
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Oncology, Markers, Clinical Correlates |
Pathology Division, National Cancer Center Research Institute, Tokyo 104-0045, Japan
| ABSTRACT |
|---|
|
|
|---|
1 cm) than in those
with small (<1 cm) nodal metastasis. These results support the
hypothesis that two VEGF family members are involved in lymph node
metastasis at two distinct steps; VEGF-C facilitates entry of cancer
cells into the lymph vasculature, whereas VEGF-A promotes the growth of
metastatic tumor through angiogenesis. The results also suggest that
the balance between VEGF-C and VEGF-D could be important rather than
the level of VEGF-C alone. Whether a low VEGF-D level plays a causative
role in lymph node metastasis requires further investigation. | INTRODUCTION |
|---|
|
|
|---|
VEGF-C (6, 7, 8, 9) was initially identified as a ligand of VEGFR-3, which at the time was an "orphan" receptor that showed sequence similarity to VEGFR-1 and VEGFR-2. Because expression of VEGFR-3 is largely restricted to lymphatic endothelium (10, 11, 12) , the major function of VEGF-C appears to be the regulation of lymphatic vessel growth. Transgenic mice that overexpress VEGF-C in keratinocytes develop numerous dilated lymphatic vessels in the skin (13) . Recent studies suggest that VEGF-C may promote spread of cancer cells through lymphatic channels (14 , 15) . VEGF-D was isolated as a fos-inducible factor from mouse skin fibroblasts (16) and through database searches for sequences that show homology to VEGF-C (17 , 18) . Because of their sequence similarity, VEGF-C and VEGF-D are thought to have similar biological functions.
In the present study, we studied the expression of VEGF-C and VEGF-D in lung adenocarcinoma and investigated its relationship to lymph node metastasis, one of the most important prognostic factors in lung cancer (19 , 20) . We also studied the expression of VEGF-A and VEGF-B. VEGF-A appears to be involved in lymph node metastasis of lung and colorectal cancers (21, 22, 23) ; the significance of VEGF-B expression in tumors is still unclear (5 , 24 , 25) .
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
RNA Extraction.
Total RNA was isolated using an RNeasy kit (Qiagen). The purity and
concentration of RNA were determined by spectrophotometry at 260 nm.
The quality of RNA was checked by the electrophoresis of 23-µg
samples in a 1% agarose gel, staining with ethidium bromide, and
examining the 28S and 18S rRNA bands on a UV transilluminator. No
significant degradation was observed in any RNA samples.
Real-Time RT-PCR.
The quantitation of relative mRNA abundance was carried out using a
real-time fluorescence detection method using TaqMan chemistry
(28)
. This method has been used in several recent papers
to measure gene expression (29, 30, 31, 32)
. Briefly, 50 ng of
total RNA were reverse transcribed, and the gene of interest was PCR
amplified with rTth DNA polymerase using gene-specific primers in a
single-tube, single-enzyme system. During PCR amplification, the 5'-3'
nuclease activity of the rTth DNA polymerase releases a TaqMan probe
that hybridized to amplified sequences. The TaqMan probe contains a
reporter dye (FAM) at the 5' end and quencher dye (TAMRA) at the 3'
end. Cleavage of the probe by rTth DNA polymerase separates the
reporter from the quencher. The resulting increase of fluorescence
signal can be detected by the laser detector of the ABI Model 7700
Sequence Detection System (Perkin-Elmer Applied Biosystems, Urayasu,
Chiba). In this system, the cycle at which the fluorescent intensity
first exceeds a threshold value (Ct) is determined for each
sample. By running serial dilutions of a reference sample, a standard
curve is generated in each experiment. The target message of the
unknown sample is then determined by measuring its Ct and by
using the standard curve. The linearity of the standard curve ensures
that the starting quantity of the target molecule is inversely
proportional to its Ct. The reference RNA samples used to
generate standard curves were obtained from a lung adenocarcinoma cell
line, L-27, for VEGF-A, VEGF-B, and VEGF-C, and a neuroblastoma cell
line, NB39 nu, for VEGF-D. All experiments were performed in duplicate,
and the mean values were calculated. The results were normalized for
18S rRNA, the abundance of which was also determined by TaqMan RT-PCR.
The results were expressed in arbitrary units. Negative controls
lacking template RNA were always included in each experiment.
The following oligonucleotides were used for real-time RT-PCR: (a) forward VEGF-A primer, 5'-CTTGCCTTGCTGCTCTACC-3'; reverse VEGF-A primer, 5'-CACACAGGATGGCTTGAAG-3'; VEGF-A probe, 5'-FAM AGTTCATGGATGTCTATCAGCGCAGCT TAMRA-3'; (b) forward VEGF-B primer, 5'-AGCACCAAGTCCGGATG-3'; reverse VEGF-B primer, 5'-GTCTGGCTTCACAGCACTG-3', VEGF-B probe, 5'-FAM AGATCCTCATGATCCGGTACCCG TAMRA-3'; (c) forward VEGF-C primer, 5'-TGCCGATGCATGTCTAAACT-3'; reverse VEGF-C primer, 5'-TGAACAGGTCTCTTCATCCAGC-3'; VEGF-C probe, 5'-FAM CAGCAACACTACCACAGTGTCAGGCA TAMRA-3'; (d) forward VEGF-D primer, 5'-GTATGGACTCTCGCTCAGCAT-3'; reverse VEGF-D primer, 5'-AGGCTCTCTTCATTGCAACAG-3'; VEGF-D probe, 5'-FAM AAGAACTCAGTGCAGCCCTAGAGAAACG TAMRA-3'; and (e) forward 18S rRNA primer, 5'-CGGCTACCACATCCAAGGAA-3'; reverse 18S rRNA primer, 5'-GCTGGAATTACCGCGGCT-3'; 18S rRNA probe, 5'-6-carboxy-4-5-dichloro-2,7-dimethoxyfluorescein TGCTGGCA-CCAGACTTGCCCTC TAMRA-3'.
The primers for VEGF-A span exon 1 to exon 3 and thus detect all isoforms of VEGF-A. To distinguish different VEGF-A isoforms, a second set of primers were designed: a second forward VEGF-A primer, 5'-GAGTGCCCACTGAGGAGTC-3', and a second reverse VEGF-A primer, 5'-GCCTCGGCTTGTCACAT-3'. These primers spanned exon 3 to exon 8 and thus allowed discrimination between different isoforms of VEGF-A, i.e., VEGF-A121, VEGF-A165, VEGF-A189, and VEGF-A206, by the electrophoresis of PCR products in agarose gels.
The PCR amplification was performed using a 96-well optical tray and caps in a final reaction volume of 50 µl. The reaction mixture consisted of 200 nM each primer, 100 nM probe, 0.1 unit/µl rTth DNA polymerase, 300 µM each of dATP, dCTP, and dGTP, 600 µM dUTP, 3 mM manganese acetate, 0.01 unit/µl AmpErase uracil N-glycosylase, and 1x TaqMan buffer containing a reference dye. The RT-PCR cycle parameters were as follows: 50°C for 2 min, 60°C for 30 min, and 95°C for 5 min, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. Primers and probes were designed using the computer program Primer Express (Perkin-Elmer), following the instructions of the manufacturer. Primers were chosen from sequences of different exons. Sequence specificity of the primers and probes was confirmed by homology searches through databases at National Center for Biotechnology Information using the computer program BLASTN. Additionally, we sequenced the PCR products and confirmed their identity with the target sequence. Primers and probes were purchased from Greiner Japan (Tokyo) and Perkin-Elmer Applied Systems, respectively.
Statistics.
Kruskal-Wallis one-way ANOVA was first performed to decide whether
there was a significant difference between different groups. If we
observed statistical difference by this global analysis, the difference
between two groups was determined by the Mann-Whitney U
test. The correlation between clinicopathological parameters and levels
of VEGF family members was evaluated by Spearmans rank correlation
coefficients. The correlation between the presence of lymph node
metastasis and that of lymphatic invasion in the 60 cases of lung
adenocarcinoma was determined by Fishers probability exact test.
Calculation was performed using the computer program StatView (Abacus
Concepts, Berkeley, CA). The results were considered significant if
P < 0.05.
| RESULTS |
|---|
|
|
|---|
|
|
Expression patterns of VEGF-C and VEGF-D were quite different from those of VEGF-A and VEGF-B. Normal lung tissues expressed both VEGF-C and VEGF-D at much higher levels than did tumor tissues (P < 0.01 and P < 0.002, respectively). Comparison between different tumor groups showed that VEGF-C levels tended to be higher in the node-positive group than in the node-negative group, whereas VEGF-D levels tended to be lower in the node-positive group than in the node-negative group. Interestingly, VEGF-D levels seemed to decrease in the following order: normal lung tissue, noninvasive adenocarcinoma, node-negative adenocarcinoma, and node-positive adenocarcinoma.
We also measured the expression levels of VEGF-A, VEGF-B, VEGF-C, and
VEGF-D in seven adenocarcinoma cell lines. As shown in Fig. 2
, all of
the seven adenocarcinoma cell lines expressed VEGF-A and VEGF-B at
levels comparable with those of primary tumors. VEGF-C was expressed at
variable levels in the seven cell lines: at a high level in ABC-1,
L-27, LC-2/ad, and RERF-LC-MS; at a modest level in A549; and at very
low levels in HLC-1 and VMRC-LCD. As in the primary tumors, expression
levels of VEGF-D were very low in all of the seven cell lines.
We then checked whether expression of VEGF-A, VEGF-B, VEGF-C, and
VEGF-D was correlated with other clinicopathological parameters, such
as tumor size, T status, and pathological stage. As shown in Table 2
, we noted a correlation between VEGF-B
and pathological stage (P = 0.03) and a negative
correlation between VEGF-D and tumor size (P = 0.002).
VEGF-D levels were very low (<2.0) in all of the tumors >3.0 cm in
diameter. We did not find any other correlation between expression of
VEGF-A, VEGF-B, VEGF-C, and VEGF-D and the above clinicopathological
parameters.
|
|
|
Lymphatic Invasion of Cancer Cells Is Correlated with a Low
VEGF-D:VEGF-C Ratio.
Next, we asked whether lymphatic invasion of cancer cells is correlated
with expression of VEGF-C or other VEGF family members. Fig. 5
shows mRNA levels of the four VEGF
family members in tumors with (n = 41) or without
(n = 19) lymphatic invasion. We found that VEGF-C
levels tended to be higher (P = 0.053) and VEGF-D
levels were lower (P = 0.006) in tumors with lymphatic
invasion than in those without lymphatic invasion.
|
|
|
VEGF-A Levels Are Correlated with Bulky Lymph Node Metastasis.
Metastasis involves a cascade of events that include: (a)
invasion of cancer cells into blood or lymph vasculature;
(b) suppression of anoikis; (c) evasion from
immune surveillance; and (d) local growth at metastatic
sites (4)
. We reasoned that VEGF-A may be involved in the
growth of metastatic tumor cells through induction of angiogenesis in
the lymph nodes. To confirm this, we subdivided the node-positive group
into two subgroups, one with bulky lymph node metastasis (
1 cm in
diameter), and the other group with small lymph node metastasis (<1 cm
in diameter). Then we compared the expression levels of VEGF family
members in the different groups. As shown in Fig. 8
, VEGF-A levels were higher in tumors
with bulky lymph node metastasis than in tumors with small lymph node
metastasis. VEGF-A levels in tumors with small lymph node metastasis
were very low and appeared to be even lower than in node-negative
tumors. Thus, VEGF-A is likely to be involved in the growth of tumor at
metastatic sites. We compared levels of other VEGF family members
between the different groups, but we did not find any significant
correlations (Fig. 8)
.
|
| DISCUSSION |
|---|
|
|
|---|
Despite this lack of correlation by single factor analysis, scatterplot analysis revealed that an expression pattern of high VEGF-C and low VEGF-D, or a low VEGF-D:VEGF-C ratio, was correlated with both lymph node metastasis and lymphatic invasion of cancer cells. Interestingly, those tumors that showed especially high levels of VEGF-C and low levels of VEGF-D displayed lymphatic invasion of cancer cells outside the main tumor, a situation somewhat resembling "lymphangeal carcinomatosis." These results are consistent with recent reports that showed positive correlation of VEGF-C levels and lymph node metastasis in prostate and stomach cancer (14 , 15) . Because VEGF-D was not measured in these studies, however, it would be necessary to see whether analysis of the combination of VEGF-C and VEGF-D reveals similar findings in these cancers.
Our study showed that VEGF-D levels were down-regulated in the majority of tumor specimens as compared with normal tissue. However, a fraction of lung adenocarcinomas (11 of 60), especially those that were small in size (<3 cm in diameter), retained relatively high levels of VEGF-D mRNA. Interestingly, none of these 11 tumors metastasized to lymph nodes, although some of them expressed VEGF-C at a relatively high level. Whether this is attributable to a possible antimetastatic effect of VEGF-D, or whether the observation of no metastasis in the context of a high VEGF-D level represents a mere association, remains to be clarified.
Tumor cells must undergo multiple steps to establish metastasis (4) . For lymph node metastasis to occur, tumor cells must: (a) enter lymphatic vessels; (b) suppress apoptosis during detachment from the matrix; (c) evade immune surveillance; and (d) turn on the angiogenic switch at metastatic sites. Previous studies found a positive correlation between VEGF-A expression and lymph node metastasis in lung and colorectal cancers (21, 22, 23) . The reason for this correlation was not clear, but it is conceivable that VEGF-A may promote lymph node metastasis of cancer cells through induction of angiogenesis in the lymph nodes. Our observation that VEGF-A levels were higher in tumors with bulky lymph node metastasis than in those with small lymph node metastasis is consistent with this hypothesis. Because metastasis is considered to be a selective process (4) , it is arguable that the characteristics of the metastatic cells with regard to VEGF expression may not be the same as those of cells in the primary tumors. However, this does not necessarily mean that the relevance of data obtained from primary tumors is questionable in terms of deducing or predicting the behavior of tumor cells at metastatic sites. A multitude of previous studies have shown that expression levels of given factors, including VEGF (34) , are correlated with the presence of metastasis and/or disease recurrence.
Taken together, our data are consistent with the hypothesis that VEGF-A and VEGF-C promote lymph node metastasis by distinct mechanisms; the latter facilitates entry of tumor cells into the lymph vasculature, whereas the former stimulates tumor growth at metastatic sites through angiogenesis. VEGF-B appears to be involved in lymph node metastasis in the setting of low VEGF-D and in the progression of lung adenocarcinoma because it was associated with pathological stage. The precise roles of these VEGF family members in cancer progression and metastasis should be elucidated by further functional studies.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by a Grant-in-Aid for the Second Term
Comprehensive 10-year Strategy for Cancer Control from the Ministry of
Health and Welfare of Japan and a Grant-in-Aid for Scientific Research
(C) from the Ministry of Education, Science, Sports and Culture of
Japan. ![]()
2 To whom requests for reprints should be
addressed, at Pathology Division, National Cancer Center Research
Institute, Tsukiji 5-1-1, Chuo-ku, Tokyo, 104-0045 Japan. Phone:
81-3-3542-2511; Fax: 81-3-3248-2463. ![]()
3 The abbreviations used are: VEGF, vascular
endothelial growth factor; VEGFR, VEGF receptor; FAM,
6-carboxyfluorescein; TAMRA,
6-carboxy-N,N,N',N'-tetramethylrhodamine;
RT-PCR, reverse transcription-PCR. ![]()
Received 11/12/99; revised 2/25/00; accepted 2/28/00.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. KUEMMEL, A. THOMAS, S. LANDT, A. FUGER, P. SCHMID, M. KRINER, J.-U. BLOHMER, J. SEHOULI, G. SCHALLER, W. LICHTENEGGER, et al. Circulating Vascular Endothelial Growth Factors and their Soluble Receptors in Pre-invasive, Invasive and Recurrent Cervical Cancer Anticancer Res, February 1, 2009; 29(2): 641 - 645. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Boonkitticharoen, B. Kulapaditharom, J. Leopairut, P. Kraiphibul, N. Larbcharoensub, W. Cheewaruangroj, C. Chintrakarn, and L. Pochanukul Vascular Endothelial Growth Factor A and Proliferation Marker in Prediction of Lymph Node Metastasis in Oral and Pharyngeal Squamous Cell Carcinoma Arch Otolaryngol Head Neck Surg, December 1, 2008; 134(12): 1305 - 1311. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kodama, Y. Kitadai, M. Tanaka, T. Kuwai, S. Tanaka, N. Oue, W. Yasui, and K. Chayama Vascular Endothelial Growth Factor C Stimulates Progression of Human Gastric Cancer via Both Autocrine and Paracrine Mechanisms Clin. Cancer Res., November 15, 2008; 14(22): 7205 - 7214. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-J. Lee, T.-H. Chan, T.-C. Chen, B.-K. Liao, P.-P. Hwang, and H. Lee LPA1 is essential for lymphatic vessel development in zebrafish FASEB J, October 1, 2008; 22(10): 3706 - 3715. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Matsui, Y. Funahashi, T. Uenaka, T. Watanabe, A. Tsuruoka, and M. Asada Multi-Kinase Inhibitor E7080 Suppresses Lymph Node and Lung Metastases of Human Mammary Breast Tumor MDA-MB-231 via Inhibition of Vascular Endothelial Growth Factor-Receptor (VEGF-R) 2 and VEGF-R3 Kinase Clin. Cancer Res., September 1, 2008; 14(17): 5459 - 5465. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sivakumar, N. Sharma-Walia, H. Raghu, M. V. Veettil, S. Sadagopan, V. Bottero, L. Varga, R. Levine, and B. Chandran Kaposi's Sarcoma-Associated Herpesvirus Induces Sustained Levels of Vascular Endothelial Growth Factors A and C Early during In Vitro Infection of Human Microvascular Dermal Endothelial Cells: Biological Implications J. Virol., February 15, 2008; 82(4): 1759 - 1776. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Schafer, C. Wissmann, J. Hertel, V. Lunyak, and M. Hocker Regulation of Vascular Endothelial Growth Factor D by Orphan Receptors Hepatocyte Nuclear Factor-4{alpha} and Chicken Ovalbumin Upstream Promoter Transcription Factors 1 and 2 Cancer Res., January 15, 2008; 68(2): 457 - 466. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Donnem, S. Al-Saad, K. Al-Shibli, M. P. Delghandi, M. Persson, M. N. Nilsen, L.-T. Busund, and R. M. Bremnes Inverse Prognostic Impact of Angiogenic Marker Expression in Tumor Cells versus Stromal Cells in Non Small Cell Lung Cancer Clin. Cancer Res., November 15, 2007; 13(22): 6649 - 6657. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jackowski, M. Janusch, E. Fiedler, W. C. Marsch, E. J. Ulbrich, G. Gaisbauer, J. Dunst, D. Kerjaschki, and P. Helmbold Radiogenic Lymphangiogenesis in the Skin Am. J. Pathol., July 1, 2007; 171(1): 338 - 348. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Juttner, C. Wissmann, T. Jons, M. Vieth, J. Hertel, S. Gretschel, P. M. Schlag, W. Kemmner, and M. Hocker Vascular Endothelial Growth Factor-D and Its Receptor VEGFR-3: Two Novel Independent Prognostic Markers in Gastric Adenocarcinoma J. Clin. Oncol., January 10, 2006; 24(2): 228 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Audet, N. J. Beasley, C. MacMillan, D. G. Jackson, P. J. Gullane, and S. Kamel-Reid Lymphatic Vessel Density, Nodal Metastases, and Prognosis in Patients With Head and Neck Cancer Arch Otolaryngol Head Neck Surg, December 1, 2005; 131(12): 1065 - 1070. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, M. L. Varney, M. W. Backora, K. Cowan, J. C. Solheim, J. E. Talmadge, and R. K. Singh Down-Regulation of Vascular Endothelial Cell Growth Factor-C Expression Using Small Interfering RNA Vectors in Mammary Tumors Inhibits Tumor Lymphangiogenesis and Spontaneous Metastasis and Enhances Survival Cancer Res., October 1, 2005; 65(19): 9004 - 9011. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Tateishi, K. S. Lee, and J. Han Vascular Endothelial Growth Factor-related Angiogenesis * Drs Lee and Han respond: Radiology, June 1, 2005; 235(3): 1084 - 1085. [Full Text] [PDF] |
||||
![]() |
V. Kaushal, P. Mukunyadzi, R. A. Dennis, E. R. Siegel, D. E. Johnson, and M. Kohli Stage-Specific Characterization of the Vascular Endothelial Growth Factor Axis in Prostate Cancer: Expression of Lymphangiogenic Markers Is Associated with Advanced-Stage Disease Clin. Cancer Res., January 15, 2005; 11(2): 584 - 593. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kurahara, S. Takao, K. Maemura, H. Shinchi, S. Natsugoe, and T. Aikou Impact of Vascular Endothelial Growth Factor-C and -D Expression in Human Pancreatic Cancer: Its Relationship to Lymph Node Metastasis Clin. Cancer Res., December 15, 2004; 10(24): 8413 - 8420. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hoeben, B. Landuyt, M. S. Highley, H. Wildiers, A. T. Van Oosterom, and E. A. De Bruijn Vascular Endothelial Growth Factor and Angiogenesis Pharmacol. Rev., December 1, 2004; 56(4): 549 - 580. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Rubbia-Brandt, B. Terris, E. Giostra, B. Dousset, P. Morel, and M. S. Pepper Lymphatic Vessel Density and Vascular Endothelial Growth Factor-C Expression Correlate with Malignant Behavior in Human Pancreatic Endocrine Tumors Clin. Cancer Res., October 15, 2004; 10(20): 6919 - 6928. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yuan, T.-M. Hong, J. J. W. Chen, W. H. Tsai, and M. T. Lin Syndecan-1 up-regulated by ephrinB2/EphB4 plays dual roles in inflammatory angiogenesis Blood, August 15, 2004; 104(4): 1025 - 1033. [Abstract] [Full Text] [PDF] |
||||
![]() |
M J Currie, V Hanrahan, S P Gunningham, H R Morrin, C Frampton, C Han, B A Robinson, and S B Fox Expression of vascular endothelial growth factor D is associated with hypoxia inducible factor (HIF-1{alpha}) and the HIF-1{alpha} target gene DEC1, but not lymph node metastasis in primary human breast carcinomas J. Clin. Pathol., August 1, 2004; 57(8): 829 - 834. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zeng, K. Opeskin, M. E. Baldwin, L. G. Horvath, M. G. Achen, S. A. Stacker, R. L. Sutherland, and E. D. Williams Expression of Vascular Endothelial Growth Factor Receptor-3 by Lymphatic Endothelial Cells Is Associated with Lymph Node Metastasis in Prostate Cancer Clin. Cancer Res., August 1, 2004; 10(15): 5137 - 5144. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Stahlberg, J. Hakansson, X. Xian, H. Semb, and M. Kubista Properties of the Reverse Transcription Reaction in mRNA Quantification Clin. Chem., March 1, 2004; 50(3): 509 - 515. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Abdel-Majid and J. S. Marshall Prostaglandin E2 Induces Degranulation-Independent Production of Vascular Endothelial Growth Factor by Human Mast Cells J. Immunol., January 15, 2004; 172(2): 1227 - 1236. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Goydos and D. H. Gorski Vascular Endothelial Growth Factor C mRNA Expression Correlates with Stage of Progression in Patients with Melanoma Clin. Cancer Res., December 1, 2003; 9(16): 5962 - 5967. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Orlandini, S. Semboloni, and S. Oliviero {beta}-Catenin Inversely Regulates Vascular Endothelial Growth Factor-D mRNA Stability J. Biol. Chem., November 7, 2003; 278(45): 44650 - 44656. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Hung, D. G. Ginzinger, R. Zarnegar, H. Kanauchi, M. G. Wong, E. Kebebew, O. H. Clark, and Q.-Y. Duh Expression of Vascular Endothelial Growth Factor-C in Benign and Malignant Thyroid Tumors J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3694 - 3699. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yokoyama, D. S. Charnock-Jones, D. Licence, A. Yanaihara, J. M. Hastings, C. M. Holland, M. Emoto, A. Sakamoto, T. Sakamoto, H. Maruyama, et al. Expression of Vascular Endothelial Growth Factor (VEGF)-D and Its Receptor, VEGF Receptor 3, as a Prognostic Factor in Endometrial Carcinoma Clin. Cancer Res., April 1, 2003; 9(4): 1361 - 1369. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-W. Tsai, S.-G. Shiah, M.-T. Lin, C.-W. Wu, and M.-L. Kuo Up-regulation of Vascular Endothelial Growth Factor C in Breast Cancer Cells by Heregulin-beta 1. A CRITICAL ROLE OF p38/NUCLEAR FACTOR-kappa B SIGNALING PATHWAY J. Biol. Chem., February 14, 2003; 278(8): 5750 - 5759. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakamura, H. Yasuoka, M. Tsujimoto, Q. Yang, S. Imabun, M. Nakahara, K. Nakao, M. Nakamura, I. Mori, and K. Kakudo Prognostic Significance of Vascular Endothelial Growth Factor D in Breast Carcinoma with Long-Term Follow-Up Clin. Cancer Res., February 1, 2003; 9(2): 716 - 721. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ishikawa, J. Kitayama, S. Kazama, and H. Nagawa Expression of Vascular Endothelial Growth Factor C and D (VEGF-C and -D) is an Important Risk Factor for Lymphatic Metastasis in Undifferentiated Early Gastric Carcinoma Jpn. J. Clin. Oncol., January 1, 2003; 33(1): 21 - 27. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Dafni, T. Israely, Z. M. Bhujwalla, L. E. Benjamin, and M. Neeman Overexpression of Vascular Endothelial Growth Factor 165 Drives Peritumor Interstitial Convection and Induces Lymphatic Drain: Magnetic Resonance Imaging, Confocal Microscopy, and Histological Tracking of Triple-labeled Albumin Cancer Res., November 15, 2002; 62(22): 6731 - 6739. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Virtanen, Y. Ishikawa, D. Honjoh, M. Kimura, M. Shimane, T. Miyoshi, H. Nomura, and M. H. Jones Integrated classification of lung tumors and cell lines by expression profiling PNAS, September 17, 2002; 99(19): 12357 - 12362. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. STACKER, M. E. BALDWIN, and M. G. ACHEN The role of tumor lymphangiogenesis in metastatic spread FASEB J, July 1, 2002; 16(9): 922 - 934. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Jussila and K. Alitalo Vascular Growth Factors and Lymphangiogenesis Physiol Rev, July 1, 2002; 82(3): 673 - 700. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Witmer, J. Dai, H. A. Weich, G. F.J.M. Vrensen, and R. O. Schlingemann Expression of Vascular Endothelial Growth Factor Receptors 1, 2, and 3 in Quiescent Endothelia J. Histochem. Cytochem., June 1, 2002; 50(6): 767 - 778. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Jain and B. T. Fenton Intratumoral Lymphatic Vessels: A Case of Mistaken Identity or Malfunction? J Natl Cancer Inst, March 20, 2002; 94(6): 417 - 421. [Full Text] [PDF] |
||||
![]() |
J. D. White, P. W. Hewett, D. Kosuge, T. McCulloch, B. C. Enholm, J. Carmichael, and J. C. Murray Vascular Endothelial Growth Factor-D Expression Is an Independent Prognostic Marker for Survival in Colorectal Carcinoma Cancer Res., March 1, 2002; 62(6): 1669 - 1675. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Karpanen and K. Alitalo Lymphatic Vessels as Targets of Tumor Therapy? J. Exp. Med., September 17, 2001; 194(6): F37 - F42. [Full Text] [PDF] |
||||
![]() |
M. Skobe, L. M. Hamberg, T. Hawighorst, M. Schirner, G. L. Wolf, K. Alitalo, and M. Detmar Concurrent Induction of Lymphangiogenesis, Angiogenesis, and Macrophage Recruitment by Vascular Endothelial Growth Factor-C in Melanoma Am. J. Pathol., September 1, 2001; 159(3): 893 - 903. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Gunningham, M. J. Currie, C. Han, K. Turner, P. A. E. Scott, B. A. Robinson, A. L. Harris, and S. B. Fox Vascular Endothelial Growth Factor-B and Vascular Endothelial Growth Factor-C Expression in Renal Cell Carcinomas: Regulation by the von Hippel-Lindau Gene and Hypoxia Cancer Res., April 1, 2001; 61(7): 3206 - 3211. [Abstract] [Full Text] |
||||
![]() |
M. S. Pepper Lymphangiogenesis and Tumor Metastasis: Myth or Reality? Clin. Cancer Res., March 1, 2001; 7(3): 462 - 468. [Abstract] [Full Text] |
||||
![]() |
M. Orlandini and S. Oliviero In Fibroblasts Vegf-D Expression Is Induced by Cell-Cell Contact Mediated by Cadherin-11 J. Biol. Chem., February 23, 2001; 276(9): 6576 - 6581. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |