| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Clinical Trials |
University of Southern California/Norris Comprehensive Cancer Center, University of Southern California School of Medicine, Los Angeles, California 90033 [D. S., K. D. D., R. M., S. G., D. D. T-W., H-J. L., C. G. L., L. L., P. V. D.], and the Department of Pharmacology and Toxicology, University of Alabama, Birmingham, Alabama 35294 [M. J., R. B. D.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In this study, we examined intratumoral DPD expression as a possible additional determinant of the response of colorectal tumors to 5-FU treatment. DPD reduces the 5,6 double bond of uracil (as well as that of 5-FU) and is the rate-limiting enzyme for 5-FU catabolism (5, 6, 7) . DPD activity is highly variable in normal tissues (8) and, thus, by sufficiently influencing the bioavailability of 5-FU, could affect its pharmacokinetics, toxicity, and antitumor activity. DPD levels not only vary among individuals but also within the same individual on a Circadian rhythm basis (9) . Patients with DPD levels within the normal range rapidly eliminate over 80% of administered 5-FU as 2-fluoro-ß-alanine, whereas patients who are deficient in DPD retain 5-FU over a much longer half-life and excrete mostly unchanged 5-FU in the urine (10) . In such patients, 5-FU can cause profound toxicity (11) . Because inactivation of 5-FU by DPD seemed to be a mechanism of clinical resistance to 5-FU, vigorous efforts have been made to design inhibitors of DPD. The most successful of these, 5-ethynyluracil, markedly improved the efficacy and therapeutic index of 5-FU in rats (12) . In addition to its role in normal tissue toxicity of 5-FU, DPD expression specifically in tumors has been studied as a possible determinant of tumor response to 5-FU. DPD expression is variable among tumors also, and, in head-and-neck tumors, DPD levels have been inversely associated with response to 5-FU (13) .
The above-cited studies, along with previous studies showing that DPD and TS levels both were significantly associated with sensitivity to 5-FU (14) , suggested to us that DPD expression could be a useful 5-FU response determinant in colorectal tumors along with TS and TP expression provided that: (a) intratumoral basal DPD level was associated with clinical efficacy of FU; (b) TS, TP, and DPD expressions were independent variables; and (c) there was sufficient variation among individuals in the expression of this gene. Accordingly, we used quantitative RT-PCR to measure DPD expression (relative mRNA levels) in a group of 33 colorectal tumors in which we had already determined TS and TP expressions, and we correlated these expressions with response to 5-FU-based therapy.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
After two cycles (8 weeks) of treatment, measurable disease was reassessed. Response criteria were the standard definitions used for national cooperative group trials (16) . To be classified as a responder, a tumor had to have a 50% reduction in the sum of the products of the perpendicular diameters of the indicator lesion without growth of other disease or the appearance of new lesions. Those with responses or stable disease were continued on protocol until progression was documented.
Liver metastases represented the most common site of disease on which a biopsy was performed and assessed for response, whereas, in some cases, nodal metastases or peritoneal metastases were the disease sites evaluated. All of the specimens were obtained by core-needle biopsy. This technique uses a coaxial system in which fine-needle aspiration is used to confirm cytological evidence of cancer within moments of the aspiration. The fine needle is withdrawn from a sheath and a core needle is inserted through the sheath without losing position. The core-needle material is used for gene expression analysis. Specimens were examined by pathologists and were not used for analysis unless they were judged to consist of >80% tumor tissue.
Laboratory Methods.
The procedure for RT-PCR quantitation of gene expression has been
described in detail previously (17
, 18)
. In brief, the
method involves isolation of mRNA from each tumor, preparation of cDNA
using reverse transcriptase and random hexamers and PCR amplification
of the specific cDNA of interest in a range of concentrations that
gives rise to a linear curve of the resulting PCR products. An internal
standard gene (for example, ß-actin) from the same cDNA
solution is PCR-amplified separately. We found previously that with
ß-actin as the reference gene, a good linearity is
obtained between gene expression values determined by RT-PCR and
protein content determined by immunohistochemistry (19)
.
Once the concentration ranges for linear amplification are established
for the cDNA of the target gene and the reference gene, the ratio of
the slopes generates an empirical number proportional to the amount of
mRNA of interest in the tissue normalized to total RNA. Gene expression
values are reported only if the PCR of serial dilutions of the cDNA
solution generates a set of distinct bands with intensities that are
linear with the concentration of cDNA. Slopes of the lines are obtained
from at least three data points, so that each reported gene expression
value represents the average of a minimum of three separate PCR
reactions within the linear amplification range. When the initially
chosen cDNA concentrations for a particular determination give PCR
products clearly outside of the proportional linearity region, the
determination is repeated with adjusted cDNA concentrations until the
data points are in the linear range, and the correlation coefficient
for linearity for a set of at least three consecutive serial dilutions
plus the zero point is greater than 0.90. This method has been used by
us (3
, 19)
as well as by others (20)
to
quantitate various gene expressions in tumor biopsy specimens. Gene
expression values are expressed as a ratio of PCR products of the gene
of interest to that of the internal reference gene
ß-actin.
For RT-PCR quantitation of DPD, the following primers were designed based on the sequence of the DPD gene (GenBank accession no. U20938): DPD-1740F, T7-GGTCTTGCTAGCGCAACTCC ("T7" designates the T7 RNA polymerase clamping sequence TAATACGACTCACTATAGGGAGA attached to the 5' end), and DPD-1989R, CCTTTAGTTCAGTGACACTTTGA. These primers were designed to give an amplicon of 250 bp, spanning positions 1740 to 1989 of the genomic sequence. ß-actin primers BA67 and BA68 were described previously (17) . The PCR reaction was performed as described previously (17 , 18) , except that cycling conditions were modified to be optimal for the DPD primers. The cycling conditions for DPD amplification were 15 s at 96°C, 30 s at 65°C, and 30 s at 72°C for 31 cycles.
Statistical Methods.
To evaluate the association of DPD with response and with
survival, DPD was categorized into a low and a high value.
To determine this cutoff value, the maximally selected
2 method of Miller and Halpern (21
, 22)
was adapted. For each observed DPD value,
patients were classified as falling below or equal to that value, or
above that value. The Pearson 2 test statistic
was used to compare the response rates of the two resulting groups of
patients (below or equal to the value versus above the
value). The DPD value that yielded the largest
2 test statistic (the maximal
2 statistic) was selected as the optimal
cut-point. To determine the P-value associated with the
maximal 2 statistic, we performed 2000
bootstrap-like simulations. For each simulation, a randomly selected
DPD value was drawn (with replacement) from the set of
observed DPD values and assigned to each of the observed
responses; the maximal 2 test statistic was
calculated based on this set of randomly matched DPD values
and responses. The corrected P-value was calculated as the
proportion of the 2000 simulated maximal statistics that was larger
than the original maximal 2 test statistic;
the calculated corrected value was 0.033, compared with the uncorrected
P of 0.0041. This analysis was repeated using the
log-rank test to compare survival. For this analysis, the calculated
corrected value was 0.03, compared with the uncorrected P of
0.0015. These corrected Ps account for the fact that all of
the possible DPD values were examined before selecting the
optimal cut-point. In both analyses, the optimal DPD
cut-point was 2.5. The rest of the analysis was descriptive, and
P-values were calculated to reflect the magnitude
of associations rather than to perform formal testing. The cutoff
values for TS and TP expressions were based on
the highest level in the group of responders (therefore, no patient
with a TS 
4.1 or a TP 18 was a
responder). To examine the joint association of TS,
TP, and DPD with either response or survival, the
2x2x2 = 8 groups of patients were examined. The group of
patients with TS 
4, TP 18, and
DPD 2.5, was the largest (n = 11
patients) and also identified a subset with a longer survival; the
outcome of this subset was compared with the others. To evaluate the
association with response, the two-sided Fisher’s exact test was used;
the Spearman correlation was used to evaluate the association between
DPD and TS; the log-rank test was used to measure
the association between TS, TP, and
DPD, and survival. The Ansari-Bradley test was used to
compare the responders and nonresponders in terms of the variability of
DPD gene expression (23)
.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
shows the distributions
of DPD:ß-actin PCR product ratios (henceforth termed
"expressions" for convenience) for the two groups. The range of
DPD expressions among the responding tumors was relatively
narrow (0.60 x 10-3 to 2.5 x
10-3, 4.2-fold) compared with that of the
nonresponders (0.2 x 10-3 to 16 x
10-3, 80-fold). This difference in the range of
gene expression between the responding and nonresponding groups was
significant (P = 0.019, Ansari-Bradley rank test), as
was the lack of responding tumors with DPD expressions
>2.5 x 10-3 (Table 1)
. A total of 22 tumors had
DPD expressions < 2.5 x
10-3 with a corresponding response rate of 50%
(11 of 22).
|
|
showed no correlation between the
expressions of these genes (r2, 0.01),
with a number of low-DPD tumors having high TS
and high-TS tumors having low DPD expressions. As
Fig. 3
further shows, only 1 of 12 tumors
falling within the area designated by the nonresponse cutoff values of
TS and DPD (i.e., having both low
TS and low DPD) was a nonresponder to 5-FU/LV,
but this one tumor (Fig. 3
, tumor 152) had a TP
expression value above its cutoff. Thus, all of the responding tumors
could be identified by low expression values of DPD,
TS, and TP (Fig. 3)
. The response data are
summarized in Table 1
.
|
|
, upper panel). The greatest
increase in survival was observed for the group of patients with all of
the three genes, DPD, TS, and TP below
the respective nonresponse cutoff values (Fig. 4
, lower
panel).
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
), 10 of these low-DPD tumors could be
positively identified as nonresponders by TS expression
values >4.1 x 10-3 (the nonresponse
cutoff value for TS expression). Thus, tumors having both
TS < 4.1 x 10-3 and
DPD < 2.5 x 10-2 in this
group of patients had a 92% response rate. Adding TP
expression as a third determinant allowed all of the responders in this
group of tumors to be identified by low expression of all of the three
genes (Fig. 3)
. These data show how combining more than one independent
response determinant can increase predictive power for clinical
outcome.
It is striking to see in Fig. 3
that the patterns of expression of
TS, DPD, and TP vary over a wide range
and are different in every one of the nonresponding tumors. This almost
chaotic variation of gene expressions among the individual tumors of
the nonresponding group compared with the responding group, suggests
that the transition from a drug-sensitive tumor to one that is
insensitive is accompanied or preceded by a substantial degradation of
the ability of the tumor cells to regulate their gene expressions.
This study also shows that, because response of colorectal tumors to chemotherapy is associated with a significant survival benefit (24) , measuring these gene expressions not only can predict response to 5-FU but also can identify patients with a better survival prognosis. If these results can be confirmed in a clinical trial with a larger set of patients, data on TS, DPD, and TP expressions in tumors would permit more rational decisions on whether or not to proceed with 5-FU-based therapy as first-line treatment. If the 5-FU response indices seem unfavorable, the alternative drug CPT-11 is now available for treatment of colorectal cancer patients. Preliminary results show that tumors with TS expression levels that would put them into the group not expected to respond to 5-FU, or indeed have already been treated and have failed 5-FU, do respond to CPT-11 (25) . If patients destined for 5-FU failure can be identified before the start of treatment, benefits will of course be gained by avoiding the toxicity associated with the drug, but, moreover, it is possible that patients will be more likely to respond to CPT-11 when it is given as primary therapy, compared with its use after 5-FU failure. Thus, the assignment of patients for either 5-FU or CPT-11 treatment by taking into consideration their TS, DPD, or TP levels may provide a way of achieving a substantial increase in the overall response rate to chemotherapy using currently available agents.
|
FOOTNOTES |
|---|
1 Supported by USPHS Grants U01 CA 60108, RO1 CA
39629, RO1 CA60859, and P30 CA 14089. R. M. was supported by Dr.
Mildred Scheel Stiftung, Bonn, Germany. 
2 To whom requests for reprints should be
addressed, at University of Southern California/Norris Comprehensive
Cancer Center CRL-204, 1303 North Mission Road, Los Angeles, CA 90033.
Phone: (213) 224-7788; Fax: (213) 224-7679; E-mail: pdanenbe{at}hsc.usc.edu
3 The abbreviations used are: 5-FU,
5-fluorouracil; TS, thymidylate synthase; DPD, dihydropyrimidine
dehydrogenase; LV, leucovorin; RT, reverse transcription; TP, thymidine
phosphorylase.
Received 7/21/99; revised 1/12/00; accepted 1/19/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2 statistics. Biometrics, 38: 1011-1016, 1982.[CrossRef]
2 statistics for small samples. Biometrics, 38: 1017-1023, 1982.[CrossRef]
This article has been cited by other articles:
|
|
 |
|
  L. N. Kaliberova, D. L. Della Manna, V. Krendelchtchikova, M. E. Black, D. J. Buchsbaum, and S. A. Kaliberov Molecular chemotherapy of pancreatic cancer using novel mutant bacterial cytosine deaminase gene Mol. Cancer Ther., September 1, 2008; 7(9): 2845 - 2854. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. M. Wilson, W. Fazzone, M. J. LaBonte, J. Deng, N. Neamati, and R. D. Ladner Novel opportunities for thymidylate metabolism as a therapeutic target Mol. Cancer Ther., September 1, 2008; 7(9): 3029 - 3037. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Sakurai, I. Yoshida, S. Kamoshida, K. Inaba, J. Isogaki, Y. Komori, I. Uyama, and Y. Tsutsumi Effects of Combined Administration of DPD-Inhibitory Oral Fluoropyrimidine, S-1, Plus Paclitaxel on Gene Expressions of Fluoropyrimidine Metabolism-Related Enzymes in Human Gastric Xenografts Ann. Surg. Oncol., August 1, 2008; 15(8): 2301 - 2309. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. C. Pezo, S. J. Gandhi, L. A. Shirley, R. G. Pestell, L. H. Augenlicht, and R. H. Singer Single-Cell Transcription Site Activation Predicts Chemotherapy Response in Human Colorectal Tumors Cancer Res., July 1, 2008; 68(13): 4977 - 4982. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Soong, N. Shah, M. Salto-Tellez, B. C. Tai, R. A. Soo, H. C. Han, S. S. Ng, W. L. Tan, N. Zeps, D. Joseph, et al. Prognostic significance of thymidylate synthase, dihydropyrimidine dehydrogenase and thymidine phosphorylase protein expression in colorectal cancer patients treated with or without 5-fluorouracil-based chemotherapy Ann. Onc., May 1, 2008; 19(5): 915 - 919. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Okabe, I. Okamoto, S. Tsukioka, J. Uchida, T. Iwasa, T. Yoshida, E. Hatashita, Y. Yamada, T. Satoh, K. Tamura, et al. Synergistic antitumor effect of S-1 and the epidermal growth factor receptor inhibitor gefitinib in non-small cell lung cancer cell lines: role of gefitinib-induced down-regulation of thymidylate synthase Mol. Cancer Ther., March 1, 2008; 7(3): 599 - 606. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Krugluger, A. Brandstaetter, E. Kallay, J. Schueller, E. Krexner, S. Kriwanek, E. Bonner, and H. S. Cross Regulation of Genes of the Circadian Clock in Human Colon Cancer: Reduced Period-1 and Dihydropyrimidine Dehydrogenase Transcription Correlates in High-Grade Tumors Cancer Res., August 15, 2007; 67(16): 7917 - 7922. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Oie, M. Ono, H. Fukushima, F. Hosoi, H. Yano, Y. Maruyama, M. Kojiro, T. Terada, K. Hirano, M. Kuwano, et al. Alteration of dihydropyrimidine dehydrogenase expression by IFN-{alpha} affects the antiproliferative effects of 5-fluorouracil in human hepatocellular carcinoma cells Mol. Cancer Ther., August 1, 2007; 6(8): 2310 - 2318. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Layman, D. G. Thomas, K. A. Griffith, J. B. Smerage, M. A. Helvie, M. A. Roubidoux, K. M. Diehl, L. A. Newman, M. S. Sabel, J. A. Hayman, et al. Neoadjuvant Docetaxel and Capecitabine and the Use of Thymidine Phosphorylase as a Predictive Biomarker in Breast Cancer Clin. Cancer Res., July 15, 2007; 13(14): 4092 - 4097. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. O'Dwyer, S. G. Eckhardt, D. G. Haller, J. Tepper, D. Ahnen, S. Hamilton, A. B. Benson III, M. Rothenberg, N. Petrelli, H.-J. Lenz, et al. Priorities in Colorectal Cancer Research: Recommendations From the Gastrointestinal Scientific Leadership Council of the Coalition of Cancer Cooperative Groups J. Clin. Oncol., June 1, 2007; 25(16): 2313 - 2321. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Del Rio, F. Molina, C. Bascoul-Mollevi, V. Copois, F. Bibeau, P. Chalbos, C. Bareil, A. Kramar, N. Salvetat, C. Fraslon, et al. Gene Expression Signature in Advanced Colorectal Cancer Patients Select Drugs and Response for the Use of Leucovorin, Fluorouracil, and Irinotecan J. Clin. Oncol., March 1, 2007; 25(7): 773 - 780. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. An, P. Robins, T. Lindahl, and D. E. Barnes 5-Fluorouracil Incorporated into DNA Is Excised by the Smug1 DNA Glycosylase to Reduce Drug Cytotoxicity Cancer Res., February 1, 2007; 67(3): 940 - 945. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Oguri, Y. Bessho, H. Achiwa, H. Ozasa, K. Maeno, H. Maeda, S. Sato, and R. Ueda MRP8/ABCC11 directly confers resistance to 5-fluorouracil Mol. Cancer Ther., January 1, 2007; 6(1): 122 - 127. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. W. Suh, J. H. Kim, D. Y. Kim, Y. B. Kim, C. Lee, and S. Choi Which Gene is a Dominant Predictor of Response During FOLFOX Chemotherapy for the Treatment of Metastatic Colorectal Cancer, the MTHFR or XRCC1 Gene? Ann. Surg. Oncol., November 1, 2006; 13(11): 1379 - 1385. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. H. O'Neil and H. L. McLeod Thymidine Phosphorylase and Capecitabine: A Predictive Marker for Therapy Selection? J. Clin. Oncol., September 1, 2006; 24(25): 4051 - 4053. [Full Text] [PDF]
|
|
|
|
|
|
T. Liersch, C. Langer, B. M. Ghadimi, B. Kulle, D. E. Aust, G. B. Baretton, W. Schwabe, P. Hausler, H. Becker, and C. Jakob Lymph Node Status and TS Gene Expression Are Prognostic Markers in Stage II/III Rectal Cancer After Neoadjuvant Fluorouracil-Based Chemoradiotherapy J. Clin. Oncol., September 1, 2006; 24(25): 4062 - 4068. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. J. Meropol, P. J. Gold, R. B. Diasio, M. Andria, M. Dhami, T. Godfrey, A. J. Kovatich, K. A. Lund, E. Mitchell, and R. Schwarting Thymidine Phosphorylase Expression Is Associated With Response to Capecitabine Plus Irinotecan in Patients With Metastatic Colorectal Cancer J. Clin. Oncol., September 1, 2006; 24(25): 4069 - 4077. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Garcia, J. M. Garcia, C. Pena, J. Silva, G. Dominguez, A. Hurtado, I. Alonso, R. Rodriguez, M. Provencio, and F. Bonilla Thymidylate synthase messenger RNA expression in plasma from patients with colon cancer: prognostic potential. Clin. Cancer Res., April 1, 2006; 12(7): 2095 - 2100. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. E. Kemeny, D. Niedzwiecki, D. R. Hollis, H.-J. Lenz, R. S. Warren, M. J. Naughton, J. C. Weeks, E. R. Sigurdson, J. E. Herndon II, C. Zhang, et al. Hepatic Arterial Infusion Versus Systemic Therapy for Hepatic Metastases From Colorectal Cancer: A Randomized Trial of Efficacy, Quality of Life, and Molecular Markers (CALGB 9481) J. Clin. Oncol., March 20, 2006; 24(9): 1395 - 1403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. L. Gomez, S. L. Santillana, C. S. Vallejos, R. Velarde, J. Sanchez, X. Wang, N. L. Bauer, R. D. Hockett, V. J. Chen, C. Niyikiza, et al. A Phase II Trial of Pemetrexed in Advanced Breast Cancer: Clinical Response and Association with Molecular Target Expression Clin. Cancer Res., February 1, 2006; 12(3): 832 - 838. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. H. Smorenburg, G. J. Peters, C. J. van Groeningen, P. Noordhuis, K. Smid, A. M. G. H. van Riel, W. Dercksen, H. M. Pinedo, and G. Giaccone Phase II study of tailored chemotherapy for advanced colorectal cancer with either 5-fluouracil and leucovorin or oxaliplatin and irinotecan based on the expression of thymidylate synthase and dihydropyrimidine dehydrogenase Ann. Onc., January 1, 2006; 17(1): 35 - 42. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Blanquicett, M. W. Saif, D. J. Buchsbaum, M. Eloubeidi, S. M. Vickers, D. C. Chhieng, M. D. Carpenter, J. C. Sellers, S. Russo, R. B. Diasio, et al. Antitumor Efficacy of Capecitabine and Celecoxib in Irradiated and Lead-Shielded, Contralateral Human BxPC-3 Pancreatic Cancer Xenografts: Clinical Implications of Abscopal Effects Clin. Cancer Res., December 15, 2005; 11(24): 8773 - 8781. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Saif, M. A. Eloubeidi, S. Russo, A. Steg, J. Thornton, J. Fiveash, M. Carpenter, C. Blanquicett, R. B. Diasio, and M. R. Johnson Phase I Study of Capecitabine With Concomitant Radiotherapy for Patients With Locally Advanced Pancreatic Cancer: Expression Analysis of Genes Related to Outcome J. Clin. Oncol., December 1, 2005; 23(34): 8679 - 8687. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. M. Pitari, R. I. Baksh, D. M. Harris, P. Li, S. Kazerounian, and S. A. Waldman Interruption of Homologous Desensitization in Cyclic Guanosine 3',5'-Monophosphate Signaling Restores Colon Cancer Cytostasis by Bacterial Enterotoxins Cancer Res., December 1, 2005; 65(23): 11129 - 11135. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Langer, K. Specht, K. Becker, P. Ewald, M. Bekesch, M. Sarbia, R. Busch, M. Feith, H. J. Stein, J.-R. Siewert, et al. Association of Pretherapeutic Expression of Chemotherapy-Related Genes with Response to Neoadjuvant Chemotherapy in Barrett Carcinoma Clin. Cancer Res., October 15, 2005; 11(20): 7462 - 7469. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Westra, H. Hollema, M. Schaapveld, I. Platteel, K. A. Oien, W. N. Keith, R. Mauritz, G. J. Peters, C. H. C. M. Buys, R. M. W. Hofstra, et al. Predictive value of thymidylate synthase and dihydropyrimidine dehydrogenase protein expression on survival in adjuvantly treated stage III colon cancer patients Ann. Onc., October 1, 2005; 16(10): 1646 - 1653. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Ohrling, D. Edler, M. Hallstrom, P. Ragnhammar, and H. Blomgren Detection of Thymidylate Synthase Expression in Lymph Node Metastases of Colorectal Cancer Can Improve the Prognostic Information J. Clin. Oncol., August 20, 2005; 23(24): 5628 - 5634. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. L. Allen and P. G. Johnston Role of Genomic Markers in Colorectal Cancer Treatment J. Clin. Oncol., July 10, 2005; 23(20): 4545 - 4552. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Ricciardiello, C. Ceccarelli, G. Angiolini, M. Pariali, P. Chieco, P. Paterini, G. Biasco, G. N. Martinelli, E. Roda, and F. Bazzoli High Thymidylate Synthase Expression in Colorectal Cancer with Microsatellite Instability: Implications for Chemotherapeutic Strategies Clin. Cancer Res., June 1, 2005; 11(11): 4234 - 4240. [Abstract |
