
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Faculté des Sciences, Pavillon des Isotopes, 1211 Geneva [X. q. C., J. L., C. L., M. S., P. A.]; Département de Gynécologie, Hôpital Cantonal Universitaire, 1211 Geneva [H. B., S. M., P. S.]; Département de Pathologie, Faculté de Médecine, Université, 1211 Geneva [M-F. P.]; Département de Chirurgie, Hôpital de la Tour, 1217 Geneva [P. M.], Switzerland; and Digestive Diseases Research Centre, St. Bartholomews Hospital, London E1 2AD, United Kingdom [H. E. M.]
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Gene alterations identical to those found within the primary tumor have been detected in extracellular circulating DNA extracted from the plasma and serum of breast cancer patients. These include microsatellite instability or loss of heterozygosity (12, 13, 14, 15) , p53 gene alterations (16) , and aberrant methylation of the p16INK4a gene (12 , 17) . Such data, combined with the results obtained from the plasma and sera of patients with other cancers (18) , suggest that a diagnostic or prognostic test for cancer might be developed using genetic markers within blood. In addition to DNA, RNA has also been found circulating in the plasma and sera of normal subjects and in those with cancer. Kamm and Smith (19) found high concentrations of RNA in the plasma of healthy individuals, and Wieczorek et al. (20, 21, 22) reported similar findings in a variety of cancer types. More recently, tyrosinase mRNA has been detected convincingly in the plasma of malignant melanoma patients (23) , and cell-free EBV-associated RNA has been detected in the plasma of patients with nasopharyngeal carcinoma (24) .
Eukaryotic chromosomal ends consist of repeating DNA sequences (TTAGG) termed "telomeres." These stabilizing terminal sequences become progressively shortened during each cell cycle, eventually resulting in cellular death. Telomerase is a ribonucleoprotein enzyme that adds telomeric repeats onto chromosomal ends, thereby replacing the lost DNA. Telomerase is composed of two core enzymatic subunits, hTR3 and hTERT. hTR and hTERT expression is related to telomerase activity (25, 26, 27, 28, 29) . Thus, normal somatic cells have low or undetectable telomerase levels whereas cancers, including breast cancer, have detectable telomerase activity in 85100% of cases (30) . In this study, we report the presence hTR and the catalytic subunit hTERT in both tumor and serum samples taken from breast cancer patients.
| Materials and Methods |
|---|
|
|
|---|
Sample Collection.
Blood was collected prior to surgery in plain tubes for serum sampling.
After clotting, tubes were centrifuged at 900 x g for
15 min at room temperature, and the serum was collected. This was
followed by a second 15-min centrifugation at 900 x g
to remove cellular debris. Serum samples were aliquoted and stored at
-70°C until use. Tumor samples were removed at the time of surgery.
The tumor was histopathologically characterized to confirm its
diagnosis. A small portion was taken for study purposes, part being
used for RNA extraction and part being stored at -70°C for
additional extractions.
RNA Extraction.
RNA was extracted using a commercially available kit (SV Total RNA
Isolation System; Promega, Madison, WI), according to the
manufacturers instructions with a slight modification for serum
samples. To each 100 µl of serum was directly added 175 µl of
SV RNA lysis buffer. Only fresh or once-frozen thawed serum was
used.
RT-PCR for hTR, hTERT, and GAPDH RNA.
The Qiagen One Step RT-PCR kit (Qiagen, Basel, Switzerland) was used to
detect the presence of hTR, hTERT, and GAPDH RNA in tumor and serum.
For hTR analysis, 1ng of tumor RNA was used in a 25-µl RT-PCR
reaction mixture containing 400 µM each of
deoxynucleotide triphosphate, Omniscript reverse transcriptase
(designed for all reverse transcription with any amount of RNA from 50
ng to 2 mg/reaction), Sensiscript reverse transcriptase (optimized for
very small amounts of RNA, <50 ng), hot-start Taq DNA polymerase, and
0.15 µM primers P1 and P2. The mixture of the two systems
was found empirically to increase sensitivity. In the case of serum
RNA, the quantity being too small to be measured by UV, two
concentrations were used each time corresponding to 1 and 5 µl of the
extract because sometimes 1 µl was not sufficient. The RT-PCR
conditions were an initial incubation at 50°C for 30 min followed by
a 95°C incubation for 15 min to activate the HotstarTaq DNA
Polymerase, then 50 cycles at 94°C (30 s), 65°C (1 min), 72°C (1
min), and a 10-min final extension at 72°C. RT-PCR conditions were
identical for the detection of hTERT, except that 0.3 µM
primers P3 and P4 were used. GAPDH was used as a PCR quality control.
Again, control PCR conditions were identical, except that 0.075
µM primers P5 and P6 were used in the RT-PCR reaction.
Primers used were as follows: (a) for hTR (sense), GAAGGGCG-TAGGCGCCGTGCTTTTGC and (antisense), GTTTGCTCTAGAATGAACGGTGGAAGG; (b) for hTERT (sense), TGACACCTCACCTCACCCAC and (antisense) CACTGTCTTCCGCAAGTTCAC; and (c) for GAPDH (sense), CGGAGTCAACGGATTTGGTCGTAT and (antisense) AGCCTTCTCCATGGTGGTGAAGAC.
PCR amplification yielded products of 111 bp for hTR, 95 bp for hTERT, and 308 bp for GAPDH RNA. Products were run at 55°C on Elchrom Scientific S-50 gels (Elchrom Scientific, Cham, Switzerland), stained with SYBR-gold (Molecular Probes, Eugene, OR) for 45 min, and destained twice in a darkroom for 30 min with deionized water. Molecular analyses were performed by personnel blinded to clinical and pathological data, and all experiments were repeated at least once. A number of samples appeared positive initially, but were negative thereafter. Only samples clearly positive twice were scored as positive. Fishers exact test and Wilcoxons rank-sum test were used for the statistical analysis of categorical and continuous data, respectively.
| Results |
|---|
|
|
|---|
|
|
| Discussion |
|---|
|
|
|---|
This is the first time that tumor-related RNA has been reported in the sera of breast cancer patients. Tumor DNA has already been reported in the plasma or the sera of breast cancer patients (12, 13, 14, 15, 16, 17) using microsatellite, p53 mutations or p16 hypermethylation. No single marker has yielded such a high percentage of positive cases. To reach 66% of the plasmas of breast cancer patients bearing a tumor-related DNA alteration, Silva et al. (12) had to use 6 microsatellite markers, p53 mutations, and methylation patterns of the first exon of p16.
The presence of hTR and hTERT in the serum is probably the reflexion of the expression of this RNA which took place in the tumor cells. Expression of hTR and hTERT has been reported to be observed specifically in telomerase-positive cancer cell lines and clinical cancer tissues (25, 26, 27, 28, 29) . The hTERT and hTR subunits are independently expressed in vivo, and little is known about the mechanism of their assembly (27) . This might explain the discordance of hTERT and hTR results in the sera of several patients. This kind of discordance has already been observed by others (25 , 27 , 28) .
Telomerase activity is not observed easily in the serum due to the degradation of the RNA components of the nucleoprotein. However these RNA components are still large enough to be put in evidence with a RT-PCR, resulting in small PCR products. The PCR conditions we used (50 cycles) were adapted for the analysis of serum DNA. It is interesting to note that in the same conditions, all lymphocytes, whether they came from healthy controls or from patients, were positive (results not shown). This is not surprising, because telomerase activity has been reported in normal lymphocytes (31) . But with this simple method, all sera from healthy controls were negative, and an important percentage of cancer patient sera were clearly positive. Of course, real time PCR could be used in the future and might increase the amount of cases detected by giving the number of copies in healthy persons and cancer patients.
Telomerase RNA might serve as a useful cancer marker in the future. Previous studies have shown that telomerase activity is an extremely frequent finding in neoplastic disease, and serum analysis might therefore be applied to the detection of a broad range of cancers. Indeed, we have detected hTR and hTERT in the sera of five of five patients with gastrointestinal malignancies (data not shown). This indicates that the phenomenon of circulating extracellular tumor-derived mRNA is not confined to any one cancer type, but may actually be a relatively ubiquitous finding across a broad range of cancers at various pathological stages.
| FOOTNOTES |
|---|
1 Supported by La Ligue Suisse contre Cancer
(Grant KFS 905-09-1999) and the O. J. Isvet Fund (Grant 747). ![]()
2 To whom requests for reprints should be
addressed, at Pavillon des Isotopes, 20 bvd dYvoy, Genève 1211,
Switzerland. Phone: 42-22-702-63-37; Fax: 42-22-781-51-93; E-mail: anker{at}sc2a.unige.ch ![]()
3 The abbreviations used are: hTR, telomerase RNA
template; hTERT, telomerase reverse transcriptase protein; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase. ![]()
Received 6/12/00; revised 7/17/00; accepted 7/17/00.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Fischer, M. Nishio, S. C. Peters, M. Tschernatsch, M. Walberer, S. Weidemann, R. Heidenreich, P. O. Couraud, B. B. Weksler, I. A. Romero, et al. Signaling mechanism of extracellular RNA in endothelial cells FASEB J, July 1, 2009; 23(7): 2100 - 2109. [Abstract] [Full Text] [PDF] |
||||
![]() |
E C W Hung, R W K Chiu, and Y M D Lo Detection of circulating fetal nucleic acids: a review of methods and applications J. Clin. Pathol., April 1, 2009; 62(4): 308 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. KATSIMPOULA, M. PATRINOU-GEORGOULA, N. MAKRILIA, K. DIMAKOU, A. GUIALIS, D. ORFANIDOU, and K.N. SYRIGOS Overexpression of hnRNPA2/B1 in Bronchoscopic Specimens: A Potential Early Detection Marker in Lung Cancer Anticancer Res, April 1, 2009; 29(4): 1373 - 1382. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Miyamoto, M. Yanai, S. Ookubo, N. Awasaki, K. Takami, and R. Imai Detection of Cell-Free, Liver-Specific mRNAs in Peripheral Blood from Rats with Hepatotoxicity: A Potential Toxicological Biomarker for Safety Evaluation Toxicol. Sci., December 1, 2008; 106(2): 538 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Terrin, E. Rampazzo, S. Pucciarelli, M. Agostini, R. Bertorelle, G. Esposito, P. DelBianco, D. Nitti, and A. De Rossi Relationship Between Tumor and Plasma Levels of hTERT mRNA in Patients with Colorectal Cancer: Implications for Monitoring of Neoplastic Disease Clin. Cancer Res., November 15, 2008; 14(22): 7444 - 7451. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Garcia, V. Garcia, C. Pena, G. Dominguez, J. Silva, R. Diaz, P. Espinosa, M. J. Citores, M. Collado, and F. Bonilla Extracellular plasma RNA from colon cancer patients is confined in a vesicle-like structure and is mRNA-enriched RNA, July 1, 2008; 14(7): 1424 - 1432. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Garcia, C. Pena, V. Garcia, G. Dominguez, C. Munoz, J. Silva, I. Millan, R. Diaz, Y. Lorenzo, R. Rodriguez, et al. Prognostic Value of LISCH7 mRNA in Plasma and Tumor of Colon Cancer Patients Clin. Cancer Res., November 1, 2007; 13(21): 6351 - 6358. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rani, M. Clynes, and L. O'Driscoll Detection of Amplifiable mRNA Extracellular to Insulin-Producing Cells: Potential for Predicting Beta Cell Mass and Function Clin. Chem., November 1, 2007; 53(11): 1936 - 1944. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Collado, V. Garcia, J. M. Garcia, I. Alonso, L. Lombardia, R. Diaz-Uriarte, L. A. Lopez Fernandez, A. Zaballos, F. Bonilla, and M. Serrano Genomic Profiling of Circulating Plasma RNA for the Analysis of Cancer Clin. Chem., October 1, 2007; 53(10): 1860 - 1863. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fischer, T. Gerriets, C. Wessels, M. Walberer, S. Kostin, E. Stolz, K. Zheleva, A. Hocke, S. Hippenstiel, and K. T. Preissner Extracellular RNA mediates endothelial-cell permeability via vascular endothelial growth factor Blood, October 1, 2007; 110(7): 2457 - 2465. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, D. Elashoff, M. Oh, U. Sinha, M. A.R. St John, X. Zhou, E. Abemayor, and D. T. Wong Serum Circulating Human mRNA Profiling and Its Utility for Oral Cancer Detection J. Clin. Oncol., April 10, 2006; 24(11): 1754 - 1760. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Garcia, J. M. Garcia, C. Pena, J. Silva, G. Dominguez, A. Hurtado, I. Alonso, R. Rodriguez, M. Provencio, and F. Bonilla Thymidylate synthase messenger RNA expression in plasma from patients with colon cancer: prognostic potential. Clin. Cancer Res., April 1, 2006; 12(7): 2095 - 2100. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C.K. Wong, R. W.K. Chiu, N. B.Y. Tsui, K.C. A. Chan, L. W. Chan, T. K. Lau, T. N. Leung, and Y.M. D. Lo Circulating Placental RNA in Maternal Plasma Is Associated with a Preponderance of 5' mRNA Fragments: Implications for Noninvasive Prenatal Diagnosis and Monitoring Clin. Chem., October 1, 2005; 51(10): 1786 - 1795. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B. Larrabee, K. L. Johnson, I. Peter, and D. W. Bianchi Presence of Filterable and Nonfilterable Cell-Free mRNA in Amniotic Fluid Clin. Chem., June 1, 2005; 51(6): 1024 - 1026. [Full Text] [PDF] |
||||
![]() |
N. Miura, Y. Maeda, T. Kanbe, H. Yazama, Y. Takeda, R. Sato, T. Tsukamoto, E. Sato, A. Marumoto, T. Harada, et al. Serum Human Telomerase Reverse Transcriptase Messenger RNA as a Novel Tumor Marker for Hepatocellular Carcinoma Clin. Cancer Res., May 1, 2005; 11(9): 3205 - 3209. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Z. Bischoff, D. E. Lewis, and J. L. Simpson Cell-free fetal DNA in maternal blood: kinetics, source and structure Hum. Reprod. Update, January 1, 2005; 11(1): 59 - 67. [Abstract] [Full Text] [PDF] |
||||
![]() |
A M Gilbey, D Burnett, R E Coleman, and I Holen The detection of circulating breast cancer cells in blood J. Clin. Pathol., September 1, 2004; 57(9): 903 - 911. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. C. Wong, S. F. E. Lo, M. T. Cheung, K. O. E. Ng, C. W. Tse, B. S. P. Lai, K. C. Lee, and Y. M. D. Lo Quantification of Plasma {beta}-Catenin mRNA in Colorectal Cancer and Adenoma Patients Clin. Cancer Res., March 1, 2004; 10(5): 1613 - 1617. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. El-Hefnawy, S. Raja, L. Kelly, W. L. Bigbee, J. M. Kirkwood, J. D. Luketich, and T. E. Godfrey Characterization of Amplifiable, Circulating RNA in Plasma and Its Potential as a Tool for Cancer Diagnostics Clin. Chem., March 1, 2004; 50(3): 564 - 573. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Rainer, N. Y.L. Lam, N. B.Y. Tsui, E. K.O. Ng, R. W.K. Chiu, G. M. Joynt, and Y.M. D. Lo Effects of Filtration on Glyceraldehyde-3-Phosphate Dehydrogenase mRNA in the Plasma of Trauma Patients and Healthy Individuals Clin. Chem., January 1, 2004; 50(1): 206 - 208. [Full Text] [PDF] |
||||
![]() |
K. Pantel, V. Muller, M. Auer, N. Nusser, N. Harbeck, and S. Braun Detection and Clinical Implications of Early Systemic Tumor Cell Dissemination in Breast Cancer Clin. Cancer Res., December 15, 2003; 9(17): 6326 - 6334. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Bunn Jr Early Detection of Lung Cancer Using Serum RNA or DNA Markers: Ready for """Prime Time""" or for Validation? J. Clin. Oncol., November 1, 2003; 21(21): 3891 - 3893. [Full Text] [PDF] |
||||
![]() |
A. Rathi, A. K. Virmani, K. Harada, C. F. Timmons, K. Miyajima, R. J. Hay, D. Mastrangelo, A. Maitra, G. E. Tomlinson, and A. F. Gazdar Aberrant Methylation of the HIC1 Promoter Is a Frequent Event in Specific Pediatric Neoplasms Clin. Cancer Res., September 1, 2003; 9(10): 3674 - 3678. [Abstract] [Full Text] [PDF] |
||||
![]() |
B M Ryan, F Lefort, R McManus, J Daly, P W N Keeling, D G Weir, and D Kelleher A prospective study of circulating mutant KRAS2 in the serum of patients with colorectal neoplasia: strong prognostic indicator in postoperative follow up Mol. Pathol., June 1, 2003; 56(3): 172 - 179. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. O. Ng, N. B. Y. Tsui, T. K. Lau, T. N. Leung, R. W. K. Chiu, N. S. Panesar, L. C. W. Lit, K.-W. Chan, and Y. M. D. Lo From the Cover: mRNA of placental origin is readily detectable in maternal plasma PNAS, April 15, 2003; 100(8): 4748 - 4753. [Abstract] [Full Text] [PDF] |
||||
![]() |
B M Ryan, F Lefort, R McManus, J Daly, P W N Keeling, D G Weir, and D Kelleher A prospective study of circulating mutant KRAS2 in the serum of patients with colorectal neoplasia: strong prognostic indicator in postoperative follow up Gut, January 1, 2003; 52(1): 101 - 108. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. B.Y. Tsui, E. K.O. Ng, and Y.M. D. Lo Stability of Endogenous and Added RNA in Blood Specimens, Serum, and Plasma Clin. Chem., October 1, 2002; 48(10): 1647 - 1653. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Johnson and Y.M. D. Lo Plasma Nucleic Acids in the Diagnosis and Management of Malignant Disease Clin. Chem., August 1, 2002; 48(8): 1186 - 1193. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Anker and M. Stroun Progress in the Knowledge of Circulating Nucleic Acids: Plasma RNA Is Particle-Associated. Can It Become a General Detection Marker for a Cancer Blood Test? Clin. Chem., August 1, 2002; 48(8): 1210 - 1211. [Full Text] [PDF] |
||||
![]() |
E. K.O. Ng, N. B.Y. Tsui, N. Y.L. Lam, R. W.K. Chiu, S. C.H. Yu, S.C. C. Wong, E. S.F. Lo, T. H. Rainer, P. J. Johnson, and Y.M. D. Lo Presence of Filterable and Nonfilterable mRNA in the Plasma of Cancer Patients and Healthy Individuals Clin. Chem., August 1, 2002; 48(8): 1212 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
J M Silva, R Rodriguez, J M Garcia, C Munoz, J Silva, G Dominguez, M Provencio, P Espana, and F Bonilla Detection of epithelial tumour RNA in the plasma of colon cancer patients is associated with advanced stages and circulating tumour cells Gut, April 1, 2002; 50(4): 530 - 534. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Hess and W. E. Highsmith Jr Telomerase Detection in Body Fluids Clin. Chem., January 1, 2002; 48(1): 18 - 24. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Silva, G. Dominguez, J. Silva, J. M. Garcia, A. Sanchez, O. Rodriguez, M. Provencio, P. Espana, and F. Bonilla Detection of Epithelial Messenger RNA in the Plasma of Breast Cancer Patients Is Associated with Poor Prognosis Tumor Characteristics Clin. Cancer Res., September 1, 2001; 7(9): 2821 - 2825. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. O. Hasselmann, G. Rappl, W. Tilgen, and U. Reinhold Extracellular Tyrosinase mRNA within Apoptotic Bodies Is Protected from Degradation in Human Serum Clin. Chem., August 1, 2001; 47(8): 1488 - 1489. [Full Text] [PDF] |
||||
![]() |
Q. Su, S.-F. Wang, T.-E. Chang, R. Breitkreutz, H. Hennig, K. Takegoshi, L. Edler, and C. H. Schroder Circulating Hepatitis B Virus Nucleic Acids in Chronic Infection : Representation of Differently Polyadenylated Viral Transcripts during Progression to Nonreplicative Stages Clin. Cancer Res., July 1, 2001; 7(7): 2005 - 2015. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |