Clinical Cancer Research The Science of Cancer Health Disparities Stand Up to Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mellado, B.
Right arrow Articles by Estapé, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mellado, B.
Right arrow Articles by Estapé, J.
Clinical Cancer Research Vol. 5, 1843-1848, July 1999
© 1999 American Association for Cancer Research


Molecular Oncology, Markers, Clinical Correlates

Prognostic Significance of the Detection of Circulating Malignant Cells by Reverse Transcriptase-Polymerase Chain Reaction in Long-Term Clinically Disease-free Melanoma Patients1

Begoña Mellado2, Lorena Gutierrez, Teresa Castel, Dolors Colomer, Montserrat Fontanillas, Josefa Castro and Jordi Estapé

Medical Oncology Department [B. M., L. G., M. F., J. E.], Dermatology Department [T. C., J. C.], Hematopathology Laboratory [D. C.], Melanoma Group, and Institut de Investigacions Biomèdiques August Pi i Sunyer, Hospital Clínic, University of Barcelona, 08036 Barcelona, Spain


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The purpose of this study was to assess the prognostic significance of the detection of circulating melanoma cells by reverse transcriptase-PCR in long-term clinically disease-free melanoma patients. Patients with melanoma who were free of clinical relapse for at least 6 months after primary tumor diagnosis were included and prospectively followed. Tyrosinase mRNA in peripheral blood from these patients was assayed by reverse transcriptase-PCR at the time of their inclusion in the study. One hundred six blood samples from 57 melanoma patients were analyzed. The median time between melanoma diagnosis and inclusion in the study was 24 months (range, 7–51 months). The median follow-up time calculated from the time of inclusion in the study was 27 months (range, 11–36 months). Tyrosinase mRNA in blood was detected in 10 (17.5%) of 57 patients: 2 (18%) of 11 stage I patients, 6 (19%) of 33 stage II patients, and 2 (15%) of 13 stage III patients. Actuarial 2-year DFS was 89% for the tyrosinase-negative patients versus 30% for the positive patients (P = 0.003). Actuarial 2-year OS was 97% for the tyrosinase-negative patients versus 72% for the positive patients (P = 0.001). Tyrosinase mRNA could be detected in the blood of a proportion of long-term disease-free melanoma patients, regardless of their initial clinical stage. The presence of late circulating melanoma cells in this selected group of clinically disease-free patients was significantly associated with a subsequent high risk of relapse and death.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
There is an increasing interest in studying the clinical implications of the detection of tumor cells in the blood from patients with solid tumors. A widely used technique to achieve this purpose is RT-PCR.3 This technique is based on the amplification of tissue or tumor cell-specific mRNAs (1, 2, 3, 4, 5, 6, 7, 8, 9) .

Smith et al. (10) reported that tyrosinase mRNA could be detected by RT-PCR in the blood from melanoma patients. Tyrosinase mRNA is specifically expressed in melanocytes, Schwann cells, and melanoma cells. Because melanocytes do not circulate, the detection of tyrosinase mRNA in blood indicates the presence of circulating melanoma cells. Subsequent studies confirmed the ability to detect mRNA tyrosinase by RT-PCR in the blood of melanoma patients and investigated the potential clinical implications derived from the presence of circulating melanoma cells detected by this assay (11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22) .

Although most of the studies have been focused on the detection of circulating melanoma cells at the time of initial diagnosis, they can also be detected in blood months or years after primary tumor diagnosis (15) . However, the biological and clinical implications that may be associated with the presence of circulating malignant cells during the follow-up of melanoma patients are not known. To address the prognostic implications of the presence of late circulating melanoma cells, here we decided to investigate the presence of tyrosinase mRNA by RT-PCR in the peripheral blood from melanoma patients who where clinically free of disease for a median time of 24 months after primary tumor diagnosis. We designate the RT-PCR analysis performed here as late RT-PCR to specifically emphasize that the timing of the RT-PCR test in was different from in our previously published study, in which the blood samples were collected in the perioperative period.


    PATIENTS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patients.
Inclusion criteria were histologically documented diagnosis of melanoma and being free of clinical disease for >=6 months after primary tumor diagnosis and treatment. Exclusion criteria were a history of another malignancy or the use of systemic therapy during the month previous to inclusion in the study. Oral informed consent was obtained from each patient. The study was accepted by the Ethic Committee of the Hospital Clínic. Blood for tyrosinase RT-PCR was drawn at the same time that blood extraction was performed for a previously established follow-up: the first 20 ml of blood collected were used for standard biochemistry and cell blood counts, and the following 15–20 ml were used for RT-PCR studies. Clinical stage and past therapy were documented at the time of entry into the study. The clinical outcome of the patients was prospectively followed. Clinical staging consisted of medical history, physical exam, cell blood count, blood biochemistry, and chest X-ray. Other complementary exams were performed if they were clinically indicated. Patients with a positive RT-PCR were not subjected to a more intensive follow-up than were those with a negative RT-PCR. Clinical stage was defined based on the American Joint Committee on Cancer guidelines. Patients were visited every 4 months during the first 2 years after the diagnosis, every 6 months up to 5 years after the diagnosis, and yearly thereafter. At each follow-up time, clinical history, physical exam, blood cell count and biochemistry, and chest X-ray were performed. Patients were considered late RT-PCR positive if they had at least one positive result for tyrosinase mRNA in blood. No clinical decisions were made based on the results of the RT-PCR assay.

Samples.
Between 15 and 20 ml of blood were collected in EDTA anticoagulant from each patient. The mononuclear cell fraction of peripheral blood was isolated by Ficoll gradient as described by Boyum (23) . Total RNA was isolated from the mononuclear cell fraction by guanidinium thiocyanate extraction using the method described by Chomczynski and Sacchi (24) . Positive controls were processed separately to avoid contamination.

RT-PCR Method.
RT-PCR was performed following the manufacturers’ instructions (Life Technologies, Inc.) using 1 µg of total cellular RNA. First strand cDNA was generated with 50 ng of specific primer (HTR2), 0.5 mM dNTPs, 1 unit of RNAsin (Promega), and 200 units of murine Moloney leukemia virus reverse transcriptase (Life Technologies, Inc.) in a 20-ml final volume. A 10-µl aliquot of this reaction was used in the first round of PCR using 50 ng of each primer (HTR1 and HTR2), 1.6 mM MgCl2, 0.2 mM dNTPs, and 1.5 unit of Taq polymerase (Life Technologies, Inc.) under the following conditions: 1 cycle of 5 min at 95°C for template denaturation followed by 30 cycles of 65 s denaturation at 95°C, 65 s at 55°C for primer annealing, and 50 s for polymerase extension at 72°C. All PCRs were terminated with a 10-min extension at 70°C. For the second round of PCR, 5 µl of a 1:100 dilution of the first-round PCR product were used in combination with 50 ng of HTR3 and HTR4 primers in a 25-µl final volume. Cycling conditions were the same as the first-round PCR. Final products were electrophoresed on 2% agarose gel and analyzed by direct visualization after ethidium bromide staining. Every RT-PCR was repeated at least twice to confirm results.

For synthetic oligonucleotides, primer sequences were devised from published sequences of tyrosinase gene (9) . Outer primers were: HTYR1 (sense), TTGGCAGATTGTCTGTAGCC; and HTYR2 (antisense), AGGCATTGTGCATGCTGCT. Nested primers were: HTRY3 (sense), GTCTTTATGCAATGGAACGC; and HTYR4 (antisense), GCTATCCCAGTAAGTGGACT. The outer primers amplified a PCR product of 284 bp, and the nested primers amplified a fragment of 207 bp.

Integrity of RNA for RT-PCR assay was determined by performing parallel RT-PCRs using primers that are specific for ß-globin (10) and/or by running RNA in a 1% agarose gel. Samples that failed to show the 28S and 18S ribosomal bands were considered degraded and ineligible for the study.

Negative controls of the study were blood samples from patients with other malignancies. The human melanoma-derived cell line SK-mel 28 (American Type Culture Collection, Manassas, VA) was used as a positive control. The sensibility of our RT-PCR was determined by performing serial dilutions of SK-mel 28 cells in 107 normal mononucleated cells. With the described conditions, we were able to detect 1 SK-mel 28 cell in 106 mononucleated cells by RT-PCR and 1 SK-mel 28 cell in 107 mononucleated cells by Southern blot (Fig. 1)Citation .



View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. A, sensitivity test of the RT-PCR assay. Serial dilutions of SK-mel 28 melanoma cells from 106 to 0.1 melanoma cells per 107 normal mononucleated cells are shown. One SK-mel 28 cell was detected in 106 mononucleated cells with RT-PCR. B, autoradiograph of Southern blot of the same gel transferred to a nitrocellulose membrane showing hybridization of fluorescein-labeled tyrosinase probe of the RT-PCR positive samples. One SK-mel 28 cell was detected in 107 mononucleated cells with RT-PCR plus Southern blot.

 
Southern blot was performed to confirm that our RT-PCR amplified products were, indeed, from tyrosinase. After electrophoresis gels were transferred overnight to a nitrocellulose membrane with 20x SSC buffer. Membranes were hybridized with an oligonucleotide complementary to a region in the tyrosinase cDNA, using a using a nonisotopic fluorescein 3'-oligolabeling system (Amersham; Fig. 1BCitation ).

Statistical Analysis.
Univariate analysis of different variables (RT-PCR status, stage, Breslow, Clark, number of nodes involved, primary tumor location, growth pattern, systemic therapy, sex, age, and relapse) was performed by the {chi}2 test. DFS and OS were calculated from the time of inclusion into the study until relapse and death, respectively. DFS and OS were analyzed by the Kaplan-Meier method. Curves were compared by the log-rank test.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patients.
One hundred six blood samples from 57 melanoma patients were tested for tyrosinase mRNA in blood by RT-PCR. The median number of RT-PCR tests per patient was two (range, one to five). For patients with more than one test, the median interval between different blood extractions was 6 months (range, 4–12 months), depending on previously established standard follow-up schedule for each patient. Blood from eight controls (eight patients with breast cancer) was also examined. Patients’ characteristics and prior treatments are described in Table 1Citation . Clinical stages were: stage I, 11 patients; stage II, 33 patients; and stage III, 13 patients. The median interval between tumor diagnosis and late RT-PCR test was 24 months (range, 7–51 months): 23 months (range, 10–51 months) for the positive patients and 25 months (range, 7–48 months) for the negative patients. The patients were then followed for a median time (calculated from the inclusion in the study) of 27 months (range, 11–36 months). Median follow-up time, calculated from primary diagnosis, was 49 months (range, 18–91 months).


View this table:
[in this window]
[in a new window]

 
Table 1 Patients’ characteristics

 
Late RT-PCR and Clinical Features.
RNA samples that showed the 28S and 18S ribosomal bands were considered eligible for the study (Fig. 2A)Citation . Samples showing a band of 207 bp after a second round of amplification with nested primers were considered positive (Fig. 2B)Citation . Using the same RT-PCR technique, we previously reported (16) no false-positive results among 50 samples from nonmelanoma control patients (20 healthy subjects and 30 patients with other cancers). In this study, we performed RT-PCR tyrosinase analysis in blood samples from eight breast cancer control patients. All of them tested negative. Hence, no illegitimate transcription in the hematopoietic cells was observed among the nonmelanoma controls with the experimental conditions used.



View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. A, RNA samples showing 28S and 18S ribosomal bands were considered eligible for the study. B, RT-PCR products visualized in a 2% agarose gel with ethidium bromide staining, showing a 207-bp band after second round of amplification with nested primers for the positive samples. Lanes 1–8, RNA from melanoma patients; Lane 9, negative control; Lane 10, positive control (SK-mel 28 cell line); Lane 11, 100-bp DNA ladder.

 
Here, 18 (16%) of 106 blood samples were positive for tyrosinase. Circulating melanoma cells were detected in 10 (17.5%) of 57 patients: 2 (18%) of 11 stage I patients, 6 (19%) of 33 stage II patients, and 2 (15%) of 13 stage III patients. One stage IV patient, who was rendered disease free after surgical treatment, tested negative. The percentage of late RT-PCR positivity did not correlate with clinical stage (P = 0.9). This finding is in contrast with our previous study, in which the percentage of RT-PCR positivity at the time of initial diagnosis positively correlated with stage (16) . There was no correlation between late RT-PCR results and Breslow, Clark, tumor site, histology, sex, or age.

Stage IIB and III patients were candidates for receiving adjuvant chemotherapy following the protocols of our institution during the period of accrual of this study. Thirty-three patients (13 stage III and 20 stage II patients) received adjuvant systemic chemotherapy after surgery. The median interval between the end of chemotherapy and the late RT-PCR test was 16 months (range, 2–57 months). All stage III and 20 of 33 stage II patients received adjuvant chemotherapy before being analyzed by late RT-PCR (Table 2)Citation . The possible effect of chemotherapy on the rate of detection of circulating melanoma cells could not be assessed in stage III patients because all of them received adjuvant chemotherapy. In stage IIB, there were no differences between the percentage of positivity between the patients treated or not with chemotherapy: 4 (20%) of 20 patients who were treated with chemotherapy were positive versus 2 (14%) of 13 who were not treated with adjuvant chemotherapy.


View this table:
[in this window]
[in a new window]

 
Table 2 Late RT-PCR results by stagea

 
Late RT-PCR and Prognosis.
At the time of this analysis, 11 (19%) of 57 patients had relapsed [5 (50%) of 10 positive versus 6 (13%) of 47 negative patients, P = 0.01] and 4 (7%) of 57 patients had died from melanoma dissemination [3 (30%) of 10 positive and 1 (2%) of 47 negative patients, P = 0.01]. There were no relapses in stage I patients. In stage II, only 2 (7%) of 27 patients with a negative late RT-PCR test relapsed versus 3 (50%) of 6 patients with a positive result. In Stage III, 4 (36%) of 11 patients with a negative late RT-PCR relapsed versus 2 (100%) of 2 late RT-PCR-positive patients (Table 3)Citation . The median interval between the detection of a positive RT-PCR result and the diagnosis of clinical relapse was 8.5 months (range, 1–24 months). For the group with a negative tyrosinase test, the median time between the negative RT-PCR and the diagnosis of recurrence of the disease was 12 months (range, 4–25 months).


View this table:
[in this window]
[in a new window]

 
Table 3 Late RT-PCR results and relapsea

 
The RT-PCR positivity for tyrosinase mRNA in blood during the follow-up of patients with melanoma significantly correlated with a lower DFS and OS, calculated from the time of inclusion in the study. The median DFS was not reached for the group of patients testing negative for tyrosinase in blood, whereas it was 24 months for the positive patients. Actuarial 2-year DFS was 89% for the negative patients versus 30% for the positive patients (P = 0.003; Fig. 3Citation ). Median OS was not reached for either the group of patients who tested negative or the positive patients. Actuarial 2-year OSs were 97 and 72% for the negative and positive patients, respectively (P = 0.001;Fig. 4Citation ).



View larger version (9K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Late RT-PCR result and DFS in patients with stage I–III melanoma. DFS was calculated by the Kaplan-Meier method. The statistical significance of the difference in DFS in late RT-PCR-negative versus late RT-PCR-positive patients was calculated by the log-rank test.

 


View larger version (8K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Late RT-PCR result and OS in patients with stage I–III melanoma. OS was calculated by the Kaplan-Meier method. The statistical significance of the difference in OS in late RT-PCR-negative versus late RT-PCR-positive patients was calculated by the log-rank test.

 
RT-PCR Results at Diagnosis and in Long-Term Disease-free Patients.
In our previous study (16) , blood samples from 56 stage I–III melanoma patients were evaluated for tyrosinase RT-PCR during the perioperative period. Twenty-four of these 56 patients were disease free for at least 6 months postsurgery and available for follow-up at Hospital Clínic during the accrual of this study. These 24 patients were included in this study of late RT-PCR and allow to analyze the dynamic changes in individual patients of their RT-PCR results at diagnosis and at late follow-up. In these 24 patients, the median time between the RT-PCR test at diagnosis and late RT-PCR was 24 months (range, 7–36 months). Clinical stage and initial RT-PCR results were the following: eight stage I (three positive and five negative), seven stage II (two positive and five negative), and nine stage III (three positive and six negative). Six of the eight positive patients became negative when tested beyond 6 months of surgery. The two persistently positive tests were observed in two stage I patients and they were free of relapse at 48 and 59 months postsurgery. Two of the negative patients at diagnosis had a positive test during follow-up and subsequently relapsed. Overall, at diagnosis, 8 (33%) of 24 patients were positive, whereas only 4 (16%) tested positive during late follow-up. Of the 10 patients who had a positive test either at diagnosis and/or during follow-up, 5 (50%) experienced a relapse. In contrast, only 1 (7%) of the 14 persistently negative patients relapsed (P = 0.05).


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this report, we show that circulating melanoma cells, detected by tyrosinase mRNA amplification by RT-PCR in peripheral blood, were present in a proportion of long-term clinically disease-free melanoma patients and that the presence of late circulating melanoma cells predicted a subsequent high risk of relapse and death.

The clinical value of detection of circulating melanoma cells by RT-PCR has been investigated by several groups (11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21) . In some studies, the RT-PCR positivity at diagnosis correlated with increased clinical stage (11 , 13, 14, 15, 16, 17) and other known prognostic factors (17) . In patients with metastatic disease, the positivity of the test correlated with lower patient survival (18) , the presence of visceral metastasis (19) , or higher serum lactate dehydrogenase levels (20) . The prognostic significance of the detection of melanoma cells in blood by RT-PCR during the perioperative period has been reported by several groups (14, 15, 16 , 21) . In our previous study, RT-PCR positivity was an independent prognostic factor for recurrence in stage II and III (16) . In other two studies, the RT-PCR positivity after surgical treatment (21) or during the 3 first months after diagnosis (15) was an independent prognostic factor for survival.

Here, we specifically studied long-term disease-free melanoma patients to assess the clinical significance of the detection of late circulating melanoma cells. The first finding from our data were that the percentage of positivity for tyrosinase mRNA in peripheral blood among different stages of disease was lower than the observed in our previous series. In our late RT-PCR study, we detected mRNA tyrosinase in 17% of patients, whereas in our initial report, RT-PCR was positive in 40% of stage I–III patients (16) . This finding was not unexpected because we assayed blood from a selected group of "good prognosis" patients who were free of clinical disease after a median time after tumor diagnosis of 2 years. In addition, we cannot rule out that, in our initial report, in which blood was drawn in the perioperative period, the surgical procedures caused the shedding of tumor cells into the peripheral blood in some patients, as has been proposed by other groups (15) . In contrast with our published perioperative RT-PCR report (16) , late RT-PCR positivity did not correlate with tumor stage. This difference might be due to the natural selection process implied by the inclusion criteria of this study.

To assess the impact of late RT-PCR on prognosis, we followed our series of patients for a median of 27 months after inclusion in the study. A positive test for tyrosinase mRNA in blood during the long-term follow-up of patients with melanoma was significantly correlated with a higher risk of relapse and death from melanoma dissemination. In a recent study (15) , blood samples from 276 melanoma patients were tested for tyrosinase and MART-1 mRNAs at multiple, sequential time points for at least 2 years from surgery. In agreement with our data, a low incidence of RT-PCR positivity was observed, even up to 2 years after surgery. This occurred both in patients who had been continuously positive and in patients who had developed positive results after several negative tests. Given the short follow-up of the patients, the authors could not assess the prognostic significance of their late RT-PCR-positive results and, consequently, could not exclude that these were false-positive tests. However, the poor prognosis observed in our group of patients with a late RT-PCR positive result presented here suggest that these positivities are due to the presence of melanoma cells in the circulation in long-term disease free patients rather than false-positive tests.

Our study did not address whether the late circulating melanoma cells are shed from occult micrometastases present in secondary organs such as bone marrow. It would have been of interest to have parallel blood and bone marrow samples to study this issue. In this regard, Ghossein et al. (21) reported a significant correlation between blood and bone marrow detection of tyrosinase mRNA in melanoma patients after surgical treatment. On the basis of this observation, it is reasonable to speculate that the late circulating melanoma cells detected in our patients can be shed from secondary organs. If this were true, then the presence of circulating malignant cells in the setting of long-term clinically disease-free melanoma patients would be a marker, rather than a cause, of the existence of micrometastatic disease.

Our clinical findings give further support to the view of melanoma as a systemic disease and that a potential end point of adjuvant systemic immunotherapy could be to maintain patients with undetectable malignant cells in peripheral blood. Because most of our patients received prior adjuvant chemotherapy, we cannot analyze the potential impact of systemic chemotherapy in the RT-PCR results. In addition, the benefit of adjuvant chemotherapy in melanoma remains unproven (25) .

Recent publications show that adjuvant treatment with IFN (26) or anti-GM2 antibodies (27) could increase the survival of stage II and III melanoma patients. The development of effective adjuvant treatments, which are associated to significant toxicity and economic cost, highlights the urgent need to find prognostic factors to select those patients who are more likely to benefit from such treatments. Our data suggest that circulating melanoma cells are markers of a high relapse risk, whether detected at the time of diagnosis (16) or during late follow-up. Further studies using mRNA tyrosinase in blood to analyze its prognostic value during patient follow-up and as a surrogate marker of the effectiveness of systemic adjuvant therapy are warranted. Our group is currently investigating if the tyrosinase mRNA amplification by RT-PCR could be useful for monitoring the efficacy of adjuvant IFN therapy in stage II and III melanoma patients.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Instituto para el Desarrollo Científico y Tecnológico, Programa I+D. L. G. was supported by Amgen (1996) and a Research Grant from Asociación Española de la Lucha Contra el Cáncer (1997). Back

2 To whom requests for reprints should be addressed, at Medical Oncology Department, Hospital Clínic, University of Barcelona, C/Villa-rroel, 170, 08036 Barcelona, Spain. Phone: 34-93-2275402; Fax: 34-93-2275454; E-mail: 26503 6 mg{at}comb.es Back

3 The abbreviations used are: RT-PCR, reverse transcriptase-PCR; DFS, disease-free survival; OS, overall survival. Back

Received 12/ 1/98; revised 2/22/99; accepted 3/22/99.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Naito H., Kuzumaki N., Uchino J-I., Kobayashy R., Shikano T., Ishikawa Y., Matsumoto S. Detection of tyrosine hydroxylase mRNA and minimal neuroblastoma cells by the reverse transcription-polymerase chain reaction. Eur. J. Cancer, 27: 762-765, 1991.
  2. Mattano L. A., Moss T. J., Emerson S. G. Sensitive detection of rare circulating neuroblastoma cells by the reverse transcriptase-polymerase chain reaction. Cancer Res, 52: 4701-4705, 1992.[Abstract/Free Full Text]
  3. Datta I. H., Adams P. T., Drobyski W. R., Ethier S. P., Terry V. H., Roth M. S. Sensitive detection of occult breast cancer by the reverse-transcriptase polymerase chain reaction. J. Clin. Oncol., 12: 475-482, 1994.[Abstract]
  4. Moreno J. G., Croce C. M., Fischer R., Monne M., Vihko P., Mulholland S. G., Gomella L. G. Detection of hematogenous micrometastasis in patients with prostate cancer. Cancer Res., 52: 6110-6112, 1992.[Abstract/Free Full Text]
  5. Seiden M. V., Kantoff P. W., Krithivas K., Propert K., Bryant M., Haltom E., Gaynes L., Kaplaw I., Bubley G., De Wolf W. Detection of circulating tumor cells in men with localized prostate cancer. J. Clin. Oncol., 12: 2634-2639, 1994.[Abstract/Free Full Text]
  6. Komeda T., Fukuda Y., Sando T., Kita R., Furukawa M., Nishida N., Amenomori M., Nakao K. Sensitive detection of circulating hepatocellular carcinoma cells in peripheral venous blood. Cancer (Phila.), 75: 2214-2219, 1995.[Medline]
  7. Matsumura M., Niwa Y., Kato N., Shiina S., Kawase T., Toyoshima H., Ihori M., Shiratori Y. Detection of {alpha}-protein mRNA, an indicator of hematogenous spreading hepatocellular carcinoma, in the circulation: a possible predictor of metastatic hepatocellular carcinoma. Hepatology, 20: 1418-1425, 1995.
  8. Hillaire S., Barbu V., Boucher E., Moukhtar M., Poupow R. Albumin messenger RNA as a marker of circulating hepatocytes in hepatocellular carcinoma. Gastroenteroloy, 106: 239-242, 1994.[Medline]
  9. Gerhard M., Juhl M., Kalthoff H., Schreiber H. W., Wagener C., Neumaier M. Specific detection of carcinoembryonic antigen-expressing tumor cells in bone marrow aspirates by polymerase chain reaction. J. Clin. Oncol., 12: 725-729, 1994.[Abstract]
  10. Smith B., Selby P., Southgate J., Pittman K., Bradley C., Blair G. E. Detection of melanoma cells in peripheral blood by means of reverse transcriptase and polymerase chain reaction. Lancet, 338: 1227-1229, 1991.[Medline]
  11. Hoon D. S. B., Wang Y., Dale P. S., Conrad A. J., Schmid P., Garrison D., Kuo C., Foshag L. J., Rizze A. J., Morton D. L. Detection of occult melanoma cells in blood with a multiple-marker polymerase chain reaction assay. J. Clin. Oncol., 13: 2109-2116, 1995.[Abstract/Free Full Text]
  12. Brossart P., Keilholz U., Willhauck M., Scheibenbogen C., Mohler T., Hunstein W. Hematogenous spread of malignant melanoma cells in different stages of disease. J. Invest. Dermatol., 101: 887-890, 1993.[Medline]
  13. Brossart P., Shmier J. W., Krüger S., Willhauck M., Scheibenbogen C., Mohler T., Keilholz V. A polymerase chain reaction-based semiquantitative assessment of malignant melanoma cells in peripheral blood. Cancer Res., 55: 4065-4068, 1995.[Abstract/Free Full Text]
  14. Battayanni Z., Grob J., Xerri L. PCR detection of circulating melanocytes as a prognostic marker in patients with melanoma. Arch. Dermatol., 131: 443-447, 1995.[Abstract]
  15. Curry B. J., Myers K., Hersey P. Polymerase chain reaction detection of melanoma cells in the circulation: relation to clinical stage, surgical treatment and recurrence from melanoma. J. Clin. Oncol., 16: 1760-1769, 1998.[Abstract]
  16. Mellado B., Colomer D., Castel T., Muñoz M., Carballo E., Galán M., Moscero J. M., Lives-Corrons J. L., Grau J. J., Estopi J. Detection of circulating neoplastic cells by RT-PCR in malignant melanoma. Correlation with clinical stage and prognosis. J. Clin. Oncol., 14: 2091-2097, 1996.[Abstract/Free Full Text]
  17. Farthmann B., Ebverle J., Krasagakis K., Gstottner M., Wang N., Bisson S., Orfanes C. E. RT-PCR for tyrosinase-mRNA-positive cells in peripheral blood: evaluation strategy and correlation with known prognostic markers in 123 melanoma patients. J. Invest. Dermatol., 110: 263-267, 1998.[Medline]
  18. Kunter U., Buer J., Probst M., Dvernsing S., Dallmann I., Grosse J., Kirchner H., Schluepen E. M., Volkenandt M., Ganser A., Atzpidien J. Peripheral blood tyrosinase messenger RNA detection and survival in malignant melanoma. J. Natl. Cancer Inst. (Bethesda), 88: 590-594, 1996.[Abstract/Free Full Text]
  19. Glaser R., Rass K., Seiter S., Hauschild A., Christophers E., Tilgen W. Detection of circulating melanoma cells by specific amplification of tyrosinase complementary DNA is no a reliable tumor marker in melanoma patients. J. Clin. Oncol., 15: 2828-2825, 1997.
  20. Jung F. A., Buzaid A. C., Ross M. I., Woods K. V., Lee J. J., Albitar M., Grimm E. S. Evaluation of tyrosinase mRNA as a tumor marker in the blood of melanoma patients. J. Clin. Oncol., 15: 2826-2831, 1997.[Abstract]
  21. Ghossein R. A., Coit D., Brennan M., Zhang F. Z., Wang Y., Bhattacharya S., Houghtoin A., Rosai J. Prognostic significance of peripheral blood and bone marrow tyrosinase mRNA in malignant melanoma. Clin. Cancer Res., 4: 419-428, 1998.[Abstract/Free Full Text]
  22. Saiki R. K., Gelfand D., Stoffel S., et al Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science (Washington DC), 230: 1350-1354, 1985.[Abstract/Free Full Text]
  23. Boyum A. Separation of leukocytes from blood and bone marrow. Scand. Clin. Invest., 21: 51-55, 1968.
  24. Chomczynski P., Sacchi N. Single-step method for RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156-159, 1987.[Medline]
  25. Barth A., Morton D. L. The role of adjuvant therapy in melanoma management. Cancer (Phila.), 75: 726-734, 1995.[Medline]
  26. Kirkwood J. M., Strawderman M. H., Ernstoff M. S., Smith T. J., Borden E. C., Blum R. H. Interferon {alpha}-2b adjuvant therapy of high-risk resected cutaneous melanoma. J. Clin. Oncol., 14: 7-17, 1996.[Abstract]
  27. Livingston P. O., Wong G. Y. C., Adluri S., Tao Y., Padavan M., Parente R., Hanlow C., Calves M. J., Helling F., Ritter G. Improved survival in stage III melanoma patients with GM2 antibodies. A randomized trial of adjuvant vaccination with GM2 ganglioside. J. Clin. Oncol., 12: 1036-1044, 1994.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
S. Mocellin, D. Hoon, A. Ambrosi, D. Nitti, and C. R. Rossi
The Prognostic Value of Circulating Tumor Cells in Patients with Melanoma: A Systematic Review and Meta-analysis
Clin. Cancer Res., August 1, 2006; 12(15): 4605 - 4613.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
K. Koyanagi, S. J. O'Day, R. Gonzalez, K. Lewis, W. A. Robinson, T. T. Amatruda, H.-J. Wang, R. M. Elashoff, H. Takeuchi, N. Umetani, et al.
Serial Monitoring of Circulating Melanoma Cells During Neoadjuvant Biochemotherapy for Stage III Melanoma: Outcome Prediction in a Multicenter Trial
J. Clin. Oncol., November 1, 2005; 23(31): 8057 - 8064.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
U. Keilholz, P. Goldin-Lang, N. E. Bechrakis, N. Max, A. Letsch, A. Schmittel, C. Scheibenbogen, K. Heufelder, A. Eggermont, and E. Thiel
Quantitative Detection of Circulating Tumor Cells in Cutaneous and Ocular Melanoma and Quality Assessment by Real-Time Reverse Transcriptase-Polymerase Chain Reaction
Clin. Cancer Res., March 1, 2004; 10(5): 1605 - 1612.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
T. El-Hefnawy, S. Raja, L. Kelly, W. L. Bigbee, J. M. Kirkwood, J. D. Luketich, and T. E. Godfrey
Characterization of Amplifiable, Circulating RNA in Plasma and Its Potential as a Tool for Cancer Diagnostics
Clin. Chem., March 1, 2004; 50(3): 564 - 573.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
J. Szenajch, B. Jasinski, A. Synowiec, J. Kulik, M. Chomicka, J. Struzyna, Z. Nowecki, P. Rutkowski, W. Ruka, W. Kupsc, et al.
Prognostic Value of Multiple Reverse Transcription-PCR Tyrosinase Testing for Circulating Neoplastic Cells in Malignant Melanoma
Clin. Chem., September 1, 2003; 49(9): 1450 - 1457.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. A. Wascher, D. L. Morton, C. Kuo, R. M. Elashoff, H.-J. Wang, M. Gerami, and D. S.B. Hoon
Molecular Tumor Markers in the Blood: Early Prediction of Disease Outcome in Melanoma Patients Treated With a Melanoma Vaccine
J. Clin. Oncol., July 1, 2003; 21(13): 2558 - 2563.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. R. Reynolds, J. Albrecht, R. L. Shapiro, D. F. Roses, M. N. Harris, A. Conrad, A. Zeleniuch-Jacquotte, and J.-C. Bystryn
Changes in the Presence of Multiple Markers of Circulating Melanoma Cells Correlate with Clinical Outcome in Patients with Melanoma
Clin. Cancer Res., April 1, 2003; 9(4): 1497 - 1502.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J. P. Dutcher
The Prognostic Role of Detection of Circulating Melanoma Cells in the Blood
J. Clin. Oncol., March 1, 2003; 21(5): 757 - 759.
[Full Text] [PDF]


Home page
JCOHome page
G. Palmieri, P. A. Ascierto, F. Perrone, S. M.R. Satriano, A. Ottaiano, A. Daponte, M. Napolitano, C. Caraco, N. Mozzillo, M. T. Melucci, et al.
Prognostic Value of Circulating Melanoma Cells Detected by Reverse Transcriptase-Polymerase Chain Reaction
J. Clin. Oncol., March 1, 2003; 21(5): 767 - 773.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
G. Schleiermacher, M. Peter, O. Oberlin, T. Philip, H. Rubie, F. Mechinaud, D. Sommelet-Olive, J. Landman-Parker, D. Bours, J. Michon, et al.
Increased Risk of Systemic Relapses Associated With Bone Marrow Micrometastasis and Circulating Tumor Cells in Localized Ewing Tumor
J. Clin. Oncol., January 1, 2003; 21(1): 85 - 91.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
B. Mellado, M. del Carmen Vela, D. Colomer, L. Gutierrez, T. Castel, L. Quinto, M. Fontanillas, N. Reguart, J. M. Domingo-Domenech, C. Montagut, et al.
Tyrosinase mRNA in Blood of Patients With Melanoma Treated With Adjuvant Interferon
J. Clin. Oncol., October 1, 2002; 20(19): 4032 - 4039.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
U. Reinhold, C. Berkin, A.-K. Bosserhoff, A. Deutschmann, C. Garbe, R. Glaser, R. Hein, G. Krahn, R. U. Peter, G. Rappl, et al.
Interlaboratory Evaluation of a New Reverse Transcriptase Polymerase Chain Reaction-Based Enzyme-Linked Immunosorbent Assay for the Detection of Circulating Melanoma Cells: A Multicenter Study of the Dermatologic Cooperative Oncology Group
J. Clin. Oncol., March 15, 2001; 19(6): 1723 - 1727.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
I. Miyashiro, C. Kuo, K. Huynh, A. Iida, D. Morton, A. Bilchik, A. Giuliano, and D. S.B. Hoon
Molecular Strategy for Detecting Metastatic Cancers with Use of Multiple Tumor-specific MAGE-A Genes
Clin. Chem., March 1, 2001; 47(3): 505 - 512.
[Abstract] [Full Text] [PDF]


Home page
Arch DermatolHome page
H. Tsao, U. Nadiminti, A. J. Sober, and M. Bigby
A Meta-analysis of Reverse Transcriptase-Polymerase Chain Reaction for Tyrosinase mRNA as a Marker for Circulating Tumor Cells in Cutaneous Melanoma
Arch Dermatol, March 1, 2001; 137(3): 325 - 330.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
B. S. Sorensen, H. Schmidt, H. von der Maase, P. T. Straten, and E. Nexo
Quantification of Melanoma Cell-specific MART-1 mRNA in Peripheral Blood by a Calibrated Competitive Reverse Transcription-PCR
Clin. Chem., December 1, 2000; 46(12): 1923 - 1928.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J.-J. Lu, Y. Kakehi, T. Takahashi, X.-X. Wu, T. Yuasa, T. Yoshiki, Y. Okada, T. Terachi, and O. Ogawa
Detection of Circulating Cancer Cells by Reverse Transcription-Polymerase Chain Reaction for Uroplakin II in Peripheral Blood of Patients with Urothelial Cancer
Clin. Cancer Res., August 1, 2000; 6(8): 3166 - 3171.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
D. S. B. Hoon, P. Bostick, C. Kuo, T. Okamoto, H.-J. Wang, R. Elashoff, and D. L. Morton
Molecular Markers in Blood as Surrogate Prognostic Indicators of Melanoma Recurrence
Cancer Res., April 1, 2000; 60(8): 2253 - 2257.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mellado, B.
Right arrow Articles by Estapé, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mellado, B.
Right arrow Articles by Estapé, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online