
Clinical Cancer Research Vol. 6, 3817-3822, October 2000
© 2000 American Association for Cancer Research
Detection of Circulating Cancer Cells with von Hippel-Lindau Gene Mutation in Peripheral Blood of Patients with Renal Cell Carcinoma1
Shingo Ashida,
Heiwa Okuda,
Masakazu Chikazawa,
Masanobu Tanimura,
Osamu Sugita,
Yukio Yamamoto,
Syoichiro Nakamura,
Masatoshi Moriyama and
Taro Shuin2
Department of Urology, Kochi Medical School, Kochi 783-8505 [S. A., H. O., T. S.]; Department of Urology, Kubokawa Hospital, Kochi 786-0002 [M. C.]; Department of Urology, Hatakenmin Hospital, Kochi 787-0785 [M. T.]; Department of Urology, Hosogi Hospital, Kochi 780-0926 [O. S.]; Department of Urology, Chikamori Hospital, Kochi 780-0052 [Y. Y.]; Department of Urology, Kochi Red Cross Hospital, Kochi 780-0062 [S. N.]; and Department of Urology, Yokohama Municipal Citizens Hospital, Kanagawa 240-0062 [M. M.], Japan
 |
ABSTRACT
|
|---|
Mutations
of the von Hippel-Lindau (VHL) tumor suppressor gene have been detected
in up to 60% of sporadic clear cell renal carcinomas (RCCs). Even
patients with RCCs believed to be curable with radical nephrectomy
sometimes develop distant metastasis 510 years after surgery,
suggesting hematogenous circulation of cancer cells. Useful tumor
markers have not yet been established for RCC. To detect patients at
high risk of metastasis after surgery, we developed a highly
sensitive and specific nested reverse transcription-PCR method using
VHL gene mutation to detect circulating cancer
cells. We screened 29 sporadic clear cell RCCs from patients for
mutations of the VHL gene by direct sequencing. We next
examined blood samples from patients with the VHL gene
mutation using mutation-specific nested reverse transcription-PCR.
Somatic mutations were detected in 20 of 29 (69.0%) sporadic clear
cell RCCs. The VHL gene mutations were detected in
peripheral and/or renal venous blood from 15 of 20 (75%) patients. The
mutations were detected in the peripheral blood in 2 of 17 (11.8%)
patients before surgery, 6 of 16 (37.5%) patients within 24 h
after surgery, 3 of 16 (18.8%) patients on day 7 after surgery, and 2
of 11 (18.2%) patients on day 30 after surgery. In seven of
nine (77.8%) patients, mutations were detected in renal venous blood
during surgery. These findings indicate the presence of circulating
cancer cells with VHL gene mutation. Although much larger
studies are needed to determine the clinical significance, our study
shows that this technique is feasible for detecting circulating RCC
cells.
 |
Introduction
|
|---|
RCC,3
the most common malignant neoplasm of the kidney, accounts for
approximately 2% of all cancers and has traditionally been identified
as arising from the proximal tubule of the nephron (1
, 2)
.
RCC has a unique biological profile, with a long dormancy of metastasis
(3)
. In RCC patients, distant metastasis sometimes
develops 510 years after surgery, even in those with RCCs believed to
be curable with radical nephrectomy. Metastatic RCCs respond poorly to
radiotherapy and chemotherapy (4)
. Useful tumor markers
have not yet been established for the detection, staging, prognosis, or
monitoring of response to treatment of RCC. Solid organ tumors are
known to shed cells. Several laboratories have reported the use of PCR
to detect p53 and ras gene mutations in the
peripheral blood of patients with colorectal (5, 6, 7)
and
pancreatic (8
, 9)
carcinomas and hematological
malignancies (10)
.
Mutations of the VHL tumor suppressor gene have been
detected in up to 60% of sporadic clear cell RCCs, the most common
subtype of kidney cancer (11, 12, 13)
. In the present study,
we developed a highly sensitive and specific nested RT-PCR method using
VHL gene mutation to detect circulating RCC cells in the
peripheral blood. To obtain a higher sensitivity without decreasing
specificity for detecting circulating cancer cells, mutation-specific
nested RT-PCR was applied to blood samples. We chose to target RNA
rather than DNA for our study to detect only viable cancer cells in the
peripheral blood. In this study, we detected circulating cancer cells
with high frequency, particularly during or after surgery. This study
may provide a possible biological marker for monitoring patients after
surgery and determining adjuvant chemotherapy.
 |
Materials and Methods
|
|---|
Tissue and Blood Samples and Cell Lines.
Twenty-nine patients with histologically confirmed clear cell RCC were
enrolled in the study. Mean age at the time of diagnosis was 65.6 years
(range, 4190 years), and the male:female ratio was 1.2:1. Peripheral
blood (10 ml) was collected before surgery, within 24 h after
surgery, on day 7 after surgery, and on day 30 after surgery in
the patients undergoing nephrectomy. Renal venous blood (10 ml) was
obtained during surgery with written informed consent of the patients.
Specimens from the surgery were frozen rapidly with liquid nitrogen and
then stored at -80°C. Two VHL-mutated RCC cell lines,
UMRC-6 and SKRC-1, were used for sensitivity assay. UMRC-6 has a 10-bp
deletion at nucleotides 715724, and SKRC-7 has a C to T nonsense
mutation at nucleotide 607. SKRC-7 was kindly supplied by H. Uemura
(Department of Urology, Nara Medical University, Nara, Japan).
DNA Extraction and Direct Sequencing.
We screened 29 sporadic clear cell RCCs from patients for
mutations of the VHL gene by direct sequencing. Genomic DNAs
were extracted from tumors by standard procedures. Genomic DNA (50100
ng) was amplified by PCR in a standard PCR buffer containing 20
µM deoxynucleotide triphosphates, 1.5 mM
MgCl2, 3% DMSO, 1.0 unit of AmpliTaq Gold
polymerase (Perkin-Elmer), and 0.2 µM primers using 45
cycles of 95°C for 45 s, 59°C for 45 s, and 72°C for
45 s. PCR products were sequenced using a cycle sequencing kit
with dye terminators (Perkin-Elmer) and an ABI 310 automated sequencer.
Primers used for both PCR and sequencing were as follows:
(a) 1F, TGGTCTGGATCGCGGAGGGAAT; (b) 1R,
GACCGTGCTATCGTCCCTGC; (c) 2F, GTGGCTCTTTAACAACCTTTGC;
(d) 2R, CCTGTACTTACCACAACAACCTTATC; (e) 3F,
TTCCTTGTACTGAGACCCTAGT; and (f) 3R, AGCTGAGATGAAACAGTGTAAGT.
Amplification for sequencing was performed with 3 cycles of 95°C for
10 s, 55°C for 5 s, and 60°C for 4 min, followed by 22
cycles of 96°C for 10 s, 50°C for 5 s, and 60°C for 4
min.
RNA Extraction and Reverse Transcription.
Peripheral blood and renal venous blood (10 ml) were collected in the
presence of EDTA. Lymphocytes were isolated using Ficoll-Paque Plus
(Pharmacia Biotech). Total RNAs were extracted by the acid-guanidinium
thiocyanate-phenol chloroform method using a Trizol kit (Life
Technologies, Inc.). Frozen tissues were pulverized under liquid
nitrogen, and the frozen powder was used for RNA extraction with the
Trizol kit. Isolated RNA was reverse-transcribed to cDNA as described
by Horikoshi et al. (14)
. Briefly, total RNA
(10 µg) resuspended in 50 µl of diethylpyrocarbonate-treated water
was added to a reaction mixture containing 2.5 µl of RNAguard
(Pharmacia Biotech), 10 µl of a 0.1 M solution
of DTT, 20 µl of transcription buffer [250 mM
Tris-HCl (pH 8.3), 375 mM KCl, and 15
mM MgCl2], 10 µl of a 10
mM deoxynucleotide triphosphate solution, 2.5
µl of a BSA solution (3 mg/ml water), and 0.5 µl of random hexamers
[50 absorbance units in 0.55 ml of 10 mM
Tris-HCl (pH 7.5) and 1 mM EDTA (Pharmacia
Biotech)]. The mixture was combined with 5 µl of MMLV reverse
transcriptase (200 units/µl; Life Technologies, Inc.) and incubated
at room temperature for 10 min, at 42°C for 45 min, and at 90°C for
3 min (to kill any enzyme activity and denature RNA). MMLV reverse
transcriptase (2.5 µl) was added to the reaction mixture and
incubated for 45 min at 42°C, followed by a 10-min incubation at
75°C (to kill DNase activity of MMLV). Samples were stored at
-80°C.
Detection of VHL Gene Mutations.
PCR primers specific to each mutation in surgical specimens were
designed for each positive patient because the mutations do not occur
at specific sites in the VHL gene (Table 1)
, and we examined blood samples from
patients with the VHL gene mutation using mutation-specific
nested RT-PCR (Fig. 1)
.
For the first PCR, 1 µl of sample cDNA was used in 50-µl
amplification reactions containing 1x Stoffel buffer; 2.5
mM MgCl2; 2 µM each of
dATP, dCTP, dGTP, and dTTP; 0.25 µM of each primer; 5
units of AmpliTaq DNA polymerase; and Stoffel Fragment
(Perkin-Elmer) incorporating AmpliWax (Perkin-Elmer) for greater
specificity. The first PCR was performed for 35 cycles (95°C for
10 s, 65°C for 5 s) with mutation-specific primers that had
3' ends corresponding to each variant and normal sequence primer using
a GeneAmp PCR system 9600 (Perkin-Elmer). The thermal cycler was
precycled (for five cycles) to ensure accurate temperature control for
the initial annealing steps (15)
. The second PCR
amplification was similarly carried out using 1 µl of the first PCR
product as a template for 25 cycles (95°C for 10 s, 65°C for
5 s) with mutation-specific nested primers designed with two bases
closer to the 3' ends and normal sequence primer. Primer pairs were as
described in Table 1
. PCR products were run on electrophoresis in a 3%
agarose gel and stained with ethidium bromide. All PCR reactions were
repeated to verify results.

View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Schematic illustration of mutation-specific
nested RT-PCR. cDNA carrying the mutant allele is amplified with
mutationspecific primers in the first PCR. The first PCR product
is amplified with mutation-specific nested primers designed with
two bases closer to the 3' ends to increase sensitivity.
|
|
 |
Results
|
|---|
We developed a highly sensitive and specific PCR protocol for
detection of cancer cells with frameshift mutations such as deletion or
insertion as well as those with point mutations. We initially
discovered that tumor cells added to blood in a tube were found in the
lymphocyte layer formed by centrifugation on standard Papanicolaou
stain. To illustrate the sensitivity of our approach, serial dilutions
of UMRC-6 cDNA were added to normal blood cDNA, and we attempted to
detect mutation of the VHL gene in the resulting samples.
Fig. 2
shows that our technique yielded highly sensitive detection of
mutated cDNA, even in samples containing up to a
106-fold excess of homologous nonmutated
sequences. The result was the same for SKRC-7 cells (data not shown).
Thus, the sensitivity of this technique is such that mutation
(frameshift or point mutation) can be detected even if only 1 of
106 cells is affected by such mutations. None of
the blood samples from 50 healthy volunteers exhibited mutations in
peripheral blood (data not shown).

View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Sensitivity assay of mutation-specific nested
RT-PCR analysis. Serial dilutions of UMRC-6 cDNA were added to normal
blood cDNA. Mutated cDNA could be detected even in samples containing
up to a 106-fold excess of nonmutated sequences.
M, molecular marker; N, normal blood
cDNA.
|
|
A total of 20 of 29 (69.0%) sporadic clear cell RCCs was found to have
somatic mutations of the VHL gene. Among 20 patients with
VHL mutations in tumors, mutation-specific nested RT-PCR was
able to detect the same change in the peripheral and/or renal venous
blood samples of 15 patients (75%). In peripheral blood,
VHL gene mutations were detected in 2 of 17 (11.8%)
patients before surgery, 6 of 16 patients (37.5%) within 24 h
after surgery, 3 of 16 (18.8%) patients on postoperative day 7, and 2
of 11 (18.2%) patients on postoperative day 30 (see Fig. 3
.). In seven of nine (77.8%)
patients, the mutations were detected in renal venous blood during
surgery. These findings indicate the presence of circulating cancer
cells with VHL gene mutation. The detection rate of
circulating cancer cells shows that cancer cells are released into
circulation during or after surgery (Fig. 4)
. Tumor size, stage, grade, and
vascular invasion in the 20 patients are listed in Table 2
. The time at which samples were
collected and the genetic status of each blood sample are shown in
Table 3
, and representative photographs
are depicted in Fig. 3
. Patient 1 exhibited VHL gene
mutation in the peripheral blood within 24 h after surgery, on
postoperative day 7, and on postoperative day 30, whereas patient 4
exhibited VHL gene mutation in the peripheral blood only
within 24 h after surgery (Fig. 3
A). Patients 16 and 3
exhibited VHL gene mutations on postoperative day 30 and 6
months after surgery, respectively. In these two patients, a positive
test preceded overt clinical diagnosis by CT (Fig. 3
B; see
"Discussion"). In each patient, tumor and corresponding normal
kidney tissue samples from each patient were used as positive and
negative controls, respectively. Blood samples from 50 healthy
volunteers were also used as negative controls and amplified with each
primer in every patient. None of the blood samples from 50 healthy
volunteers exhibited mutations in every patient (data not
shown). The specific amplification was verified by TA cloning
and subsequent sequencing of PCR products (data not shown).

View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Detection of VHL gene mutations in
peripheral blood. A, VHL gene mutation was
detected in peripheral blood within 24 h after surgery, on
postoperative day 7, and on postoperative day 30 in patient 1. It was
detected only within 24 h after surgery in patient 4.
B, patient 16 exhibited VHL gene mutation on
postoperative day 30 and developed multiple lung metastases 4 months
after surgery. Patient 3 exhibited VHL gene mutation at 6
months after surgery and was suspected to have lymph node metastasis at
7 months after surgery (see the text). M, molecular
marker; T, tumor tissue (positive control);
N, normal kidney tissue (negative control); Lanes
15, blood samples collected before surgery, within 24 h
after surgery, on day 7, on day 30, and at 6 months,
respectively; Lanes
n1n4, blood samples from healthy
volunteers (negative control).
|
|

View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. Rate of detection of circulating cancer cells
with VHL gene mutation. Circulating cancer cells were
detected in 2 of 17 (11.2%) patients before surgery, 6 of 16 (37.5%)
patients within 24 h after surgery, 3 of 16 (18.8%) patients on
postoperative day 7, and 2 of 11 (18.2%) patients on postoperative day
30. In seven of nine (77.8%) patients, cancer cells were present in
the renal vein. These results show that intraoperative tumor
manipulation enhances cancer cell dissemination into the circulation.
|
|
 |
Discussion
|
|---|
RCC has a unique biological profile, with a long dormancy of
metastasis (3)
. Some patients with RCCs believed to be
curable with radical nephrectomy develop distant metastasis 510 years
after surgery. RCC probably spreads mainly by a hematogenous mechanism.
It was reported that serum microsatellite alterations were found in
more than 50% of patients with RCC (16
, 17)
; this
probably reflects the hematogenous mechanism by which renal tumors
spread. Thus, it would be very useful to identify a tumor marker for
RCC for monitoring patients after surgery and determining postoperative
adjuvant chemotherapy.
It was recently reported that MN/CA9 might be useful as a diagnostic
marker for RCCs (18
, 19)
. The VHL tumor
suppressor gene was isolated in 1993 (20)
. Somatic
mutations of the VHL gene have been detected in up to 60%
of sporadic clear cell RCCs, the predominant form of kidney cancer
(11, 12, 13)
. In this study, we demonstrated that nested
RT-PCR using VHL gene mutation can detect the presence of
circulating cancer cells with high frequency in patients with RCC. We
identified circulating cancer cells in 15 of 20 (75%) patients with
RCC by mutation-specific nested RT-PCR of the peripheral blood and/or
renal venous blood collected before, during, or after surgical
treatment. Patient 3 exhibited circulating cancer cells for at 6 months
after surgery and was strongly suspected to have lymph node metastasis
on CT at 7 months after surgery (data not shown).
Patient 16 exhibited circulating cancer cells on day 30 after surgery.
This patient developed multiple lung metastases 4 months after surgery.
Notably, we found cancer cells in the peripheral blood in this patient
3 months before the diagnosis of lung metastasis by CT (Table 3)
. Our
method could thus predict distant metastasis before imaging studies.
Detection of VHL gene mutation in the peripheral and/or
renal venous blood did not appear to be related to pathological factors
(tumor size, stage, grade, and vascular invasion) in this series. Even
patients with small tumors of low stage and grade exhibited circulating
cancer cells. Our results suggest that this method provides a novel
tumor marker for RCC.
Fig. 4
demonstrates that intraoperative tumor manipulation enhances
cancer cell dissemination into the circulation. This is the first
observation that cancer cells are released into the circulation during
or just after surgery. It will be necessary to assess the effect of
cancer cell dissemination on prognosis. It has been reported that the
no-touch isolation technique is useful for preventing cancer cells from
being shed into the portal vein during surgical manipulation in the
treatment of colorectal cancers (21)
and helps to reduce
cancer-related deaths and the incidence of recurrence
(22)
. It may be necessary to introduce the no-touch
technique to the treatment of RCCs.
Despite the association of certain serum protein elevations with RCC,
no marker is currently available to accurately predict an individual
patients clinical outcome after surgery for RCC. The central clinical
problem facing urologists who care for patients with RCC is that this
cancer is unresponsive to conventional systemic chemotherapies, unlike
other genitourinary cancers for which successful chemotherapies have
been developed. Radioresistance is also characteristic of RCC, leaving
surgery as the sole consistently successful form of treatment for RCC.
Our results confirm those of a previous study in which circulating RCC
cells were detected using microsatellite DNA analysis
(17)
. The study demonstrated that microsatellite analysis
of serum samples can detect circulating tumor-specific DNA in
approximately half of RCC patients. This result is reliable, and
further study may identify RCC patients at risk for metastasis.
Although the number of patients we studied was small, our findings
provide insights into the potential usefulness of this novel method for
monitoring patients after surgery for clear cell RCC. Clinical studies
with large numbers of patients must be performed. Moreover, follow-up
will be necessary to determine the correlation between the discovery of
circulating cancer cells and prognosis. We believe that this approach
identifies kidney cancer patients at risk for metastatic disease.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported in part by a Grant-in-Aid for
Scientific Research (Grant 11557118) from the Ministry of Education,
Science, Sports and Culture of Japan. 
2 To whom requests for reprints should be
addressed, at Department of Urology, Kochi Medical School, Kohasu,
Okoh-cho, Nankoku, Kochi 783-8505, Japan. Phone: 81-88-880-2401; Fax:
81-88-880-2404; E-mail: shuint{at}kochi-ms.ac.jp 
3 The abbreviations used are: RCC, renal cell
carcinoma; VHL, von Hippel-Lindau; RT-PCR, reverse transcription-PCR;
MMLV, Moloney murine leukemia virus; CT, computed tomography. 
Received 4/18/00;
revised 7/17/00;
accepted 7/17/00.
 |
REFERENCES
|
|---|
-
Kosary C. L., McLaughlin J. K. Kidney and renal pelvis Miller B. A. Reis L. A. G. Hankey B. F. Kosary C. L. Harras A. Edwards B. K. eds. . SEER Cancer Statistics Review, : 1973-1990, National Cancer Institute Bethesda, MD 1993.
-
Holthofer H., Miettinen A., Paasivuo R., Lehto V. P., Linder E., Alfthan O., Virtanen I. Cellular organ and differentiation of renal carcinomas. A fluorescence microscopic study with kidney-specific antibodies, anti-intermediate filament antibodies, and lectins. Lab. Invest., 49: 319-326, 1983.
-
Ritchie A. W. S., deKernion J. B. The natural history and clinical features of renal carcinoma. Semin. Nephrol., 7: 131-139, 1987.[Medline]
-
Motzer R. J., Bander N. H., Nanus D. M. Renal cell carcinoma. N. Engl. J. Med., 335: 865-875, 1996.[Free Full Text]
-
Anker P., Lefort F., Vasioukhin V., Lyautey J., Lederrey C., Chen X., Stroun M., Mulcahy H. E., Farthing M. J. K-ras mutations are found in DNA extracted from the plasma of colorectal cancer patients. Gastroenterology, 112: 1114-1120, 1997.[CrossRef][Medline]
-
Kopreski M. S., Benko F. A., Kwee C., Leitzel K. E., Lipton A., Goche C. D. Detection of mutant K-ras DNA in plasma or serum of patients with colorectal cancer. Br. J. Cancer, 76: 1293-1299, 1997.[Medline]
-
Hibi K., Robinson R., Wu L., Hamilton S. R., Sidranski D., Jen J. Molecular detection of genetic alterations in the serum of colorectal cancer patients. Cancer Res., 58: 1405-1407, 1998.[Abstract/Free Full Text]
-
Sorenson G. D., Pribish D. M., Valone F. H., Memoli V. A., Bzik D. J., Yao S. L. Soluble normal and mutated DNA sequences from single copy genes in human blood. Cancer Epidemiol. Biomark. Prev., 3: 67-71, 1994.[Abstract]
-
Mulcahy H. E., Lyautey J., Lederrey C., Chen X., Anker P., Alstead E. M., Ballinger A., Farthing M. J. G., Stroun M. A prospective study of K-ras mutations in the plasma of pancreatic cancer patients. Clin. Cancer Res., 4: 271-275, 1998.[Abstract/Free Full Text]
-
Vasioukhin V., Anker P., Maurice P., Lyautey J., Lederrey C., Stroun M. Point mutations of the N-ras in the blood plasma DNA of patients with myelodysplastic syndrome or acute myelogenous leukemia. Br. J. Haematol., 86: 774-779, 1994.[Medline]
-
Gnarra J. R., Tory K., Weng Y., Schmidt L., Wei M. H., Li H., Latif F., Liu S., Chen F., Duh F. M., Lubensky I., Duan D. R., Florence C., Pozzatti R., Walther M. M., Bander N. H., Grossman H. B., Brauch H., Pomer S., Brooks J. D., Issac W. B., Lerman M. I., Zbar B., Linehan W. M. Mutations of the VHL tumor suppressor gene in renal carcinoma. Nat. Genet., 7: 85-90, 1994.[CrossRef][Medline]
-
Shuin T., Kondo K., Torigoe S., Kishida T., Kubota Y., Hosaka M., Nagashima Y., Kitamura H., Latif F., Zbar B., Lerman M. I., Yao M. Frequent somatic mutations and loss of heterozygosity of the von Hippel-Lindau tumor suppressor gene in primary human renal cell carcinomas. Cancer Res., 54: 2852-2855, 1994.[Abstract/Free Full Text]
-
Foster K., Prowse A., van den Berg A., Fleming S., Hulsbeek M. M., Crossey P. A., Richards F. M., Cairns P., Affara N. A., Ferguson-Smith M. A., Buys C. H. C. M., Maher E. R. Somatic mutations of the von Hippel-Lindau disease tumor suppressor gene in non-familial clear cell renal carcinoma. Hum. Mol. Genet., 3: 2169-2173, 1994.[Abstract/Free Full Text]
-
Horikoshi T., Danenberg K. D., Stadlbauer T. H. W., Volkenandt M., Shea L. C. C., Aigner K., Gustavsson B., Leichman L., Frösing R., Ray M., Gibson N. W., Spears C. P., Danenberg P. V. Quantitation of thymidylate synthase, dihydrofolate reductase, and DT-diaphorase gene expression in human tumors using the polymerase chain reaction. Cancer Res., 52: 108-116, 1992.[Abstract/Free Full Text]
-
Tada M., Omata M., Kawai S., Saisho H., Ohto M., Saiki R. K., Sninsky J. J. Detection of ras gene mutations in pancreatic juice and peripheral blood of patients with pancreatic adenocarcinoma. Cancer Res., 53: 2472-2474, 1993.[Abstract/Free Full Text]
-
Goessl C., Heicappell R., Munker R., Anker P., Stroun M., Krause H., Müller M., Miller K. Microsatellite analysis of plasma DNA from patients with clear cell renal carcinoma. Cancer Res., 58: 4728-4732, 1998.[Abstract/Free Full Text]
-
Eisenberger C. F., Schoenberg M., Enger C., Hortopan S., Shah S., Chow N-H., Marshall F. F., Sidransky D. Diagnosis of renal cancer by molecular urinalysis. J. Natl. Cancer Inst., 91: 2028-2032, 1999.[Abstract/Free Full Text]
-
McKiernan J. M., Buttyan R., Bander N. H., de la Taille A., Stifelman M. D., Emanuel E. R., Bagiella E., Rubin M. A., Katz A. E., Olsson C. A., Sawczuk I. S. The detection of renal cell carcinoma cells in the peripheral blood with an enhanced reverse transcriptase-polymerase chain reaction assay for MN/CA9. Cancer (Phila.), 86: 492-497, 1999.[CrossRef][Medline]
-
Uemura H., Nakagawa Y., Yoshida K., Saga S., Yoshikawa K., Hirao Y., Oosterwijk E. MN/CA IX/G250 as a potential target for immunotherapy of renal cell carcinomas. Br. J. Cancer, 81: 741-746, 1999.[CrossRef][Medline]
-
Latif F., Tory K., Gnarra J., Yao M., Duh F. M., Orcutt M. L., Stackhouse T., Kuzmin I., Modi W., Geil L., Schmidt L., Zhou F., Li H., Wei M. H., Chen F., Glenn G., Choyke P., Walther M. M., Weng Y., Duan D. R., Dean M., Glavac D., Richards F. M., Crossey P. A., Ferguson-Smith M. A., Le Paslier D., Chumakov I., Cohen D., Chinault A. C., Maher E. R., Linehan W. M., Zbar B., Lerman M. I. Identification of the von Hippel-Lindau disease tumor suppressor gene. Science (Washington DC), 260: 1317-1320, 1993.[Abstract/Free Full Text]
-
Hayashi N., Egami H., Kai M., Kurusu Y., Takano S., Ogawa M. No-touch isolation technique reduces intraoperative shedding of tumor cells into the portal vein during resection of colorectal cancer. Surgery (St. Louis), 125: 369-374, 1999.[Medline]
-
Slanetz C. J. Effect of no touch isolation on survival and recurrence in curative resections for colorectal cancer. Ann. Surg. Oncol., 5: 390-398, 1998.[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
R. E. Banks, P. Tirukonda, C. Taylor, N. Hornigold, D. Astuti, D. Cohen, E. R. Maher, A. J. Stanley, P. Harnden, A. Joyce, et al.
Genetic and Epigenetic Analysis of von Hippel-Lindau (VHL) Gene Alterations and Relationship with Clinical Variables in Sporadic Renal Cancer
Cancer Res.,
February 15, 2006;
66(4):
2000 - 2011.
[Abstract]
[Full Text]
[PDF]
|
 |
|