Clinical Cancer Research Targets AACR Membership
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ashida, S.
Right arrow Articles by Shuin, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ashida, S.
Right arrow Articles by Shuin, T.
Clinical Cancer Research Vol. 6, 3817-3822, October 2000
© 2000 American Association for Cancer Research


Advances in Brief

Detection of Circulating Cancer Cells with von Hippel-Lindau Gene Mutation in Peripheral Blood of Patients with Renal Cell Carcinoma1

Shingo Ashida, Heiwa Okuda, Masakazu Chikazawa, Masanobu Tanimura, Osamu Sugita, Yukio Yamamoto, Syoichiro Nakamura, Masatoshi Moriyama and Taro Shuin2

Department of Urology, Kochi Medical School, Kochi 783-8505 [S. A., H. O., T. S.]; Department of Urology, Kubokawa Hospital, Kochi 786-0002 [M. C.]; Department of Urology, Hatakenmin Hospital, Kochi 787-0785 [M. T.]; Department of Urology, Hosogi Hospital, Kochi 780-0926 [O. S.]; Department of Urology, Chikamori Hospital, Kochi 780-0052 [Y. Y.]; Department of Urology, Kochi Red Cross Hospital, Kochi 780-0062 [S. N.]; and Department of Urology, Yokohama Municipal Citizen’s Hospital, Kanagawa 240-0062 [M. M.], Japan


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Mutations of the von Hippel-Lindau (VHL) tumor suppressor gene have been detected in up to 60% of sporadic clear cell renal carcinomas (RCCs). Even patients with RCCs believed to be curable with radical nephrectomy sometimes develop distant metastasis 5–10 years after surgery, suggesting hematogenous circulation of cancer cells. Useful tumor markers have not yet been established for RCC. To detect patients at high risk of metastasis after surgery, we developed a highly sensitive and specific nested reverse transcription-PCR method using VHL gene mutation to detect circulating cancer cells. We screened 29 sporadic clear cell RCCs from patients for mutations of the VHL gene by direct sequencing. We next examined blood samples from patients with the VHL gene mutation using mutation-specific nested reverse transcription-PCR. Somatic mutations were detected in 20 of 29 (69.0%) sporadic clear cell RCCs. The VHL gene mutations were detected in peripheral and/or renal venous blood from 15 of 20 (75%) patients. The mutations were detected in the peripheral blood in 2 of 17 (11.8%) patients before surgery, 6 of 16 (37.5%) patients within 24 h after surgery, 3 of 16 (18.8%) patients on day 7 after surgery, and 2 of 11 (18.2%) patients on day 30 after surgery. In seven of nine (77.8%) patients, mutations were detected in renal venous blood during surgery. These findings indicate the presence of circulating cancer cells with VHL gene mutation. Although much larger studies are needed to determine the clinical significance, our study shows that this technique is feasible for detecting circulating RCC cells.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
RCC,3 the most common malignant neoplasm of the kidney, accounts for approximately 2% of all cancers and has traditionally been identified as arising from the proximal tubule of the nephron (1 , 2) . RCC has a unique biological profile, with a long dormancy of metastasis (3) . In RCC patients, distant metastasis sometimes develops 5–10 years after surgery, even in those with RCCs believed to be curable with radical nephrectomy. Metastatic RCCs respond poorly to radiotherapy and chemotherapy (4) . Useful tumor markers have not yet been established for the detection, staging, prognosis, or monitoring of response to treatment of RCC. Solid organ tumors are known to shed cells. Several laboratories have reported the use of PCR to detect p53 and ras gene mutations in the peripheral blood of patients with colorectal (5, 6, 7) and pancreatic (8 , 9) carcinomas and hematological malignancies (10) .

Mutations of the VHL tumor suppressor gene have been detected in up to 60% of sporadic clear cell RCCs, the most common subtype of kidney cancer (11, 12, 13) . In the present study, we developed a highly sensitive and specific nested RT-PCR method using VHL gene mutation to detect circulating RCC cells in the peripheral blood. To obtain a higher sensitivity without decreasing specificity for detecting circulating cancer cells, mutation-specific nested RT-PCR was applied to blood samples. We chose to target RNA rather than DNA for our study to detect only viable cancer cells in the peripheral blood. In this study, we detected circulating cancer cells with high frequency, particularly during or after surgery. This study may provide a possible biological marker for monitoring patients after surgery and determining adjuvant chemotherapy.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Tissue and Blood Samples and Cell Lines.
Twenty-nine patients with histologically confirmed clear cell RCC were enrolled in the study. Mean age at the time of diagnosis was 65.6 years (range, 41–90 years), and the male:female ratio was 1.2:1. Peripheral blood (10 ml) was collected before surgery, within 24 h after surgery, on day 7 after surgery, and on day 30 after surgery in the patients undergoing nephrectomy. Renal venous blood (10 ml) was obtained during surgery with written informed consent of the patients. Specimens from the surgery were frozen rapidly with liquid nitrogen and then stored at -80°C. Two VHL-mutated RCC cell lines, UMRC-6 and SKRC-1, were used for sensitivity assay. UMRC-6 has a 10-bp deletion at nucleotides 715–724, and SKRC-7 has a C to T nonsense mutation at nucleotide 607. SKRC-7 was kindly supplied by H. Uemura (Department of Urology, Nara Medical University, Nara, Japan).

DNA Extraction and Direct Sequencing.
We screened 29 sporadic clear cell RCCs from patients for mutations of the VHL gene by direct sequencing. Genomic DNAs were extracted from tumors by standard procedures. Genomic DNA (50–100 ng) was amplified by PCR in a standard PCR buffer containing 20 µM deoxynucleotide triphosphates, 1.5 mM MgCl2, 3% DMSO, 1.0 unit of AmpliTaq Gold polymerase (Perkin-Elmer), and 0.2 µM primers using 45 cycles of 95°C for 45 s, 59°C for 45 s, and 72°C for 45 s. PCR products were sequenced using a cycle sequencing kit with dye terminators (Perkin-Elmer) and an ABI 310 automated sequencer. Primers used for both PCR and sequencing were as follows: (a) 1F, TGGTCTGGATCGCGGAGGGAAT; (b) 1R, GACCGTGCTATCGTCCCTGC; (c) 2F, GTGGCTCTTTAACAACCTTTGC; (d) 2R, CCTGTACTTACCACAACAACCTTATC; (e) 3F, TTCCTTGTACTGAGACCCTAGT; and (f) 3R, AGCTGAGATGAAACAGTGTAAGT.

Amplification for sequencing was performed with 3 cycles of 95°C for 10 s, 55°C for 5 s, and 60°C for 4 min, followed by 22 cycles of 96°C for 10 s, 50°C for 5 s, and 60°C for 4 min.

RNA Extraction and Reverse Transcription.
Peripheral blood and renal venous blood (10 ml) were collected in the presence of EDTA. Lymphocytes were isolated using Ficoll-Paque Plus (Pharmacia Biotech). Total RNAs were extracted by the acid-guanidinium thiocyanate-phenol chloroform method using a Trizol kit (Life Technologies, Inc.). Frozen tissues were pulverized under liquid nitrogen, and the frozen powder was used for RNA extraction with the Trizol kit. Isolated RNA was reverse-transcribed to cDNA as described by Horikoshi et al. (14) . Briefly, total RNA (10 µg) resuspended in 50 µl of diethylpyrocarbonate-treated water was added to a reaction mixture containing 2.5 µl of RNAguard (Pharmacia Biotech), 10 µl of a 0.1 M solution of DTT, 20 µl of transcription buffer [250 mM Tris-HCl (pH 8.3), 375 mM KCl, and 15 mM MgCl2], 10 µl of a 10 mM deoxynucleotide triphosphate solution, 2.5 µl of a BSA solution (3 mg/ml water), and 0.5 µl of random hexamers [50 absorbance units in 0.55 ml of 10 mM Tris-HCl (pH 7.5) and 1 mM EDTA (Pharmacia Biotech)]. The mixture was combined with 5 µl of MMLV reverse transcriptase (200 units/µl; Life Technologies, Inc.) and incubated at room temperature for 10 min, at 42°C for 45 min, and at 90°C for 3 min (to kill any enzyme activity and denature RNA). MMLV reverse transcriptase (2.5 µl) was added to the reaction mixture and incubated for 45 min at 42°C, followed by a 10-min incubation at 75°C (to kill DNase activity of MMLV). Samples were stored at -80°C.

Detection of VHL Gene Mutations.
PCR primers specific to each mutation in surgical specimens were designed for each positive patient because the mutations do not occur at specific sites in the VHL gene (Table 1)Citation , and we examined blood samples from patients with the VHL gene mutation using mutation-specific nested RT-PCR (Fig. 1)Citation . For the first PCR, 1 µl of sample cDNA was used in 50-µl amplification reactions containing 1x Stoffel buffer; 2.5 mM MgCl2; 2 µM each of dATP, dCTP, dGTP, and dTTP; 0.25 µM of each primer; 5 units of AmpliTaq DNA polymerase; and Stoffel Fragment (Perkin-Elmer) incorporating AmpliWax (Perkin-Elmer) for greater specificity. The first PCR was performed for 35 cycles (95°C for 10 s, 65°C for 5 s) with mutation-specific primers that had 3' ends corresponding to each variant and normal sequence primer using a GeneAmp PCR system 9600 (Perkin-Elmer). The thermal cycler was precycled (for five cycles) to ensure accurate temperature control for the initial annealing steps (15) . The second PCR amplification was similarly carried out using 1 µl of the first PCR product as a template for 25 cycles (95°C for 10 s, 65°C for 5 s) with mutation-specific nested primers designed with two bases closer to the 3' ends and normal sequence primer. Primer pairs were as described in Table 1Citation . PCR products were run on electrophoresis in a 3% agarose gel and stained with ethidium bromide. All PCR reactions were repeated to verify results.


View this table:
[in this window]
[in a new window]

 
Table 1 %PCR primers used for mutation-specific nested RT-PCR

 


View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Schematic illustration of mutation-specific nested RT-PCR. cDNA carrying the mutant allele is amplified with mutationspecific primers in the first PCR. The first PCR product is amplified with mutation-specific nested primers designed with two bases closer to the 3' ends to increase sensitivity.

 

    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
We developed a highly sensitive and specific PCR protocol for detection of cancer cells with frameshift mutations such as deletion or insertion as well as those with point mutations. We initially discovered that tumor cells added to blood in a tube were found in the lymphocyte layer formed by centrifugation on standard Papanicolaou stain. To illustrate the sensitivity of our approach, serial dilutions of UMRC-6 cDNA were added to normal blood cDNA, and we attempted to detect mutation of the VHL gene in the resulting samples. Fig. 2Citation shows that our technique yielded highly sensitive detection of mutated cDNA, even in samples containing up to a 106-fold excess of homologous nonmutated sequences. The result was the same for SKRC-7 cells (data not shown). Thus, the sensitivity of this technique is such that mutation (frameshift or point mutation) can be detected even if only 1 of 106 cells is affected by such mutations. None of the blood samples from 50 healthy volunteers exhibited mutations in peripheral blood (data not shown).



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Sensitivity assay of mutation-specific nested RT-PCR analysis. Serial dilutions of UMRC-6 cDNA were added to normal blood cDNA. Mutated cDNA could be detected even in samples containing up to a 106-fold excess of nonmutated sequences. M, molecular marker; N, normal blood cDNA.

 
A total of 20 of 29 (69.0%) sporadic clear cell RCCs was found to have somatic mutations of the VHL gene. Among 20 patients with VHL mutations in tumors, mutation-specific nested RT-PCR was able to detect the same change in the peripheral and/or renal venous blood samples of 15 patients (75%). In peripheral blood, VHL gene mutations were detected in 2 of 17 (11.8%) patients before surgery, 6 of 16 patients (37.5%) within 24 h after surgery, 3 of 16 (18.8%) patients on postoperative day 7, and 2 of 11 (18.2%) patients on postoperative day 30 (see Fig. 3Citation .). In seven of nine (77.8%) patients, the mutations were detected in renal venous blood during surgery. These findings indicate the presence of circulating cancer cells with VHL gene mutation. The detection rate of circulating cancer cells shows that cancer cells are released into circulation during or after surgery (Fig. 4)Citation . Tumor size, stage, grade, and vascular invasion in the 20 patients are listed in Table 2Citation . The time at which samples were collected and the genetic status of each blood sample are shown in Table 3Citation , and representative photographs are depicted in Fig. 3Citation . Patient 1 exhibited VHL gene mutation in the peripheral blood within 24 h after surgery, on postoperative day 7, and on postoperative day 30, whereas patient 4 exhibited VHL gene mutation in the peripheral blood only within 24 h after surgery (Fig. 3Citation A). Patients 16 and 3 exhibited VHL gene mutations on postoperative day 30 and 6 months after surgery, respectively. In these two patients, a positive test preceded overt clinical diagnosis by CT (Fig. 3Citation B; see "Discussion"). In each patient, tumor and corresponding normal kidney tissue samples from each patient were used as positive and negative controls, respectively. Blood samples from 50 healthy volunteers were also used as negative controls and amplified with each primer in every patient. None of the blood samples from 50 healthy volunteers exhibited mutations in every patient (data not shown). The specific amplification was verified by TA cloning and subsequent sequencing of PCR products (data not shown).



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Detection of VHL gene mutations in peripheral blood. A, VHL gene mutation was detected in peripheral blood within 24 h after surgery, on postoperative day 7, and on postoperative day 30 in patient 1. It was detected only within 24 h after surgery in patient 4. B, patient 16 exhibited VHL gene mutation on postoperative day 30 and developed multiple lung metastases 4 months after surgery. Patient 3 exhibited VHL gene mutation at 6 months after surgery and was suspected to have lymph node metastasis at 7 months after surgery (see the text). M, molecular marker; T, tumor tissue (positive control); N, normal kidney tissue (negative control); Lanes 1–5, blood samples collected before surgery, within 24 h after surgery, on day 7, on day 30, and at 6 months, respectively; Lanes n1—n4, blood samples from healthy volunteers (negative control).

 


View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Rate of detection of circulating cancer cells with VHL gene mutation. Circulating cancer cells were detected in 2 of 17 (11.2%) patients before surgery, 6 of 16 (37.5%) patients within 24 h after surgery, 3 of 16 (18.8%) patients on postoperative day 7, and 2 of 11 (18.2%) patients on postoperative day 30. In seven of nine (77.8%) patients, cancer cells were present in the renal vein. These results show that intraoperative tumor manipulation enhances cancer cell dissemination into the circulation.

 

View this table:
[in this window]
[in a new window]

 
Table 2 %Patients showing VHL gene mutation in the tumor

 

View this table:
[in this window]
[in a new window]

 
Table 3 %Detection of VHL gene mutations in the peripheral blood and renal vein

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
RCC has a unique biological profile, with a long dormancy of metastasis (3) . Some patients with RCCs believed to be curable with radical nephrectomy develop distant metastasis 5–10 years after surgery. RCC probably spreads mainly by a hematogenous mechanism. It was reported that serum microsatellite alterations were found in more than 50% of patients with RCC (16 , 17) ; this probably reflects the hematogenous mechanism by which renal tumors spread. Thus, it would be very useful to identify a tumor marker for RCC for monitoring patients after surgery and determining postoperative adjuvant chemotherapy.

It was recently reported that MN/CA9 might be useful as a diagnostic marker for RCCs (18 , 19) . The VHL tumor suppressor gene was isolated in 1993 (20) . Somatic mutations of the VHL gene have been detected in up to 60% of sporadic clear cell RCCs, the predominant form of kidney cancer (11, 12, 13) . In this study, we demonstrated that nested RT-PCR using VHL gene mutation can detect the presence of circulating cancer cells with high frequency in patients with RCC. We identified circulating cancer cells in 15 of 20 (75%) patients with RCC by mutation-specific nested RT-PCR of the peripheral blood and/or renal venous blood collected before, during, or after surgical treatment. Patient 3 exhibited circulating cancer cells for at 6 months after surgery and was strongly suspected to have lymph node metastasis on CT at 7 months after surgery (data not shown).

Patient 16 exhibited circulating cancer cells on day 30 after surgery. This patient developed multiple lung metastases 4 months after surgery. Notably, we found cancer cells in the peripheral blood in this patient 3 months before the diagnosis of lung metastasis by CT (Table 3)Citation . Our method could thus predict distant metastasis before imaging studies.

Detection of VHL gene mutation in the peripheral and/or renal venous blood did not appear to be related to pathological factors (tumor size, stage, grade, and vascular invasion) in this series. Even patients with small tumors of low stage and grade exhibited circulating cancer cells. Our results suggest that this method provides a novel tumor marker for RCC.

Fig. 4Citation demonstrates that intraoperative tumor manipulation enhances cancer cell dissemination into the circulation. This is the first observation that cancer cells are released into the circulation during or just after surgery. It will be necessary to assess the effect of cancer cell dissemination on prognosis. It has been reported that the no-touch isolation technique is useful for preventing cancer cells from being shed into the portal vein during surgical manipulation in the treatment of colorectal cancers (21) and helps to reduce cancer-related deaths and the incidence of recurrence (22) . It may be necessary to introduce the no-touch technique to the treatment of RCCs.

Despite the association of certain serum protein elevations with RCC, no marker is currently available to accurately predict an individual patient’s clinical outcome after surgery for RCC. The central clinical problem facing urologists who care for patients with RCC is that this cancer is unresponsive to conventional systemic chemotherapies, unlike other genitourinary cancers for which successful chemotherapies have been developed. Radioresistance is also characteristic of RCC, leaving surgery as the sole consistently successful form of treatment for RCC.

Our results confirm those of a previous study in which circulating RCC cells were detected using microsatellite DNA analysis (17) . The study demonstrated that microsatellite analysis of serum samples can detect circulating tumor-specific DNA in approximately half of RCC patients. This result is reliable, and further study may identify RCC patients at risk for metastasis. Although the number of patients we studied was small, our findings provide insights into the potential usefulness of this novel method for monitoring patients after surgery for clear cell RCC. Clinical studies with large numbers of patients must be performed. Moreover, follow-up will be necessary to determine the correlation between the discovery of circulating cancer cells and prognosis. We believe that this approach identifies kidney cancer patients at risk for metastatic disease.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by a Grant-in-Aid for Scientific Research (Grant 11557118) from the Ministry of Education, Science, Sports and Culture of Japan. Back

2 To whom requests for reprints should be addressed, at Department of Urology, Kochi Medical School, Kohasu, Okoh-cho, Nankoku, Kochi 783-8505, Japan. Phone: 81-88-880-2401; Fax: 81-88-880-2404; E-mail: shuint{at}kochi-ms.ac.jp Back

3 The abbreviations used are: RCC, renal cell carcinoma; VHL, von Hippel-Lindau; RT-PCR, reverse transcription-PCR; MMLV, Moloney murine leukemia virus; CT, computed tomography. Back

Received 4/18/00; revised 7/17/00; accepted 7/17/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Kosary C. L., McLaughlin J. K. Kidney and renal pelvis Miller B. A. Reis L. A. G. Hankey B. F. Kosary C. L. Harras A. Edwards B. K. eds. . SEER Cancer Statistics Review, : 1973-1990, National Cancer Institute Bethesda, MD 1993.
  2. Holthofer H., Miettinen A., Paasivuo R., Lehto V. P., Linder E., Alfthan O., Virtanen I. Cellular organ and differentiation of renal carcinomas. A fluorescence microscopic study with kidney-specific antibodies, anti-intermediate filament antibodies, and lectins. Lab. Invest., 49: 319-326, 1983.
  3. Ritchie A. W. S., deKernion J. B. The natural history and clinical features of renal carcinoma. Semin. Nephrol., 7: 131-139, 1987.[Medline]
  4. Motzer R. J., Bander N. H., Nanus D. M. Renal cell carcinoma. N. Engl. J. Med., 335: 865-875, 1996.[Free Full Text]
  5. Anker P., Lefort F., Vasioukhin V., Lyautey J., Lederrey C., Chen X., Stroun M., Mulcahy H. E., Farthing M. J. K-ras mutations are found in DNA extracted from the plasma of colorectal cancer patients. Gastroenterology, 112: 1114-1120, 1997.[CrossRef][Medline]
  6. Kopreski M. S., Benko F. A., Kwee C., Leitzel K. E., Lipton A., Goche C. D. Detection of mutant K-ras DNA in plasma or serum of patients with colorectal cancer. Br. J. Cancer, 76: 1293-1299, 1997.[Medline]
  7. Hibi K., Robinson R., Wu L., Hamilton S. R., Sidranski D., Jen J. Molecular detection of genetic alterations in the serum of colorectal cancer patients. Cancer Res., 58: 1405-1407, 1998.[Abstract/Free Full Text]
  8. Sorenson G. D., Pribish D. M., Valone F. H., Memoli V. A., Bzik D. J., Yao S. L. Soluble normal and mutated DNA sequences from single copy genes in human blood. Cancer Epidemiol. Biomark. Prev., 3: 67-71, 1994.[Abstract]
  9. Mulcahy H. E., Lyautey J., Lederrey C., Chen X., Anker P., Alstead E. M., Ballinger A., Farthing M. J. G., Stroun M. A prospective study of K-ras mutations in the plasma of pancreatic cancer patients. Clin. Cancer Res., 4: 271-275, 1998.[Abstract/Free Full Text]
  10. Vasioukhin V., Anker P., Maurice P., Lyautey J., Lederrey C., Stroun M. Point mutations of the N-ras in the blood plasma DNA of patients with myelodysplastic syndrome or acute myelogenous leukemia. Br. J. Haematol., 86: 774-779, 1994.[Medline]
  11. Gnarra J. R., Tory K., Weng Y., Schmidt L., Wei M. H., Li H., Latif F., Liu S., Chen F., Duh F. M., Lubensky I., Duan D. R., Florence C., Pozzatti R., Walther M. M., Bander N. H., Grossman H. B., Brauch H., Pomer S., Brooks J. D., Issac W. B., Lerman M. I., Zbar B., Linehan W. M. Mutations of the VHL tumor suppressor gene in renal carcinoma. Nat. Genet., 7: 85-90, 1994.[CrossRef][Medline]
  12. Shuin T., Kondo K., Torigoe S., Kishida T., Kubota Y., Hosaka M., Nagashima Y., Kitamura H., Latif F., Zbar B., Lerman M. I., Yao M. Frequent somatic mutations and loss of heterozygosity of the von Hippel-Lindau tumor suppressor gene in primary human renal cell carcinomas. Cancer Res., 54: 2852-2855, 1994.[Abstract/Free Full Text]
  13. Foster K., Prowse A., van den Berg A., Fleming S., Hulsbeek M. M., Crossey P. A., Richards F. M., Cairns P., Affara N. A., Ferguson-Smith M. A., Buys C. H. C. M., Maher E. R. Somatic mutations of the von Hippel-Lindau disease tumor suppressor gene in non-familial clear cell renal carcinoma. Hum. Mol. Genet., 3: 2169-2173, 1994.[Abstract/Free Full Text]
  14. Horikoshi T., Danenberg K. D., Stadlbauer T. H. W., Volkenandt M., Shea L. C. C., Aigner K., Gustavsson B., Leichman L., Frösing R., Ray M., Gibson N. W., Spears C. P., Danenberg P. V. Quantitation of thymidylate synthase, dihydrofolate reductase, and DT-diaphorase gene expression in human tumors using the polymerase chain reaction. Cancer Res., 52: 108-116, 1992.[Abstract/Free Full Text]
  15. Tada M., Omata M., Kawai S., Saisho H., Ohto M., Saiki R. K., Sninsky J. J. Detection of ras gene mutations in pancreatic juice and peripheral blood of patients with pancreatic adenocarcinoma. Cancer Res., 53: 2472-2474, 1993.[Abstract/Free Full Text]
  16. Goessl C., Heicappell R., Munker R., Anker P., Stroun M., Krause H., Müller M., Miller K. Microsatellite analysis of plasma DNA from patients with clear cell renal carcinoma. Cancer Res., 58: 4728-4732, 1998.[Abstract/Free Full Text]
  17. Eisenberger C. F., Schoenberg M., Enger C., Hortopan S., Shah S., Chow N-H., Marshall F. F., Sidransky D. Diagnosis of renal cancer by molecular urinalysis. J. Natl. Cancer Inst., 91: 2028-2032, 1999.[Abstract/Free Full Text]
  18. McKiernan J. M., Buttyan R., Bander N. H., de la Taille A., Stifelman M. D., Emanuel E. R., Bagiella E., Rubin M. A., Katz A. E., Olsson C. A., Sawczuk I. S. The detection of renal cell carcinoma cells in the peripheral blood with an enhanced reverse transcriptase-polymerase chain reaction assay for MN/CA9. Cancer (Phila.), 86: 492-497, 1999.[CrossRef][Medline]
  19. Uemura H., Nakagawa Y., Yoshida K., Saga S., Yoshikawa K., Hirao Y., Oosterwijk E. MN/CA IX/G250 as a potential target for immunotherapy of renal cell carcinomas. Br. J. Cancer, 81: 741-746, 1999.[CrossRef][Medline]
  20. Latif F., Tory K., Gnarra J., Yao M., Duh F. M., Orcutt M. L., Stackhouse T., Kuzmin I., Modi W., Geil L., Schmidt L., Zhou F., Li H., Wei M. H., Chen F., Glenn G., Choyke P., Walther M. M., Weng Y., Duan D. R., Dean M., Glavac D., Richards F. M., Crossey P. A., Ferguson-Smith M. A., Le Paslier D., Chumakov I., Cohen D., Chinault A. C., Maher E. R., Linehan W. M., Zbar B., Lerman M. I. Identification of the von Hippel-Lindau disease tumor suppressor gene. Science (Washington DC), 260: 1317-1320, 1993.[Abstract/Free Full Text]
  21. Hayashi N., Egami H., Kai M., Kurusu Y., Takano S., Ogawa M. No-touch isolation technique reduces intraoperative shedding of tumor cells into the portal vein during resection of colorectal cancer. Surgery (St. Louis), 125: 369-374, 1999.[Medline]
  22. Slanetz C. J. Effect of no touch isolation on survival and recurrence in curative resections for colorectal cancer. Ann. Surg. Oncol., 5: 390-398, 1998.[Abstract]



This article has been cited by other articles:


Home page
Cancer Res.Home page
R. E. Banks, P. Tirukonda, C. Taylor, N. Hornigold, D. Astuti, D. Cohen, E. R. Maher, A. J. Stanley, P. Harnden, A. Joyce, et al.
Genetic and Epigenetic Analysis of von Hippel-Lindau (VHL) Gene Alterations and Relationship with Clinical Variables in Sporadic Renal Cancer
Cancer Res., February 15, 2006; 66(4): 2000 - 2011.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ashida, S.
Right arrow Articles by Shuin, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ashida, S.
Right arrow Articles by Shuin, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online