| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Oncology, Markers, Clinical Correlates |
Henry Ford Midwest Neuro-Oncology Center [S. A. R., S. D., S. G.] and the Departments of Neurosurgery [S. A. R., S. D., S. G.] and Neuropathology [J. A. G.], Henry Ford Health Sciences Center, Detroit, Michigan 48202
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
SDF1 is a highly conserved gene localized to chromosome 10q11.1
(2)
. The gene encodes two isoforms, SDF1-
and SDF1-ß,
that arise from alternative splicing. These isoforms differ only in
that SDF1-ß contains four additional 3' amino acids (2)
.
In all tissues examined to date, SDF1- mRNA predominates
(2)
. The SDF1 cytokines belong to the intercrine CXC
chemokine subfamily, so designated because they have four conserved
cysteines that form two essential disulfide bonds, with the first two
cysteines separated by one amino acid (3)
. SDF1 was
originally described as pre-B cell growth-stimulating factor and
implicated in lymphocyte maturation (4)
. Human SDF1 is
chemotactic for T lymphocytes, monocytes, and neutrophils
(5)
. However, its expression is not restricted to the
leukocyte lineage, with high levels of message found in the human
pancreas, spleen, ovary, and small intestine, and lower levels
associated with the brain, colon, and placenta (2)
.
Evidence implicating SDF1 in a broader role in development was obtained
from mice lacking the SDF1 gene. These mice die perinatally and not
only have severely impaired lymphopoiesis and abnormally low numbers of
B-cell and myeloid bone-marrow precursors, as expected, but also
display a defective ventricular septum of the heart (6)
and defects in the central nervous system (7)
, suggesting
that SDF1 may play a role in diverse cellular aspects during
morphogenesis and development.
The SDF1s exert their influence by interaction with the seven-transmembrane G protein-coupled receptor CXCR4 localized to chromosome 2q2 (8) . CXCR4 was first identified as HM89, a novel cDNA that was amplified using degenerate primers made against leukocyte chemotactic factor receptors (9) , and was subsequently cloned by other groups and named LESTR (10) . When LESTR was found to be the cofactor necessary to fuse HIV-1 and CD4+ cells, it was given the name fusin (11) . Once the ligand for the receptor was identified as SDF1, a CXC chemokine family member, it was renamed CXCR4. The expression of CXCR4 in T lymphocytes, monocytes, and neutrophils (3) mediates the chemotactic response to SDF1 by these cells. However, as observed with SDF1, expression is not restricted to leukocytes. Expression is reported in human neurons (12) , cultured rodent neurons, glial cells (13 , 14) , microglial cells (14) , and endothelial cells (15 , 16) . Recently, CXCR4 expression was observed to be up-regulated in glioblastoma, the inhibition of which impeded cell proliferation in vitro (17 , 18) . CXCR4 also plays a role in AIDS. CXCR4 is the cofactor necessary for the CD4+-mediated infection of T cells by the HIV virus (19) . This entry can be inhibited specifically by SDF1 (20 , 21) . SDF1/CXCR4 interactions are also implicated in the modulation of the immune response by inducing macrophage-mediated apoptosis of CD8+ T cells (22 , 23) . As observed in SDF1-deficient mice, those mice lacking CXCR4 also exhibit hematopoietic, cardiac, and cerebellar defects (7 , 24) .
Thus, this chemokine-receptor interaction has been implicated in the modulation of cell migration in morphogenesis and development in vivo, in cell proliferation in vitro, in HIV infection, and in modulation of the immune response. Although the signaling pathways that affect these events are not well understood, SDF1 appears to activate distinct signaling pathways that may mediate each of these responses (25, 26, 27) .
In this study, we identified SDF1 as a gene that is differentially expressed among GBMs with varying histomorphological features. We further characterized both SDF1 and CXCR4 expression immunohistochemically in normal brain and astrocytomas of all grades. Our data indicate that SDF1 and CXCR4 expressions increase with tumor grade. Their colocalization to predictable areas within the tumor suggests that their interactions may contribute to angiogenesis and/or modulation of the immune response.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Primary Cell Culture Selection.
Six primary GBM cell cultures were selected by assessment of the
histopathology of the corresponding tumors according to the WHO
classification system (28)
. Although all tumors met the
requirements necessary for the diagnosis of GBM, the tumors selected
ranged in presentation from morphologically more homogeneous to
morphologically more heterogeneous, with extensive angiogenesis and
necrosis. We used primary cultures instead of the bulk frozen tumor
tissue to eliminate contamination from normal tissue. The primary cell
cultures derived from the selected tumors were used for the
differential display analysis.
Differential Display and Gene Identification.
Total RNA was extracted from the six GBM primary cell cultures by the
guanidinium thiocyanate extraction procedure for Northern blot analysis
as described previously (29)
and for differential display.
Total RNA (6 µg) was treated with 1 unit of DNase I in the presence
of 1–3 units of RNase inhibitor at 37°C for 30 min in DNase buffer
[0.1 M sodium acetate (pH 5.0) and 5 mM
MgSO4]. Purified total RNA (approximately 0.2
µg) was reverse-transcribed by Superscript II (Life Technologies,
Inc.) using T12 MN primers (Genhunter). First-strand cDNA was treated
for 15 min with RNase H before PCR amplification with arbitrary 10-mers
in the presence of -dATP. PCR parameters were 40 cycles of 94°C
for 30 s, 40°C for 2 min, and 72°C for 30 s. PCR
amplification of each sample was performed in triplicate. PCR products
were fractionated on a 7.6% denaturing polyacrylamide gel. Gels were
exposed to X-ray film overnight. Candidate fragments were isolated from
the gel and PCR-amplified as described above. Amplified fragments were
labeled with 32P using a random priming kit (Life
Technologies, Inc.) and hybridized to Northern blots of total RNA from
the primary cell cultures. Differential display fragments that
exhibited differential expression between the more aggressive
versus less aggressive primary cell cultures were cloned
into pGEM-T vector (Promega). Cloned fragments were reprobed to ensure
that the pattern of expression and the size of the transcript were the
same as those observed with the initial probing. Clones were then
sequenced using Sequenase version 2.0 kit (United States Biochemical)
according to the manufacturer’s instructions. Sequences were then
submitted to GenBank for gene identification.
Quantitative PCR.
RT-PCR was performed on the same RNA samples used to perform the
differential display. First-strand cDNA synthesis was generated using
Superscript II (Life Technologies, Inc.) and T12 MN primers
(Genhunter). First-strand cDNA was treated with RNase H for 15 min
before PCR. SDF1-specific primers were synthesized (Genosys) as
follows: (a) 5' primer, ATGAACGCCAAGGTCGTGGTC; and
(b) 3' primer, GGTCTGTTGTGCTTACTTGTTT. The 305-bp fragment
generated by these primers was cloned into pGEM-T (Promega) and
sequenced. Primers specific for GAPDH (Clontech) were used as an
internal control. PCR conditions were as follows: denaturation at
94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 57°C
for 30 s, and 72°C for 1 min. Primers for GAPDH were
added to each of the SDF1 PCR samples after cycle 7 of the reaction.
The DNA was visualized on an agarose gel with ethidium bromide
staining. Images of four replicate gels were obtained. The images were
digitally captured using an image analysis system (UVP,
Inc., San Gabriel, CA) and densitometrically quantitated using
the NIH image analysis software program as described previously
(29)
.
Immunohistochemistry.
Formalin-fixed, paraffin-embedded 5-µm tissue sections of normal
brain specimens (tumor-adjacent brain tissues taken at the time of
surgery) and tumors were used for immunohistochemical analyses, as
reported previously (29
, 30)
, with minor changes. Sections
were subjected to routine deparaffinization and rehydration, and the
subsequent steps were performed at room temperature unless otherwise
specified. Sections were incubated for 10 min in 3% hydrogen peroxide
in distilled water and washed in PBS three times for 5 min. Slides were
then immersed in 10 mM sodium citrate buffer (pH 6.0),
boiled for 10 min on a hot plate, and then allowed to cool for 20 min.
Sections were rinsed in PBS solution and incubated with 10% normal
horse serum in PBS for 30 min. The sections were then incubated
overnight at 4°C with a 1:1000 dilution (0.2 µg/ml) of primary
anti-SDF1 antibody or a 1:400 dilution (0.5 µg/ml) of primary
anti-CXCR4 antibody (Santa Cruz Biotechnology) in PBS. After three
washes in PBS buffer, the sections were incubated for 30 min with
biotinylated secondary antibody (1:200 dilution in PBS), and washed and
incubated for 45 min with the avidin-biotin complex according to
manufacturer’s instructions (Vectastain ABC kit; Vector Laboratories,
Burlingame, CA). Finally, the sections were washed and reacted with
diaminobenzidine in 0.1 M Tris buffer (pH 7.6) with 0.03%
hydrogen peroxide, rinsed in tap water, counterstained, and mounted.
Controls were performed by omitting the primary SDF1 and CXCR4
antibodies or by substituting the primary antibodies with goat IgG
isotype. Slides were blindly reviewed and scored by a neuropathologist.
Staining intensity was graded as negative (-), weak (0.5+ and +),
moderate (++ and +++), or strong (++++, +++++, and ++++++). MIB-1
(Immunotech, Marseilles, France) immunohistochemistry was performed
with a 1:600 dilution as described above. Western blot analysis of
tumor cell lysates using both anti-SDF1 and anti-CXCR4 antibodies was
performed as reported previously (29)
and demonstrated
specificity for the respective proteins (data not shown).
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. They
were ordered from the histomorphologically most homogeneous to the most
heterogeneous, based on the extent of angiogenesis and necrosis, as
follows: (a) HF360; (b) HF268; (c)
HF435; (d) HF50; (e) HF5; and (f)
HF287. The corresponding primary cell cultures were used in the
differential display analysis to identify genes differentially
expressed between these tumors.
|
SDF1 was then quantitated in the GBM primary cell cultures by RT-PCR
using SDF1 sequence-specific primers and GAPDH internal control
primers. The primary cell cultures were ranked (Fig. 2)
according to their levels of SDF1,
from the lowest to the highest, as follows: (a) HF50;
(b) HF268 = HF435; (c) HF287 = HF360;
and (d) HF5, with an approximate 5-fold difference between
the lowest and highest levels (Fig. 2)
. These data indicated that the
differential display had indeed identified a gene that was
differentially expressed between the primary cell cultures. However,
because the primary cell cultures represented only a subpopulation of
the tumor cells that grow out in culture, we next examined the in
vivo immunohistochemical localization of SDF1 and its receptor,
CXCR4, in the tumor sections.
|
; Table 1
). These cellular tumors were the most
histomorphologically homogeneous of the six GBMs, displaying frequent
mitoses and vascular proliferation, but no necrosis. A striking
increase in both SDF1 (3+ and 5+) and CXCR4 (2+) was observed in tumors
HF435 and HF50 (Fig. 3
; Table 1
). These tumors were
histomorphologically intermediate GBMs containing both regions of
angiogenesis and regions of necrosis. Further increases in SDF1 were
not observed in HF5 and HF287; however, CXCR4 (4+ and 5+) was more
highly expressed. These tumors were the most histomorphologically
heterogeneous, with large regions of both angiogenesis and necrosis.
SDF1 and CXCR4 expression patterns were colocalized regionally within
the tumors. These proteins were expressed in areas of angiogenesis
(Fig. 3
, HF287), in tumor tissue located between regions of
angiogenesis where morphology suggested that the tumors were displaying
signs of degeneration (Fig. 3
, HF435 and HF5),
and in cells adjacent to regions of necrosis (Fig. 3
, HF50).
Both SDF1 and CXCR4 were observed within neutrophils and/or monocytes
(data not shown). Additionally, CXCR4 was often observed in endothelial
cells, whereas SDF1 was only occasionally seen in endothelial cells
(Table 1)
. These tumors were then ranked according to their overall
SDF1 and CXCR4 levels from lowest to highest as follows: (a)
HF360; (b) HF268; (c) HF435; (d) HF50;
(e) HF5; and (f) HF287 (Fig. 3)
.
|
|
; Table 1
). SDF1 was also observed in
the occasional phagocytic cells around vessels. Reactive astrocytes in
the molecular layer of one sample were positive (Table 1
, HF191). CXCR4
expression was negative in normal brain tissue (Fig. 4
; Table 1
) but
was also present in phagocytic cells within the vascular lumen (Table 1)
. Thus, the level of expression for both SDF1 and CXCR4 was low
in normal brain tissue compared to the GBMs and was in agreement with
the reported literature. To examine the expression patterns in
astrocytomas, we examined the expression of SDF1 and CXCR4 in one
astrocytoma, five anaplastic astrocytomas, and six additional GBMs
(Table 1)
. Overall, the lower grade tumors expressed lower levels of
both SDF1 and CXCR4 than did the GBMs. However, three anaplastic tumors
had intermediate levels of expression of SDF1 (2–3+) and CXCR4
(2–4+). These tumors were described as having microcystic or
degenerative regions (Table 1)
. Thus, SDF1 and CXCR4 expression was
colocalized, increased with increasing tumor grade, and was associated
with regions of necrosis/microcystic change and angiogenesis.
Those tumors displaying greater amounts of these features expressed
greater intensity of the proteins. Not all GBMs with elevated SDF1 and
CXCR4 had both angiogenesis and necrosis (Table 1)
, suggesting that the
proteins may be associated with both phenotypes. Overall, the
expression of both proteins was low in normal brain tissue (Fig. 4, A and B)
, slightly elevated in low-grade tumors
or in GBMs without extensive regions of angiogenesis and necrosis (Fig. 4, C and D)
, elevated in GBMs in regions of
necrosis (Fig. 4, E and F)
and in regions of degeneration (Fig. 4, G and H)
, and occasionally increased in
neovessels (Fig. 4, I and J)
.
|
HF268)
expression were low in SDF1 and CXCR4 (Fig. 4, C and D
, HF268). In contrast, regions of obvious necrosis (Fig. 5, B and D
, HF140) and degeneration (Fig. 5C,
HF140) were low in MIB-1 but expressed SDF1 and CXCR4
(Fig. 4, G and H)
.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
We identified SDF1 as a gene that is differentially expressed between the GBMs. SDF1 is a chemokine that binds to its seven-transmembrane G-coupled receptor, CXCR4, to modulate several biological functions through signal transduction pathways, including cell proliferation, cell migration, and transcriptional activation (25, 26, 27) . Therefore, we further immunohistochemically characterized both SDF1 and CXCR4 protein expression and localization in formalin-fixed, paraffin-embedded tissue sections of normal brain tissue and astrocytic tumors of all grades. SDF1 expression is low in normal brain tissue (2) . Both SDF1 expression and CXCR4 expression have been observed in the brain of developing embryos, particularly in neurons in the fetal cerebellum (7) . In vitro, both SDF1 and CXCR4 have been detected in astrocytes, neurons, and microglial cells (13) . Immunohistochemically, we observed low levels of SDF1 [in agreement with overall levels in the brain (2) ] and negligible levels of CXCR4, probably because these specimens were not taken from the cerebellum. The lower grade tumors (astrocytoma and anaplastic astrocytoma) demonstrated intermediate levels of SDF1 and CXCR4 expression. The highest levels of expression of both proteins were observed in the GBMs, and the expression was associated with histomorphologically defined regions within the GBMs. Specifically, we observed high levels of SDF1 expression in regions adjacent to tumor necrosis, in regions in-between angiogenic vessels where the tumor appeared to be undergoing degeneration, and occasionally in endothelial cells of neovessels. CXCR4 was colocalized to the same histomorphological regions as SDF1 and was often observed in the endothelial cells of neovessels. Immunohistochemical localization of MIB-1 (a proliferation marker) on adjacent sections indicated that regions high in SDF1 and CXCR4 expression were not associated with MIB-1 staining. This is not surprising, because necrotic areas are poor in MIB-1. However, the converse was also observed: regions high in MIB-1 staining were low in SDF-1 and CXCR4. These observations suggest that SDF1 and CXCR4 interactions may play a role in tumor angiogenesis and/or immune surveillance but probably do not play a role in proliferation.
We observed SDF1 expression in neovessel endothelial cells in an occasional tumor. However, expression was high in tumor cells adjacent to the neovessels. In contrast, we observed CXCR4 expression in the endothelial cells of neovessels in many tumors. These data suggest that the cytokine released from tumor cells may play a role in promoting angiogenesis by inducing the migration of endothelial cells. This hypothesis is supported by reports that CXCR4 expression has been observed in other types of endothelial cells including human umbilical vascular endothelial cells, bovine aortic endothelial cells, and bovine pulmonary artery endothelial cells (15 , 16) and that SDF1 was found to be a potent inducer of endothelial cell chemotaxis (16) . During normal development, CXCR4 is highly expressed in the endothelium of developing blood vessels, including the brain (32) . Furthermore, mice lacking either SDF1 or CXCR4 have defective vascular development, particularly in the gastrointestinal tract, suggesting that SDF1 and CXCR4 represent an important signaling system for organ vascularization (32) .
The greatest reactivity of SDF1 and CXCR4 was noted both in the regions of tumor situated between areas of angiogenesis and in the tumor immediately adjacent to areas of necrosis. Histomorphologically, these tumor regions between the neovessels appeared to be undergoing degeneration and probably progressing to necrosis, where the tumor was presumably outgrowing its blood supply. Expression of SDF1 in such regions could serve two purposes. One would be to promote new angiogenesis to supply nutrients to further tumor growth, as indicated previously. However, the observation that the highest expression was observed in these seemingly degenerative regions, in areas of necrosis, and around neovessels suggests another function. In all of these cases, expression is elevated in regions where the integrity of the tumor is compromised by destroyed tissue or leaky vessels, where the tumor is vulnerable to immune attack. Recently, SDF1 has been shown to modulate the immune response by its interactions with CXCR4 present on both macrophages and CD8+ T cells (22 , 23) . SDF1 attracts macrophages, binds to CXCR4, and induces macrophages to secrete surface TNF. SDF1 also attracts CD8+ T cells, binds to the CXCR4 receptor, and induces T cells to express the TNF-R. Macrophages and T cells bind to each other through the TNF/TNF-R interaction, inducing a death signal in the T cells. Thus, it is postulated that SDF1 and CXCR4 interactions act to suppress the immune response.
Surprisingly, GBMs fail to mount a successful immune response, although the tumors are seemingly exposed to the immune cells in regions of angiogenesis, where blood-brain barrier is absent, or in areas of tumor necrosis or degeneration. Our findings suggest that in the regions where an immune access would normally be expected, high SDF1 expression may protect the tumor by inducing macrophages and probably microglial cells to attack T cells via the TNF/FNF-R interaction. In support of this hypothesis, SDF1 has been recognized as a strong chemoattractant for microglial cells (14) , and TNF expression increases with tumor grade [17% of astrocytomas and oligoastrocytomas and 80% of anaplastic and GBM tumors express the factor (33) ].
CXCR4 has also been implicated in the regulation of glioma proliferation when transfection of an antisense to CXCR4 inhibited cell proliferation of glioma cells in vitro (17) . However, in our immunohistochemical analysis of MIB-1 labeling of cycling cells, SDF1/CXCR4 and MIB-1 were generally mutually exclusive, as determined by immunohistochemical staining of adjacent sections. This discrepancy may reflect methodological differences because cells in culture are not subject to the same environment that they are within the tumor, and the assessment of a candidate gene in vitro may not always reflect its major function in vivo. For example, we found a fairly good correlation between increased SDF1 expression as assessed by RT-PCR and immunohistochemistry for four of the six tumors. However, levels observed for HF50 and HF360 did not agree with the immunohistochemistry, suggesting that the cell culture results did not always reflect the in vivo expression patterns.
In conclusion, differential display combined with immunohistochemical analysis was successful in the identification of genes differentially expressed between heterogeneous GBMs. The localization of these genes to distinct histomorphological regions within the tumor suggests clues as to their possible functions, i.e., promoting angiogenesis and/or inhibiting T-cell-mediated immune response.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 To whom requests for reprints should be
addressed, at Molecular Neuro-Oncology Laboratory, Department of
Neurosurgery, Henry Ford Hospital, 2799 West Grand Boulevard, Detroit,
MI 48202. Phone: (313) 916-8689; Fax: (313) 916-9855, E-mail: nssan{at}neuro.hfh.edu 
2 The abbreviations used are: GBM, glioblastoma
multiforme; SDF1, stromal cell-derived factor 1; CXCR4, CXC chemokine
receptor 4; RT-PCR, reverse transcription-PCR; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; TNF, tumor necrosis
factor; TNF-R, TNF receptor.
Received 7/27/99; revised 10/ 1/99; accepted 10/ 4/99.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-chemokine, stromal cell-derived factor-l, binds to the transmembrane G-protein-coupled CXCR-4 receptor and activates multiple signal transduction pathways. J. Biol. Chem., 273: 23169-23175, 1998. and stem cell factor/kit ligand share signaling pathways in hemopoietic progenitors: a potential mechanism for cooperative induction of chemotaxis. J. Immunol., 161: 3652-3658, 1998. in gliomas. J. Clin. Pathol., 50: 559-562, 1997.This article has been cited by other articles:
|
|
 |
|
  F. Barbieri, A. Bajetto, R. Stumm, A. Pattarozzi, C. Porcile, G. Zona, A. Dorcaratto, J.-L. Ravetti, F. Minuto, R. Spaziante, et al. Overexpression of Stromal Cell-Derived Factor 1 and Its Receptor CXCR4 Induces Autocrine/Paracrine Cell Proliferation in Human Pituitary Adenomas Clin. Cancer Res., August 15, 2008; 14(16): 5022 - 5032. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Zagzag, M. Esencay, O. Mendez, H. Yee, I. Smirnova, Y. Huang, L. Chiriboga, E. Lukyanov, M. Liu, and E. W. Newcomb Hypoxia- and Vascular Endothelial Growth Factor-Induced Stromal Cell-Derived Factor-1{alpha}/CXCR4 Expression in Glioblastomas: One Plausible Explanation of Scherer's Structures Am. J. Pathol., August 1, 2008; 173(2): 545 - 560. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Benamar, E. B. Geller, and M. W. Adler First in Vivo Evidence for a Functional Interaction between Chemokine and Cannabinoid Systems in the Brain J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 641 - 645. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Barbieri, A. Bajetto, C. Porcile, A. Pattarozzi, G. Schettini, and T. Florio Role of stromal cell-derived factor 1 (SDF1/CXCL12) in regulating anterior pituitary function J. Mol. Endocrinol., March 1, 2007; 38(3): 383 - 389. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Kryczek, S. Wei, E. Keller, R. Liu, and W. Zou Stroma-derived factor (SDF-1/CXCL12) and human tumor pathogenesis Am J Physiol Cell Physiol, March 1, 2007; 292(3): C987 - C995. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Yang, E. Jackson, B. M. Woerner, A. Perry, D. Piwnica-Worms, and J. B. Rubin Blocking CXCR4-Mediated Cyclic AMP Suppression Inhibits Brain Tumor Growth In vivo Cancer Res., January 15, 2007; 67(2): 651 - 658. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bajetto, F. Barbieri, A. Pattarozzi, A. Dorcaratto, C. Porcile, J. L. Ravetti, G. Zona, R. Spaziante, G. Schettini, and T. Florio CXCR4 and SDF1 expression in human meningiomas: A proliferative role in tumoral meningothelial cells in vitro Neuro-oncol, January 1, 2007; 9(1): 3 - 11. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Redjal, J. A. Chan, R. A. Segal, and A. L. Kung CXCR4 Inhibition Synergizes with Cytotoxic Chemotherapy in Gliomas. Clin. Cancer Res., November 15, 2006; 12(22): 6765 - 6771. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Aghi, K. S. Cohen, R. J. Klein, D. T. Scadden, and E. A. Chiocca Tumor Stromal-Derived Factor-1 Recruits Vascular Progenitors to Mitotic Neovasculature, where Microenvironment Influences Their Differentiated Phenotypes. Cancer Res., September 15, 2006; 66(18): 9054 - 9064. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I A Bhutto, D S McLeod, C Merges, T Hasegawa, and G A Lutty Localisation of SDF-1 and its receptor CXCR4 in retina and choroid of aged human eyes and in eyes with age related macular degeneration Br. J. Ophthalmol., July 1, 2006; 90(7): 906 - 910. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ottaiano, R. Franco, A. Aiello Talamanca, G. Liguori, F. Tatangelo, P. Delrio, G. Nasti, E. Barletta, G. Facchini, B. Daniele, et al. Overexpression of Both CXC Chemokine Receptor 4 and Vascular Endothelial Growth Factor Proteins Predicts Early Distant Relapse in Stage II-III Colorectal Cancer Patients. Clin. Cancer Res., May 1, 2006; 12(9): 2795 - 2803. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Vianello, N. Papeta, T. Chen, P. Kraft, N. White, W. K. Hart, M. F. Kircher, E. Swart, S. Rhee, G. Palu, et al. Murine B16 Melanomas Expressing High Levels of the Chemokine Stromal-Derived Factor-1/CXCL12 Induce Tumor-Specific T Cell Chemorepulsion and Escape from Immune Control. J. Immunol., March 1, 2006; 176(5): 2902 - 2914. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yasumoto, K. Koizumi, A. Kawashima, Y. Saitoh, Y. Arita, K. Shinohara, T. Minami, T. Nakayama, H. Sakurai, Y. Takahashi, et al. Role of the CXCL12/CXCR4 Axis in Peritoneal Carcinomatosis of Gastric Cancer Cancer Res., February 15, 2006; 66(4): 2181 - 2187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Kollmar, C. Scheuer, M. D. Menger, and M. K. Schilling Macrophage Inflammatory Protein-2 Promotes Angiogenesis, Cell Migration, and Tumor Growth in Hepatic Metastasis Ann. Surg. Oncol., February 1, 2006; 13(2): 263 - 275. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. M. Woerner, N. M. Warrington, A. L. Kung, A. Perry, and J. B. Rubin Widespread CXCR4 Activation in Astrocytomas Revealed by Phospho-CXCR4-Specific Antibodies Cancer Res., December 15, 2005; 65(24): 11392 - 11399. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zhang, S. Sarkar, and V.W. Yong The chemokine stromal cell derived factor-1 (CXCL12) promotes glioma invasiveness through MT2-matrix metalloproteinase Carcinogenesis, December 1, 2005; 26(12): 2069 - 2077. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zhou, J. Zhang, Q. Liu, R. Bell, D. A. Muruve, P. Forsyth, M. Arcellana-Panlilio, S. Robbins, and V.W. Yong The chemokine GRO-{alpha} (CXCL1) confers increased tumorigenicity to glioma cells Carcinogenesis, December 1, 2005; 26(12): 2058 - 2068. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Nakagawa, K. Yoshioka, E. Miyahara, Y. Fukushima, M. Tamura, and K. Itoh Intrathecal Administration of Y-27632, a Specific Rho-Associated Kinase Inhibitor, for Rat Neoplastic Meningitis Mol. Cancer Res., August 1, 2005; 3(8): 425 - 433. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Zagzag, B. Krishnamachary, H. Yee, H. Okuyama, L. Chiriboga, M. A. Ali, J. Melamed, and G. L. Semenza Stromal Cell-Derived Factor-1{alpha} and CXCR4 Expression in Hemangioblastoma and Clear Cell-Renal Cell Carcinoma: von Hippel-Lindau Loss-of-Function Induces Expression of a Ligand and Its Receptor Cancer Res., July 15, 2005; 65(14): 6178 - 6188. [Abstract] |
