was also patchy, a finding similar to that previously reported in esophageal carcinomas (22) . In that study, the heterogeneous expression of FasL on the tumor correlated with increased levels of DNA breaks observed in T cells infiltrating regions of the FasL-expressing tumor. Whether apoptosis correlates to heterogeneous FasL expression in the renal tumor bed is unclear.
Several lines of evidence from in vitro coculture experiments suggest that FasL expressed by RCC is functional. First, FasL+ RCC induced apoptosis in Jurkat cells that are sensitive to the Fas death pathway. These results are in agreement with other studies in which Jurkat cells became apoptotic after exposure to FasL+ colon, ovarian, and brain tumors (8 , 9 , 23) . Tumor-induced apoptosis of Jurkat cells was Fas dependent because Jurkat cells rendered Fas- with Fas-specific antisense oligonucleotides are not lysed by FasL+ tumors (8) . Second, apoptosis of peripheral blood T cells was FasL+ RCC is dependent on the activation status of the lymphocyte population. It is likely that the higher expression level of Fas on activated versus resting T cells accounts for the increased sensitivity of the activated T cells to RCC-induced apoptosis. Third and most important was the observation that the apoptosis of Jurkat cells and activated T cells induced by FasL+ RCC could be inhibited by the addition of anti-FasL antibody to the cultures. This work shows that RCC can induce apoptosis in activated T cells by virtue of augmented expression of FasL as one possible mechanism of immune escape.
Although it is clear that FasL expression contributes to the immune dysfunction of patient T cells, it is likely that in RCC patients, tumor-induced apoptosis of T cells is not exclusively mediated by FasL. This is supported by the observation that the ability of some RCC cell lines to induce apoptosis in T cells was not blocked by anti-FasL antibody. It is unlikely that the apoptosis induced by these RCC cell lines is due to IL-10 or transforming growth factor ß because high molecular weight soluble products from these lines were not active. Moreover, cultured RCCs do not express mRNA for IL-10 (44 , 45) . It is possible that other RCC-derived products such as gangliosides may contribute to the apoptosis of T cells.4
Based on evidence that some tumors have adopted a Fas/FasL mechanism as a means of affecting immunosuppression, a recent study in RCCs examined Fas receptor expression in TILs and PBLs (46) . Cardi et al. reported Fas expression on peripheral blood T cells, although at reduced levels relative to expression in T-TILs and peripheral blood T cells from healthy controls. We observed Fas expression on T cells from the blood and tumor of RCC patients that did not differ significantly from the level of Fas on normal T cells. Consistent with a recent report (46) , Fas expression in RCC patient T cells was nearly 2-fold higher on CD4+ subsets than on their CD8+ counterparts. The reason for this observation is unclear.
We also identified a second mechanism by which T-cell deletion may occur in RCC patients. This involves the induction of apoptosis upon T-cell activation (AICD). We demonstrated that peripheral blood T cells from RCC patients were susceptible to activation-induced apoptosis as defined by the presence of DNA breaks. AICD was induced by several different stimuli in patient T cells, but not in those from normal healthy volunteers. Our findings are similar to those recently reported in patients with multiple myeloma where PBLs underwent apoptosis after stimulation with pokeweed mitogen or PHA (47)
. The mechanism responsible for AICD in RCC patient T cells is not known. It may be that patient T cells are in a chronic but impaired state of preactivation due to long-term exposure to tumor antigen and that subsequent stimulation causes AICD. Activation by recognition of specific antigenic peptides can trigger self-destruction of CD8+ or CD4+ T cells by AICD (48
, 49)
, a process that contributes to the termination of an ongoing cellular immune response in vivo. AICD initiated in this manner may be mediated via induction of FasL expression and subsequent interaction with Fas (32
, 33 , 34)
. However, it is clear that expression of Fas alone was not sufficient to induce apoptosis in patient T cells. Although 50% of peripheral blood T cells were Fas+, there were no detectable DNA breaks when cells were freshly isolated or after resting in vitro for 24 h. We could not link AICD to the expression of the activation marker HLA-DR or to the level of Fas expression. However, it remains possible that AICD susceptibility will be linked to the activation status of the patient T cells through the analysis of other activation markers. We did observe that whereas patient T cells displayed no DNA breaks when initially isolated, they did express one early marker of apoptosis, the externalization of phosphatidyl-serine. Thus, it is possible that patient T cells are in a preapoptotic state. It may be that activation shifts the balance to apoptosis with the induction of DNA breaks. This may occur via activation through the T cell receptor after exposure to antigen, antigen-presenting cells, or tumor or after exposure to TNF-. Alternatively, patient T cells may be more susceptible to apoptosis because they have impaired activation of the transcription factor NF
B. We have reported that T cells from approximately 60% of RCC patients are impaired in normal B binding activity (37
, 50)
. There is growing evidence that defective activation of NFB makes cells more susceptible to apoptosis due to the reduced expression of gene products that protect cells from death (51
, 52)
. Additional studies with patient T cells are under way to further define the contribution that defective NFB induction makes to the cell sensitivity to AICD.
|
FOOTNOTES |
|---|
1 Supported by USPHS Grant CA56937 and the American Foundation for Urologic Diseases. 
2 To whom requests for reprints should be addressed, at The Department of Immunology, NN1–24, The Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195. Phone: (216) 444-5186; Fax: (216) 444-9329.
3 The abbreviations used are: FasL, Fas ligand; RCC, renal cell carcinoma; PMA, phorbol 12-myristate 13-acetate; TIL, tumor-infiltrating lymphocyte; T-TIL, tumor-infiltrating T lymphocyte; AICD, activation-induced cell death; TUNEL, terminal deoxynucleotidyl transferase-mediated nick end labeling; PBL, peripheral blood lymphocyte; T-PBL, peripheral blood T lymphocyte; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TdT, terminal deoxynucleotidyltransferase; TNF, tumor necrosis factor; IL, interleukin; PHA, phytohemagglutinin; NFB, nuclear factor B.
4 R. G. Uzzo. Suppression of NFB activation in T cells by soluble products from renal cell carcinoma is mediated by tumor-derived gangliosides, submitted for publication.
Received 7/ 6/98; revised 2/ 4/99; accepted 2/11/99.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
secretion, and proliferation. J. Immunother., 15: 91-104, 1994.
B-specific DNA binding activity: a preliminary report. Cancer Res., 54: 5424-5429, 1994.
chain and p56lck in T-cells infiltrating human renal cell carcinoma. Cancer Res., 53: 5613-5616, 1993., and granulocyte-macrophage colony stimulating factor in ovarian biopsies. Proc. Natl. Acad. Sci. USA, 89: 7708-7712, 1992.B. Science (Washington DC), 274: 784-787, 1996.B in preventing TNF- induced cell death. Science (Washington DC), 274: 782-784, 1996.This article has been cited by other articles:
|
|
 |
|
  J. H. Finke, B. Rini, J. Ireland, P. Rayman, A. Richmond, A. Golshayan, L. Wood, P. Elson, J. Garcia, R. Dreicer, et al. Sunitinib Reverses Type-1 Immune Suppression and Decreases T-Regulatory Cells in Renal Cell Carcinoma Patients Clin. Cancer Res., October 15, 2008; 14(20): 6674 - 6682. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Das, G. Sa, E. Paszkiewicz-Kozik, C. Hilston, L. Molto, P. Rayman, D. Kudo, K. Biswas, R. M. Bukowski, J. H. Finke, et al. Renal Cell Carcinoma Tumors Induce T Cell Apoptosis through Receptor-Dependent and Receptor-Independent Pathways J. Immunol., April 1, 2008; 180(7): 4687 - 4696. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Das, G. Sa, C. Hilston, D. Kudo, P. Rayman, K. Biswas, L. Molto, R. Bukowski, B. Rini, J. H. Finke, et al. GM1 and Tumor Necrosis Factor-{alpha}, Overexpressed in Renal Cell Carcinoma, Synergize to Induce T-Cell Apoptosis Cancer Res., March 15, 2008; 68(6): 2014 - 2023. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Raval, S. Biswas, P. Rayman, K. Biswas, G. Sa, S. Ghosh, M. Thornton, C. Hilston, T. Das, R. Bukowski, et al. TNF-{alpha} Induction of GM2 Expression on Renal Cell Carcinomas Promotes T Cell Dysfunction J. Immunol., May 15, 2007; 178(10): 6642 - 6652. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Krambeck, H. Dong, R. H. Thompson, S. M. Kuntz, C. M. Lohse, B. C. Leibovich, M. L. Blute, T. J. Sebo, J. C. Cheville, A. S. Parker, et al. Survivin and B7-H1 Are Collaborative Predictors of Survival and Represent Potential Therapeutic Targets for Patients with Renal Cell Carcinoma Clin. Cancer Res., March 15, 2007; 13(6): 1749 - 1756. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. H. Thompson, H. Dong, C. M. Lohse, B. C. Leibovich, M. L. Blute, J. C. Cheville, and E. D. Kwon PD-1 Is Expressed by Tumor-Infiltrating Immune Cells and Is Associated with Poor Outcome for Patients with Renal Cell Carcinoma Clin. Cancer Res., March 15, 2007; 13(6): 1757 - 1761. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. H. Thompson, H. Dong, and E. D. Kwon Implications of B7-H1 Expression in Clear Cell Carcinoma of the Kidney for Prognostication and Therapy Clin. Cancer Res., January 15, 2007; 13(2): 709s - 715s. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Biswas, A. Richmond, P. Rayman, S. Biswas, M. Thornton, G. Sa, T. Das, R. Zhang, A. Chahlavi, C. S. Tannenbaum, et al. GM2 Expression in Renal Cell Carcinoma: Potential Role in Tumor-Induced T-Cell Dysfunction. Cancer Res., July 1, 2006; 66(13): 6816 - 6825. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. H. Thompson, S. M. Kuntz, B. C. Leibovich, H. Dong, C. M. Lohse, W. S. Webster, S. Sengupta, I. Frank, A. S. Parker, H. Zincke, et al. Tumor B7-H1 Is Associated with Poor Prognosis in Renal Cell Carcinoma Patients with Long-term Follow-up. Cancer Res., April 1, 2006; 66(7): 3381 - 3385. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. B. Frey and N. Monu Effector-phase tolerance: another mechanism of how cancer escapes antitumor immune response J. Leukoc. Biol., April 1, 2006; 79(4): 652 - 662. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. H. Thompson, M. D. Gillett, J. C. Cheville, C. M. Lohse, H. Dong, W. S. Webster, K. G. Krejci, J. R. Lobo, S. Sengupta, L. Chen, et al. Costimulatory B7-H1 in renal cell carcinoma patients: Indicator of tumor aggressiveness and potential therapeutic target PNAS, December 7, 2004; 101(49): 17174 - 17179. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Donskov, H. von der Maase, N. Marcussen, S. Hamilton-Dutoit, H. H. T. Madsen, J. J. Jensen, and M. Hokland Fas Ligand Expression in Metastatic Renal Cell Carcinoma During Interleukin-2 Based Immunotherapy: No In vivo Effect of Fas Ligand Tumor Counterattack Clin. Cancer Res., December 1, 2004; 10(23): 7911 - 7916. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. C. Flanigan Debulking Nephrectomy in Metastatic Renal Cancer Clin. Cancer Res., September 15, 2004; 10(18): 6335S - 6341S. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Rayman, A. K. Wesa, A. L. Richmond, T. Das, K. Biswas, G. Raval, W. J. Storkus, C. Tannenbaum, A. Novick, R. Bukowski, et al. Effect of Renal Cell Carcinomas on the Development of Type 1 T-Cell Responses Clin. Cancer Res., September 15, 2004; 10(18): 6360S - 6366S. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. V. Thornton, D. Kudo, P. Rayman, C. Horton, L. Molto, M. K. Cathcart, C. Ng, E. Paszkiewicz-Kozik, R. Bukowski, I. Derweesh, et al. Degradation of NF-{kappa}B in T Cells by Gangliosides Expressed on Renal Cell Carcinomas J. Immunol., March 15, 2004; 172(6): 3480 - 3490. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Molto, P. Rayman, E. Paszkiewicz-Kozik, M. Thornton, L. Reese, J. C. Thomas, T. Das, D. Kudo, R. Bukowski, J. Finke, et al. The Bcl-2 Transgene Protects T Cells from Renal Cell Carcinoma-mediated Apoptosis Clin. Cancer Res., September 15, 2003; 9(11): 4060 - 4068. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Kudo, P. Rayman, C. Horton, M. K. Cathcart, R. M. Bukowski, M. Thornton, C. Tannenbaum, and J. H. Finke Gangliosides Expressed by the Renal Cell Carcinoma Cell Line SK-RC-45 Are Involved in Tumor-induced Apoptosis of T Cells Cancer Res., April 1, 2003; 63(7): 1676 - 1683. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. E. Hutson, L. Molto, T. Mekhail, P. Elson, J. Finke, C. Tannenbaum, E. Borden, R. Dreicer, T. Olencki, and R. M. Bukowski Phase I Trial of Consensus Interferon in Patients with Metastatic Renal Cell Carcinoma: Toxicity and Immunological Effects Clin. Cancer Res., April 1, 2003; 9(4): 1354 - 1360. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. C. Ibrahim, Y. Allory, F. Commo, B. Gattegno, P. Callard, and P. Paul Altered Pattern of Major Histocompatibility Complex Expression in Renal Carcinoma: Tumor-Specific Expression of the Nonclassical Human Leukocyte Antigen-G Molecule Is Restricted to Clear Cell Carcinoma While Up-Regulation of Other Major Histocompatibility Complex Antigens Is Primarily Distributed in All Subtypes of Renal Carcinoma Am. J. Pathol., February 1, 2003; 162(2): 501 - 508. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Saio, S. Radoja, M. Marino, and A. B. Frey Tumor-Infiltrating Macrophages Induce Apoptosis in Activated CD8+ T Cells by a Mechanism Requiring Cell Contact and Mediated by Both the Cell-Associated Form of TNF and Nitric Oxide J. Immunol., November 15, 2001; 167(10): 5583 - 5593. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. C. Ibrahim, N. Guerra, M.-J. T. Lacombe, E. Angevin, S. Chouaib, E. D. Carosella, A. Caignard, and P. Paul Tumor-specific Up-Regulation of the Nonclassical Class I HLA-G Antigen Expression in Renal Carcinoma Cancer Res., September 1, 2001; 61(18): 6838 - 6845. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Radoja, M. Saio, and A. B. Frey CD8+ Tumor-Infiltrating Lymphocytes Are Primed for Fas-Mediated Activation-Induced Cell Death But Are Not Apoptotic In Situ J. Immunol., May 15, 2001; 166(10): 6074 - 6083. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. R. Gastman, X.-M. Yin, D. E. Johnson, E. Wieckowski, G.-Q. Wang, S. C. Watkins, and H. Rabinowich Tumor-induced Apoptosis of T Cells: Amplification by a Mitochondrial Cascade Cancer Res., December 1, 2000; 60(24): 6811 - 6817. [Abstract] [Full Text]
|
|
|
|
|
|
M. Austin Taylor, M. Bennett, V. Kumar, and J. D. Schatzle Functional Defects of NK Cells Treated with Chloroquine Mimic the Lytic Defects Observed in Perforin-Deficient Mice J. Immunol., November 1, 2000; 165(9): 5048 - 5053. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. R. Gastman, D. E. Johnson, T. L. Whiteside, and H. Rabinowich Tumor-induced apoptosis of T lymphocytes: elucidation of intracellular apoptotic events Blood, March 15, 2000; 95(6): 2015 - 2023. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Bukowski, P. Rayman, L. Molto, C. S. Tannenbaum, T. Olencki, D. Peereboom, R. Tubbs, D. McLain, G. T. Budd, T. Griffin, et al. Interferon-{{gamma}} and CXC Chemokine Induction by Interleukin 12 in Renal Cell Carcinoma Clin. Cancer Res., October 1, 1999; 5(10): 2780 - 2789. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
) or presence ( 
) of 50 ng/ml anti-Fas monoclonal antibody (Upstate Biotechnologies). TUNEL assay was then performed to determine the level of apoptosis induced. The data presented represent the mean ± SD of five experiments. B, unstimulated (
) or medium supplemented with PMA (10 ng/ml) and ionomycin (0.75 µg/ml) for 24 h (
). The results are presented as the median percentage of apoptotic T cells. Neither normal nor patient T cells displayed any significant level of apoptosis (<5%) when freshly isolated. Patient T cells (median, 7.3%; range, 1.4–21.4%) cultured in medium alone for 24 h showed a slightly higher level of apoptosis than did T cells from normal donors (median, 4.5%; range, 4.2–7.8%); however this was not statistically significant. In contrast, patient T cells (median, 20.6%; range, 10.5–85.0%) cultured with PMA/ionomycin demonstrated significantly more apoptosis than did normal T cells (median, 5.0%; range, 2.6–6.8%; P < 0.05). In T-PBLs from one-third (6 of 18) of the RCC patients examined, stimulation resulted in >40% apoptotic T cells.