Clinical Cancer Research The Science of Cancer Health Disparities
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Navari, J. R.
Right arrow Articles by Phillips, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Navari, J. R.
Right arrow Articles by Phillips, B.
Clinical Cancer Research Vol. 6, 4026-4032, October 2000
© 2000 American Association for Cancer Research

Molecular Oncology, Markers, Clinical Correlates

Loss of Estrogen Receptor (ER) Expression in Endometrial Tumors Is Not Associated with de Novo Methylation of the 5' End of the ER Gene1

Jason R. Navari, Philip Y. Roland, Pacita Keh, Helga B. Salvesen, Lars A. Akslen, Ole E. Iversen, Soma Das, Rajul Kothari, Susan Howey and Benette Phillips2

Department of Obstetrics and Gynecology, Northwestern University Medical School, Chicago, Illinois 60611 [J. R. N., P. Y. R., P. K., R. K., S. H., B. P.]; Department of Pathology, The Gade Institute [H. B. S., L. A. A.], and Department of Gynecology and Obstetrics [H. B. S., O. E. I.], Haukeland University Hospital, N-5021 Bergen, Norway; and Department of Human Genetics, The University of Chicago, Chicago, Illinois 60637 [S. D.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Normal endometrium, an estrogen-responsive tissue, expresses the estrogen receptor (ER) {alpha} gene. Loss of ER expression, the basis for which is currently unknown, is often seen in advanced stage, poor prognosis endometrial tumors. The ER gene undergoes de novo methylation with high frequency in a wide variety of human tumors, including ER-negative breast cancers. In this study, we used several bisulfite-based detection methods to assess whether loss of ER positivity in endometrial tumors is associated with aberrant methylation of the ER gene. Although extensive methylation of a 600-bp region at the 5' end of the gene was seen in two endometrial carcinoma cell lines, none of the 55 CpGs in this region was methylated in 25 of 26 ER-deficient endometrial carcinomas.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Adenocarcinoma of the endometrium is the most common reproductive tract malignancy in women. The normal glandular epithelium from which the cancer arises is hormone responsive, expressing both progesterone receptors and ERs3 . Whereas early-stage, well differentiated endometrial carcinomas usually retain expression of both receptors, advanced stage, poorly differentiated tumors often lack one or both of these receptors. The absence of these receptors has correlated in many, but not all, studies, with a poor prognosis (e.g., reduced disease-free survival or increased recurrence rate; Refs. 1 and 2 ). The mechanism by which loss of expression of these receptors occurs is not known.

Epigenetic as well as genetic alterations can result in loss of gene expression in cancer. An extensive literature documents the aberrant methylation of CpG islands comprising the regulatory regions and 5' exons of genes that function in cell cycle inhibition, DNA repair, cell-cell or cell-matrix adhesion, or inhibition of angiogenesis (reviewed in Ref. 3 ). This methylation has been demonstrated or is presumed to be associated with transcriptional repression (4 , 5) . A gene that frequently undergoes de novo methylation in a wide variety of tumors is the ER-{alpha} gene. Methylation has been reported in breast (6) , colon (7) , lung (8) , and brain tumors (9) and in several types of hematological malignancies (10) . In breast tumors, methylation and ER-negativity are closely linked (6 , 11) , although low-level methylation of the ER gene is frequently seen in ER-positive breast tumors as well (11) . The purpose of this study was to test the hypothesis that methylation of the ER gene is associated with loss of ER expression in endometrial carcinomas.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Sample Collection, Isolation of Genomic DNA, and ER Analysis.
Twenty tumor samples were obtained from patients undergoing surgery for endometrial cancer at Northwestern Memorial Hospital (Chicago, IL). Ten samples of nonmalignant endometrial tissue were obtained from the same patients. Nonmalignant samples consisted of normal endometrium, endometriosis, atypical hyperplasia, complex hyperplasia, or benign polyps. All patients gave informed consent before collection of specimens according to institutional guidelines. Part of each sample was snap-frozen in liquid nitrogen and stored at -80°C. After pulverization under liquid nitrogen, genomic DNA was isolated by standard methods using SDS-proteinase K and RNase digestions, phenol-chloroform extraction, and ethanol precipitation. The remainder of each specimen was fixed in formalin for histological examination and for evaluation of ER expression. IHC staining for the ER was performed on 5-µm paraffin-embedded sections. After rehydration, sections were incubated at 37°C with an anti-ER mouse monoclonal antibody (clone 6 F11; Ventana Medical Systems, Tucson, AZ). A strepavidin-biotin reporter system with diaminobenzadine chromogen (Ventana) was used to detect binding of the primary antibody, with all reagents applied robotically. Methyl green was used as a counterstain. In every IHC analysis, a serial section not exposed to primary antibody was included, and a section of ER-positive endometrium was stained in parallel. The percentage of glandular cells staining positive was determined for 10 high-power fields, and an average percentage of positive stain was determined.

DNA was also isolated from ER-negative endometrial carcinoma cells microdissected from three paraffin-embedded tissue sections. Two of these sections were prepared from tumors collected for this study, whereas the third was an archival section. Areas containing ER-negative cells were scraped from an unstained section using as a template a serial section in which ER-negative areas had been identified by IHC analysis. The scraped material was deparaffinized using octane, and the DNA was recovered after proteinase K digestion, phenol-chloroform extraction, and ethanol precipitation (12) . Three micrograms of carrier DNA (Saccharomyces cerevisiae genomic DNA; Promega) were added to facilitate precipitation.

Twenty endometrial carcinoma samples collected between 1981 and 1990 as part of a prospective study of prognostic factors for endometrial cancer at Haukeland University Hospital (Bergen, Norway) were also examined in this study. Specimens harvested for DNA isolation were taken from a site visually judged to be representative of the tumor, divided into three parts, and frozen in ethanol at -20°C. One part was used for receptor analysis, a second part for DNA isolation, and a third part for histological evaluation. Cytosolic ER content was measured using the single saturating dose technique (13) . Samples with <=30 fmol receptor/mg protein were classified as low expressors.

The endometrial carcinoma cell lines Hec-1-A and KLE were obtained from American Type Culture Collection and maintained in DME/10% fetal bovine serum. Genomic DNA was isolated from pelleted nuclei by lysis in N-laurylsarcosine, RNase and proteinase K digestion, phenol-chloroform extraction, and ethanol precipitation (14) .

Methylation Analysis.
Three micrograms of HindIIIdigested genomic DNA were bisulfite-treated according to published protocols (15) . Briefly, the DNA was denatured in 0.3 M NaOH and then incubated for 16 h at 55°C in the presence of 0.5 mM hydroquinone and 3.1 M sodium bisulfite. The DNA was purified using a GeneClean kit (Bio 101, La Jolla, CA) desulfonated in 0.3 M NaOH, ethanol precipitated, and dissolved in 100 µl of water.

A 580-nt region of the ER gene was amplified from the bisulfite-treated DNA using nested primers. This region comprised 70 nt upstream of the ts site and 510 nt downstream of the ts site. The primers were designed using sequences deposited in GenBank (accession no. X62462) and from regions that lacked CpG dinucleotides. A 9-nt ApaI recognition site was appended to the 5' ends of the inner primers. The sequences of the outer primers were 5'TTCTCCAAATAATAAAACACCTACTAA3' (nt 3404–3376) and 5'GTTTTTTTTGGGTTATTTTTAGTAGATTTT3' (nt 2512–2541). The sequences of the inner primers were 5'AGTGGGCCCCTATTAAATAAAAAAAAACCCCCCAAACC3' (nt 3308–3280) and 5' AGTGGGCCCGTTAATGTTAGGGTAAGGTAATAGTTTTTGG3' (nt 2667–2697). All amplifications used Ampliwax PCR gems (Perkin-Elmer/Cetus) for "hot start" and contained 1XPCR buffer [50 mM KCl and 10 mM Tris (pH 8.8)], 2.5 mM MgCl2, 0.2 mM each dNTP, 9.3 µM each primer, 2.5 units of Taq polymerase, and 3 µl of bisulfite-treated DNA in a total volume of 75 µl. After completion of the first round of amplification, 3 µl were withdrawn and used as template for the second round of amplification. Conditions for the first round of amplification were 1 cycle of 94°, 2 min; 5 cycles of 94°C, 1 min, 52°, 2 min, 72°, 3 min; 25 cycles of 94°C, 0.5 min, 52°, 2 min, 72°, 1.5 min; and 1 cycle of 72°, 6 min. Conditions for the second round of amplification were 1 cycle of 94°, 2 min; 25 cycles of 94°C, 0.5 min, 52°, 2 min, 72°, 1.5 min; and 1 cycle of 72°, 6 min.

The amplimers were electrophoresed on a Seaplaque (FMC BioProducts) agarose gel and gel purified. Recovered products were analyzed by digestion with AciI or sequenced directly. Before AciI digestion, we assessed whether bisulfite conversion was complete using two restriction enzymes (AluI and EcoRII), the recognition sites of which contain Cs not followed by Gs. The amplimer contains five sites each for AluI and EcoRII. Only amplimers that were not cleaved by either enzyme (indicating that each of the Cs within the 10 sites had been completely converted to Us) were tested for digestion by AciI, the recognition site (GCGG) of which contains a CpG. Digests were electrophoresed on agarose gels, and the products were visualized using ethidium bromide. Amplimers were manually sequenced from both ends using a Thermosequenase kit (Amersham).

MSP was performed using primer pair sequences and amplification conditions as described previously (16) , except that the 1x buffer used for amplification was 10 mM Tris (pH 8.8) and 50 mM KCl.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
We examined the methylation status of CpGs in the 5' end of the ER-{alpha} gene in two endometrial carcinoma cell lines, in nonmalignant endometrium, and in endometrial carcinomas that expressed the ER at normal or reduced levels. The region examined, which encompasses most of exon 1 as well as 70 bp of sequences immediately upstream of the ts site, contains 55 CpGs and comprises a CpG island (Fig. 1)Citation . CpGs in this region of the ER gene are methylated in many types of tumors (6, 7, 8, 9, 10, 11) . Age-related methylation of these sequences has also been shown to occur in normal colon (7) and in the right atrium of the heart (17) .



View larger version (5K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. The region of the ER-{alpha} gene, the methylation status of which was examined in this study. The region comprises 510 nt of exon 1 sequences and 70 nt upstream of the ts site (bent arrow). Numbering is according to GenBank accession no. x62462. Vertical lines denote the positions of CpGs. AciI sites (A), used in COBRA, are indicated above the horizontal line, and the locations of primer pairs 1, 4, and 5 used for MSP are shown below the line.

 
Bisulfite Sequencing.
We used several different approaches to assess the methylation status, all of which rely on an initial treatment of genomic DNA with sodium bisulfite. Such treatment converts unmethylated Cs to Us but does not alter methylated Cs. In our initial experiment, we bisulfite-treated genomic DNA that had been isolated from normal endometrium and from two ER-negative (18) endometrial carcinoma cell lines, KLE and Hec-1-A. After amplification of the 5' end of the ER gene, the amplimers were sequenced from both ends. In the normal endometrial sample, there were no bands in the C lane (top strand amplimer sequence) or the G lane (bottom strand amplimer sequence), indicating that none of the 55 CpGs in the genomic DNA was methylated (Fig. 2Citation A). By contrast, in both endometrial carcinoma cell lines, every CpG was methylated in at least a fraction of the alleles in the population. Visual inspection of the intensities of the bands in the C and G lanes (relative to those of the comigrating bands in the T and A lanes, respectively) suggested that in Hec-1-A cells the ER gene was methylated to a greater degree than in KLE cells (Fig. 2Citation A).



View larger version (67K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. A, methylation status of the 5' end of the ER gene in normal endometrium and in endometrial cell lines, as assessed by bisulfite sequencing. Genomic DNA was isolated from normal endometrium and from the endometrial carcinoma cell lines KLE and Hec-1-A. After bisulfite treatment, 580 nt at the 5' end of the ER gene were amplified, and the gel-purified amplimers were sequenced from both ends. Representative regions of the sequencing gel, which reveal the methylation status of 28 CpGs, are shown. Arrows denote bands that appear in Lane C (when sequencing the amplimer from the upstream end) or Lane G (when sequencing from the downstream end); these bands correspond to Cs that were methylated in the genomic DNA. B, methylation status of the 5' end of the ER gene in two endometrial cell lines, as assessed by COBRA. Gel-purified amplimers were digested with AciI. AciI sites in genomic DNA will survive bisulfite treatment and be retained in the amplimer only if the CpGs within them are methylated.

 
COBRA.
The sequencing results were then compared with those obtained using COBRA (combined bisulfite restriction analysis; Ref. 19 ), a more facile detection method in which the methylation status is evaluated by amplifying a region of interest from bisulfite-treated DNA and digesting with a restriction enzyme, the recognition site of which contains one or more CpGs (e.g., AciI). The genomic sequence of interest in the ER gene contains seven AciI sites (Fig. 1)Citation ; these sites will survive bisulfite treatment and be retained in the amplimer only if the CpGs within these sites were methylated. Consistent with the sequencing data, both the KLE and Hec-1-A amplimers were digested with AciI, and the Hec-1-A amplimer was digested to a greater extent than the KLE amplimer (Fig. 2Citation rer* B). Thus, in two endometrial cell lines, the 5' end of the ER gene has undergone extensive de novo methylation, and this methylation is easily detectable by COBRA.

We then used COBRA to assess the methylation status of this same region in 26 ER-deficient endometrial tumors, the clinicopathological data for which are shown in Table 1Citation . Additionally, we examined ER-negative carcinoma cells microdissected from three paraffin-embedded sections. Whereas all surgical samples are likely to contain a heterogeneous mix of normal and tumor cells, thus reducing the sensitivity of detection, the microdissected samples are highly enriched for ER-negative endometrial carcinoma cells. Representative results are shown in Fig. 3Citation . For 25 of the 26 samples, no digestion of the amplimers by AciI was detected. We also failed to detect any AciI digestion of amplimers derived from 14 ER-positive tumors and 10 samples of nonmalignant endometrial samples (data not shown). In one tumor sample (32, bottom), approximately half of the alleles in the population appeared to be cut at a single AciI site. Sequencing of this amplimer revealed partial methylation of a single cluster of three CpGs, located at +9, +16, and +20 relative to the ts site; the remaining CpGs were unmethylated (data not shown). The CpG at +9 is part of an AciI site (Fig. 1)Citation . The COBRA results, thus, suggest that, in contrast to its widespread occurrence in many tumors of diverse types, de novo methylation of the 5' end of the ER gene occurs very rarely during tumorigenesis in the endometrium.


View this table:
[in this window]
[in a new window]

  		Table 1 %Clinicopathological features of ER-deficient endometrial tumors

 


View larger version (43K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. Methylation status of the 5' end of the ER gene in ER-deficient endometrial tumors, as assessed by COBRA. DNA was purified from endometrial tumors or from microdissected paraffin-embedded specimens (designated by P following the tumor number; bottom). 55P is an archival specimen, prepared from a tumor not collected for this study. After bisulfite treatment, 580 nt at the 5' end of the ER gene were amplified, and the gel-purified amplimers were digested with AciI. Representative results from 20 tumor samples collected at Haukeland University Hospital are shown at the top; samples collected at Northwestern Memorial Hospital are shown at the bottom.

 
MSP.
Because methylation of the ER gene is so prevalent in tumors, we wanted to check whether low levels of ER gene methylation, not detectable by COBRA, were present in the endometrial tumor samples. We, therefore, reanalyzed the samples using MSP, a technique that detects methylation at selected CpGs with very high sensitivity (16) . In this approach, primer pairs are designed such that they will specifically amplify sequences from bisulfite-treated DNA depending on whether Cs have or have not been converted to Us. M primer pairs can only generate a product if the genomic sequences to which they correspond were methylated in the genomic DNA used for bisulfite treatment; conversely, U primer pairs can only generate a product if these same sequences were unmethylated. In addition to its high sensitivity, this approach allowed us to assess the methylation status of CpGs additional to those contained within the seven AciI sites analyzed by COBRA.

Three different sets of U and M primer pairs (sets 1, 4, and 5), used previously to detect ER gene methylation in breast tumor samples (11) , were tested for their ability to generate the expected sized products from bisulfite-treated DNAs. The location of these primers is shown in Fig. 1Citation . As a positive control, a sample of bisulfite-treated DNA consisting of 5% Hec-1-A DNA and 95% normal endometrial DNA was run along with the tumor samples. Representative results from analyses of the 20 samples collected at Haukeland University Hospital are shown in Fig. 4Citation . Although all three M primer pairs yielded readily detectable products from the positive control, they did not amplify the identical sequences from any of the tumor DNAs, indicating that <5% of the ER alleles in the tumor samples were methylated at the CpGs examined. The appropriately sized products were generated in all of the samples by the U primer pairs (Fig. 4)Citation . Identical results were seen with all of the tumor samples collected at Northwestern Memorial Hospital (data not shown). (The three CpGs methylated in tumor 32 from Northwestern Memorial Hospital, which showed cleavage at a single AciI site, are not represented in any of the primers used for the MSP analysis.)



View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. Methylation status of the 5' end of the ER gene in ER-negative or ER-deficient endometrial tumors, as assessed by MSP. Bisulfite-treated DNA was amplified using three sets of primer pairs. In each set, M primer pairs can only anneal to sequences that were methylated before bisulfite treatment, whereas the U primer pairs can only anneal to sequences that were unmethylated. As a positive control, a mix of 5% Hec-1-A genomic DNA was mixed with 95% normal endometrial DNA before bisulfite treatment. Top, results using primer set 1; middle, results using primer set 4; bottom, results using primer set 5.

 
Microdissected Samples.
Whereas we were able to amplify the 580-bp region at the 5' end of the ER gene from the microdissected samples using nested primers, none of the three samples yielded products with any of the M or U primer pairs (probably due to the very small amount of DNA extracted from these samples). We, therefore, sequenced the 580-bp amplimers directly. No bands corresponding to methylated Cs were detected in any of the three samples (shown for sample 41P in Fig. 5Citation ). Therefore, even in three endometrial carcinoma samples in which all or the great majority of cells were ER negative, methylation of the 5' end of the ER gene was undetectable.



View larger version (91K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. Methylation status of the 5' end of the ER gene in ER-negative endometrial cancer cells microdissected from paraffin-embedded sample 41P, as assessed by bisulfite sequencing. Genomic DNA was purified from microdissected cells. After bisulfite treatment, 580 nt at the 5' end the ER gene were amplified, and the gel-purified amplimers were sequenced from both ends. Representative regions of the sequencing gel, which reveal the methylation status of 28 CpGs, are shown.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Although the 5' end of the ER gene is methylated in two endometrial carcinoma cell lines and is highly susceptible to de novo methylation in a wide variety of tumors, including many in which a tumor suppressor role for the ER has not yet been established, the ER gene seems to be highly refractory to de novo methylation in endometrial tumors, in which loss of ER expression is common and may signify a poor prognosis. The hypothesis that loss of ER expression in endometrial carcinomas is associated with aberrant de novo methylation of the 5' end of the ER gene is, thus, clearly refuted by these data. Our results extend those recently reported by Hori et al. (20) , who used digestion with methylation-sensitive restriction enzymes, followed by semiquantitative PCR to examine the methylation status of five CpGs clustered in a 55-bp region near the 3' end of exon 1. Methylation of these CpGs was detected in only 2 of 12 ER-negative endometrioid carcinomas and in 0 of 26 ER-positive endometrioid carcinomas. These authors did detect methylation of the same CpGs in 6 of 18 samples of normal secretory phase endometria and in 6 of 16 samples of simple endometrial hyperplasia, however. By contrast, we failed to detect any methylation in 10 samples of nonmalignant endometrial tissue. Because these samples were collected from patients whose mean age was 64 years, these results suggest that in contrast to its occurrence in colon and heart (7 , 17) , age-related methylation of the ER gene does not occur in the endometrium.

Although we cannot rule out the possibility that the loss of ER expression is associated with the methylation of three CpGs just downstream of the ts site in the single tumor that showed ER gene methylation, it is clear that methylation-associated transcriptional silencing does not account for the great majority of cases of loss of ER expression in endometrial carcinomas. The basis for the loss of ER gene expression in endometrial tumors, thus, remains to be elucidated. By contrast, a link between ER methylation and loss of ER expression in breast carcinomas and in breast cancer cell lines has been demonstrated (6 , 11) , and a similar association has been reported for colon cancers (7) . CpGs that were shown to be methylated in these and other tumors were included in the region of the ER gene that we examined in this study.

In endometrial tumors, ER gene methylation is conspicuous by its almost complete absence. There are several possible explanations for this finding. Methylation of the ER gene may be manifest only in those tumors in which loss of ER expression confers a selective advantage, and endometrial tumors may not fall into that category. Although loss of ER expression is frequently seen in advanced stage, poorly differentiated endometrial tumors, there is disagreement as to whether this loss facilitates tumor progression. Second, our failure to detect methylation during tumorigenesis may be linked to our failure to detect age-related methylation of the ER gene in normal endometrium. It has been shown that many of the genes that are hypermethylated in colon cancers, the ER gene among them, are also methylated in an age-dependent manner in normal colon (21) . Finally, the low incidence of methylation of the ER gene may reflect a low overall level of genomic hypermethylation in endometrial cancers. The p16 gene, which like the ER gene is a frequent target of methylation in multiple tumor types (22 , 23) , was recently found to be methylated in only 1 of 138 endometrial tumors, including 26 tumors where p16 expression was diminished or absent (24) . The only gene that has thus far consistently been reported to be methylated in endometrial tumors is the mismatch repair gene hMLH1, which is methylated in most cases of endometrial cancers showing microsatellite instability and in a subset of precursor lesions (25, 26, 27, 28) . A recently published study in which the methylation status of >1000 CpG islands was monitored using restriction landmark genomic scanning (29) suggested that tumor types differ both with regard to overall levels of gene hypermethylation and to the specific genes that are preferred targets of this hypermethylation. Our results clearly exemplify this second point. The analysis of endometrial tumor samples using this methodology or other global methylation screening techniques should reveal which, if any, genes besides hMLH1 are susceptible to hypermethylation during tumorigenesis of the endometrium.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by a Northwestern Memorial Hospital Intramural Research grant (to P. Y. R. and B. P.). Back

2 To whom requests for reprints should be addressed, at Department of Obstetrics and Gynecology, Tarry 4-755, Northwestern University Medical School, 303 East Chicago, Chicago, IL 60611. Phone: (312) 503-7883; Fax: (312) 908-8773; E-mail: schallma{at}northwestern.edu Back

3 The abbreviations used are: ER, estrogen receptor; IHC, immunohistochemical; ts, transcription start; MSP, methylation-specific PCR; COBRA, combined bisulfite restriction analysis; nt, nucleotide. Back

Received 5/15/00; revised 7/28/00; accepted 8/ 8/00.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gehrig P. A., Le L. V., Olatidoye B., Geradts J. Estrogen receptor status, determined by immunohistochemistry, as a predictor of the recurrence of stage I endometrial carcinoma. Cancer (Phila.), 86: 2083-2089, 1999.[CrossRef][Medline]
  2. Pertschuk L. P., Masood S., Simone J., Feldman J. G., Fruchter R. G., Axiotis C. A., Greene G. L. Estrogen receptor immunocytochemistry in endometrial carcinoma: a prognostic marker for survival. Gynecol. Oncol., 63: 28-33, 1996.[CrossRef][Medline]
  3. Baylin S. B., Herman J. G. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet., 16: 168-174, 2000.[CrossRef][Medline]
  4. Jones P. L., Veenstra G. J., Wade P. A., Vermaak D., Kas S. U., Landsberger N., Strouboulis J., Wolffe A.P. Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat. Genet., 19: 87-91, 1998.[CrossRef][Medline]
  5. Nan X., Ng H. H., Johnson C. A., Laherty C. D., Turner B. M., Eisenman R. N., Bird A. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature (Lond.), 393: 386-389, 1998.[CrossRef][Medline]
  6. Lapidus R. G., Ferguson A. T., Ottaviano Y. L., Parl F. F., Smith H. S., Weitzman S. A., Baylin S. B., Issa J. P. J., Davidson N. E. Methylation of estrogen and progesterone receptor gene 5' CpG islands correlates with lack of estrogen and progesterone receptor gene expression in breast tumors. Clin. Cancer Res., 2: 805-810, 1996.[Abstract]
  7. Issa J. P., Ottaviano Y. L., Celano P., Hamilton S. R., Davidson N. E., Baylin S. B. Methylation of the oestrogen receptor CpG island links ageing and neoplasia in human colon. Nat. Genet., 7: 536-540, 1994.[CrossRef][Medline]
  8. Issa J. P., Baylin S. B., Belinsky S. A. Methylation of the estrogen receptor CpG island in lung tumors is related to the specific type of carcinogen exposure. Cancer Res., 56: 3655-3658, 1996.[Abstract/Free Full Text]
  9. Li Q., Jedlicka A., Ahuja N., Gibbons M. C., Baylin S. B., Burger P. C., Issa J. P. Concordant methylation of the ER and N33 genes in glioblastoma multiforme. Oncogene, 16: 3197-3202, 1998.[CrossRef][Medline]
  10. Issa J. P., Zehnbauer B. A., Civin C. I., Collector M. I., Sharkis S. J., Davidson N. E., Kaufmann S. H., Baylin S. B. The estrogen receptor CpG island is methylated in most hematopoietic neoplasms. Cancer Res., 56: 973-977, 1996.[Abstract/Free Full Text]
  11. Lapidus R. G., Nass S. J., Butash K.A., Parl F. F., Weitzman S. A., Graff J. G., Herman J. G., Davidson N. E. Mapping of ER gene CpG island methylation by methylation-specific polymerase chain reaction. Cancer Res., 58: 2515-2519, 1998.[Abstract/Free Full Text]
  12. Greer C. E., Wheeler C. M., Manos M. M. PCR amplification from paraffin-embedded tissues: sample preparation and the effects of fixation Dieffenbach C. W. Dveksler G. S. eds. . PCR Primer-A Laboratory Manual, : 99-112, Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY 1995.
  13. Horwitz K. B., Costlow M. E., McGuire W. L. MCF-7; a human breast cancer cell line with estrogen, androgen, progesterone, and glucocorticoid receptors. Steroids, 26: 785-795, 1975.[CrossRef][Medline]
  14. Becker P. B., Schutz G. Genomic footprinting Setlow J. K. eds. . Genetic Engineering, Principles and Methods, 10: 1-19, Plenum Press New York 1988.
  15. Frommer M., McDonald L. E., Millar D. S., Collis C. M., Watt F., Grigg G. W., Molloy P. L., Paul C. L. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. USA, 89: 1827-1831, 1992.[Abstract/Free Full Text]
  16. Herman J. G., Graff J. R., Myohanen S., Nelkin B. D., Baylin S.B. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA, 93: 9821-9826, 1996.[Abstract/Free Full Text]
  17. Post W. S., Goldschmidt-Clermont P. J., Wilhide C. C., Heldman A. W., Sussman M. S., Ouyang P., Milliken E. E., Issa J. P. Methylation of the estrogen receptor gene is associated with aging and atherosclerosis in the cardiovascular system. Cardiovasc. Res., 43: 985-991, 1999.[Abstract/Free Full Text]
  18. Grenman S. E., Roberts J. A., England B. G., Grönroos M., Carey T. E. In vitro growth regulation of endometrial carcinoma cells by tamoxifen and medroxyprogesterone acetate. Gynecol. Oncol., 30: 239-250, 1988.[CrossRef][Medline]
  19. Xiong Z., Laird P. W. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res., 25: 2532-2534, 1997.[Abstract/Free Full Text]
  20. Hori M., Iwasaki M., Shimazaki J., Inagawa S., Itabashi M. Assessment of hypermethylated DNA in two promoter regions of the estrogen receptor {alpha} gene in human endometrial diseases. Gynecol. Oncol., 76: 89-96, 2000.[CrossRef][Medline]
  21. Toyota M., Ahuja N., Ohe-Toyota M., Herman J. G., Baylin S. B., Issa J. P. CpG island methylator phenotype in colorectal cancer. Proc. Natl. Acad. Sci. USA, 96: 8681-8686, 1999.[Abstract/Free Full Text]
  22. Herman J. G., Merlo A., Mao L., Lapidus R. G., Issa J. P., Davidson N. E., Sidransky D., Baylin S. B. Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res., 55: 4525-4530, 1995.[Abstract/Free Full Text]
  23. Baylin, S. B., Herman, J. G., Graff, J. R., Vertino, P. M., and Issa, J. P. Alterations in DNA methylation: a fundamental aspect of neoplasia. In: G. Klein and G. F. Van de Woude (eds.), Advances in Cancer Research, vol. 72, pp. 141–196. New York: Academic Press, 1998.
  24. Salvesen H. B., Das S., Akslen L. A. Loss of nuclear p16 protein expression is not associated with promoter methylation but defines a subgroup of aggressive endometrial carcinomas with poor prognosis. Clin. Cancer Res., 6: 153-159, 2000.[Abstract/Free Full Text]
  25. Esteller M., Levine R., Baylin S. B., Ellenson L. H., Herman J. G. MLH1 promoter hypermethylation is associated with the microsatellite instability phenotype in sporadic endometrial carcinomas. Oncogene, 17: 2413-2417, 1998.[CrossRef][Medline]
  26. Gurin C. C., Federici M. G., Kang L., Boyd J. Causes and consequences of microsatellite instability in endometrial carcinoma. Cancer Res., 59: 462-466, 1999.[Abstract/Free Full Text]
  27. Simpkins S. B., Bocker T., Swisher E. M., Mutch D. G., Gersell D. J., Kovatich A. J., Palazzo J. P., Fishel R., Goodfellow P. J. MLH1 promoter methylation and gene silencing is the primary cause of microsatellite instability in sporadic endometrial cancers. Hum. Mol. Genet., 8: 661-666, 1999.[Abstract/Free Full Text]
  28. Esteller M., Catasus L., Matias-Guiu X., Mutter G. L., Prat J., Baylin S. B., Herman J. G. hMLH1 promoter hypermethylation is an early event in human endometrial tumorigenesis. Am. J. Pathol., 155: 1767-1772, 1999.[Abstract/Free Full Text]
  29. Costello J. F., Fruhwald M. C., Smiraglia D. J., Rush L. J., Robertson G. P., Gao X., Wright F. A., Feramisco J. D., Peltomaki P., Lang J. C., Schuller D. E., Yu L., Bloomfield C. D., Caligiuri M. A., Yates A., Nishikawa R., Su Huang, H., Petrelli N. J., Zhang X., O’Dorisio M. S., Held W. A., Cavenee W. K., Plass C. Aberrant CpG-island methylation has non-random and tumour-type-specific patterns. Nat. Genet., 24: 132-138, 2000.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
J. J. Pinzone, H. Stevenson, J. S. Strobl, and P. E. Berg
Molecular and Cellular Determinants of Estrogen Receptor {alpha} Expression
Mol. Cell. Biol., June 1, 2004; 24(11): 4605 - 4612.
[Full Text] [PDF]

Home page
 Cancer Res.Home page
W. Wu, B. M. Slomovitz, J. Celestino, L. Chung, A. Thornton, and K. H. Lu
Coordinate Expression of Cdc25B and ER-{alpha} Is Frequent in Low-Grade Endometrioid Endometrial Carcinoma but Uncommon in High-Grade Endometrioid and Nonendometrioid Carcinomas
Cancer Res., October 1, 2003; 63(19): 6195 - 6199.
[Abstract] [Full Text] [PDF]

Home page
 Ann OncolHome page
B. A. Stoll
Oestrogen/insulin-like growth factor-I receptor interaction in early breast cancer: clinical implications
Ann. Onc., February 20, 2002; 13(2): 191 - 196.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. Sasaki, L. Kotcherguina, A. Dharia, S. Fujimoto, and R. Dahiya
Cytosine-Phosphoguanine Methylation of Estrogen Receptors in Endometrial Cancer
Cancer Res., April 1, 2001; 61(8): 3262 - 3266.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Navari, J. R.
Right arrow Articles by Phillips, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Navari, J. R.
Right arrow Articles by Phillips, B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online