| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Clinical Trials |
Department of Obstetrics and Gynecology [R. D. A., M. N. B.], The Gene Therapy Center [J. G-N., M. W., T. V. S., W. A., D. T. C.], Department of Pharmacology and Toxicology [M. R. J.], The Biostatistics Unit [R. B. A.], Genzyme Corporation [B. L. R.], and Departments of Pathology, Cell Biology, and Surgery [G. P. S.], The University of Alabama at Birmingham, Birmingham Alabama 35233-7333
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Mutation compensation gene therapy approaches have been augmented by recent advances that have allowed for the construction of genes engineered to express intracellular antibodies, commonly known as intrabodies (3 , 4) . These intrabodies generally consist of the light chain variable region of an antibody connected by a small interchain linker to its complimentary heavy chain variable region and are termed sFvs3 Gene therapy approaches using sFv-encoding vectors have been successfully used to alter the activity of specific intracellular proteins in a variety of cell types (4 , 5) . In the context of cancer, modification of subcellular processes involved specifically in the malignant transformation of the target tumor cell is but one of several potential advantages of such an approach.
We have endeavored to use this intrabody strategy to target the erbB-2 protein in ovarian cancer. Several lines of evidence suggest that aberrant expression of the erbB-2 gene (which encodes for a transmembrane receptor with homology to the family of epithelial growth factor receptors) may play an important role in neoplastic transformation and progression (6, 7, 8) . It has been demonstrated that erbB-2 is amplified or overexpressed in a variety of tumors, including ovarian carcinoma (9) . Importantly, a direct correlation has been noted between overexpression of erbB-2 and aggressive tumor behavior and poor overall survival in patients with ovarian cancer (9) . Our preclinical studies using such an intrabody approach to target erbB-2-overexpressing ovarian cancer cells have demonstrated that an erbB-2 sFv could be expressed by an adenoviral-delivered gene and could be localized to the endoplasmic reticulum (10) . This feat resulted in down-regulation of erbB-2 expression, induction of apoptosis, and cytotoxicity in both established and primary ovarian cancer cell lines (10, 11, 12, 13) . Subsequent in vivo studies using an anti-erbB-2-encoding adenovirus (Ad21) demonstrated antitumor activity and prolongation of survival in erbB-2-overexpressing ovarian cancer animal models (14) .
The current study reports our initial efforts to translate this erbB-2-directed intrabody technology into a novel strategy for the treatment of erbB-2-overexpressing human cancers. In addition to elucidating the feasibility of a new paradigm for cancer gene therapy, this study also reports our findings regarding the safety profile and gene transfer efficacy associated with i.p. administration of an anti-erbB-2 sFv-encoding adenovirus.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Design of Phase I Trial.
A Phase I trial was developed to achieve the aforementioned study goals
(16)
. Eligible patients included those with recurrent
intra-abdominal ovarian or extraovarian cancer who had failed
standard debulking and chemotherapy treatment(s). Adequate organ
function and performance status were required. Tumor tissue must have
had immunohistochemical evidence of erbB-2 overexpression. Ten of the
15 study patients had their tumor samples immunohistochemically
analyzed by one of the co-authors (G. P. S.). A composite
immunoreactivity score was assigned by adding the scores based on the
proportion of immunoreactive cells and the intensity of
immunoreactivity (proportion score: 0 = no cells immunoreactive,
1 = 1 of 100 cells immunoreactive, 2 = 1 of 10 cells
immunoreactive, 3 = 1 of 3 cells immunoreactive, 4 = 2 of 3
cells immunoreactive, 5 = all cells immunoreactive; intensity
score: 0 = no cells immunoreactive, 1 = minimally
immunoreactive, 2 = weakly immunoreactive, 3 = moderately
immunoreactive, 4 = strongly immunoreactive). Tissue samples were
designated as weakly erbB-2 positive when a composite proportion and
intensity score was 4–5, moderately erbB-2 positive when a composite
proportion and intensity score was 6–7, or strongly erbB-2 positive
when a composite proportion and intensity score was 8–9. Five patients
had their tumor samples tested by commercially available tests
performed at laboratory facilities from referral institutions and were
designated as not specified.
Patients were administered a single dose of Ad21 i.p. via a Tenchkoff catheter. The dose of Ad21 was escalated in cohorts of at least three patients beginning at 1 x 109 pfu rising to 1 x 1011 pfu. Patients were monitored at specified intervals for 8 weeks after treatment for evidence of clinical toxicity using standard Phase I methodology. Serum samples were simultaneously obtained at the time of clinical evaluations; the serum samples were analyzed for evidence of hematological, biochemical, or coagulation abnormalities. Clinical efficacy was monitored by serial physical examination and computed tomography scans in all evaluable patients.
Determination of Gene Delivery.
Peritoneal aspirates of patients were obtained at specific time points
to assess for evidence of transgene expression. Following
centrifugation at 1000 rpm for 5 min, concentrated cell
pellets were obtained and stored at 80°C. Genomic DNA was isolated
from the cell pellet using a QIAamp Tissue Kit (Qiagen Inc., Valencia,
CA). Specifically, the cell pellet from spun ascites was lysed by
proteinase K (2.5 mg/ml) and incubated at 70°C for 10 min. Following
a series of washes, DNA was eluted and resuspended in 10
mM Tris-HCl and 1 mM EDTA
(pH 8.0). Six microliters of each sample were subjected to PCR analysis
with primers specific for the E4 region of the virus (forward primer:
TGTGACTGATTGAGCGGTG; reverse primer: CCCATTTAACACGCCATGCA) of the
Ad5 vector, the E1 region (forward primer: ATTACCGAAGAAATGGCCGC;
reverse primer: CCCATTTAACACGCCATGCA) of the Ad5
vector, and the anti-erbB-2 sFv gene e23
(forward primer: CATGCACTGGTATCAGCAGA; reverse primer:
CATCGAAGTACCAGTCCGTA). PCR was performed for 60 cycles at 94°C
for 30 s, 54°C for 30 s, and 72°C for 30 s.
Amplification of infected cells by these primers resulted in a fragment
of 714 bp for E4, 538 bp for e23, and 1066 bp for E1, respectively,
detected by 1% agarose gel electrophoresis, followed by staining with
ethidium bromide.
Determination of Transgene Expression.
Total RNA was also isolated from the stored cell pellets and purified
using a Qiagen RNA kit (Qiagen, Santa Clarita, CA), following the
manufacturer’s instructions. Specimens were analyzed for transgene
expression using real-time quantitative RT-PCR technology.
Oligonucleotide primers were designed as follows. The forward primer
(AAACCTTGGATTTATACCAC ATCCA), reverse primer
(GAAGAATGGTGATGGGATTTC), and 6-FAM- labeled probe
(CCTGGCTTCTGGAGTCCCTGCTCG-TAMRA) to amplify the e23 gene
were designed by the Primer Express 1.0 software (Perkin-Elmer Corp.,
Foster City, CA) following the recommendations of the manufacturer. The
forward primer (GAAGGTGAAGGTCGGAGTC), reverse primer
(GAAGATGGTGATGGGATTTC), and fluorogenic JOE-labeled probe
(CAAGCT TCCCGTTCTCAGCC) to amplify the GAPDH housekeeping
gene were derived from a control reagent kit (PE Applied Biosystems,
Foster City, CA).
In vitro transcription and purification of e23 cRNA was then performed. Specifically, pcDNA 3.0 (Invitrogen, Carlsbad, CA) containing the complete e23 cDNA was used as a template in a PCR reaction. A forward primer (CACTGCTTACTGGCTTATCG) and a reverse primer (TGATCAGCGAGCTCTAGC) was used to amplify 895 bp of the e23 cDNA fragment containing 788 bp of the complete e23 cDNA and the T7 promoter. This fragment was used as a template for an in vitro RNA transcription reaction (Ambion, Austin, TX) following the manufacturer’s instructions. The resulting cRNA was confirmed and purified from a 5% acrylamide/8 M urea gel, quantified by spectroscopy at A260, and then converted to the number of copies using the molecular weight of the e23 cRNA.
One-step RT-PCR was then performed on an ABI PRISM 7700 Sequence Detector. With an optimized concentration of primers and probe, GAPDH, the endogenous control, was amplified to generate a standard curve of a sequence using a known amount of human RNA (25, 5, 1, and 0.1 ng of total RNA). The test samples were amplified in a different set of reactions using the e23 primers and probe. Linear extrapolation of the cycle threshold values was derived using the equation to the line obtained from the e23 standard curve. These values were then divided by the relative amounts of GAPDH quantitated by linear extrapolation.
Known amounts of e23 cRNA molecules (1 x 106, 1 x 104 , 1 x 102, and 10 copies) were used to generate an absolute standard curve. The copy number of e23 mRNA was then determined by linear extrapolation of the cycle threshold values using the equation to the line obtained from the absolute e23 standard curve. These values were then divided by the relative amounts of GAPDH. The components of one-step RT-PCR were designed to result in a 25-µl final volume for each reaction: TaqMan Buffer (1X); MgCl2 (3.5 mM); 2% glycerol, dATP, dGTP, and dCTP (300 µM/each); dUTP (600 µM); forward primer (200 nM); reverse primer (200 nM); probe (200 nM); GAPDH (100 nM); Ampli Taq Gold (0.625 unit); MuLV (6.25 units); and RNase Inhibitor (5 units). All PCR reactions were performed in optical reaction tubes (Applied Biosystems, Foster City, CA) designed for the ABI PRISM 7700 Sequence Detector System. Thermal cycling conditions were subjected to 30 min at 48°C, followed by 10 min at 95°C and then 40 cycles of 15 s at 95°C and 1 min at 60°C.
Determination of Humoral Response to Vector.
An ELISA was used to determine titers of antiadenoviral antibodies in
serum samples collected from treated ovarian cancer patients.
Polystyrene 96-well plates (Costar, Fisher, Pittsburgh, PA) were coated
with 100 µl of PBS containing Ad5CMVluc at 10 ng, 30 ng, 50 ng, 100
ng, 300 ng, or 500 ng for overnight incubation at 4°C. Plates were
then blocked with 100 µl of 1% BSA (fraction 5; FisherBiotech) in 10
mM Tris, 150 mM NaCl (pH 7.5; TBS) for 1 h
at 25°C. After washing three times with TBS, ascites diluted in PBS
(1:10, 1:100, and 1:1000) were added to triplicate wells (100
µl/cell) and incubated for 2 h at room temperature. Plates were
washed three times with TBS, and alkaline phosphatase-conjugated
secondary antibodies were added and incubated overnight at 4°C. Goat
antihuman IgG (Jackson Laboratories, West Grove, PA) was used for
determining the total antiadenoviral titers. After washing three times
with TBS, substrate [3 mM p-nitrophenyl phosphate, 0.5
mM MgCl2 and 10 mM
diethanolamine (pH 9.5)] was added and color was allowed to develop at
room temperature for 
30 min. Absorbance at 405 nm was measured in a
96-well plate reader (Molecular Devices, Menlo Park, CA), and data were
analyzed by the SOFTmax software package (Emax Molecular Devices, Menlo
Park CA).
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Generally, treated patients had been initially diagnosed with advanced
stage ovarian cancer, had recurred after debulking surgery and after a
number of conventional chemotherapy regimens (including paclitaxel and
cisplatinum/carboplatinum). The majority of patients had disease
measuring in excess of 2 cm at the time of Ad21 treatment.
|
. Due to limitations in Ad21 vector availability, the last two patients
accrued to the study were treated at the third cohort dose level.
|
. Treatment-specific grade 1/2 fever was experienced by 9 of 15
(60%) treated patients. Fever symptoms were transient, lasting <48 h,
and were easily ameliorated by antipyretics. Various other grade 1/2
constitutional symptoms, pain, and gastrointestinal symptoms were also
experienced but were, likewise, transient and easily ameliorated. Most
of these latter symptoms could not be directly attributed to Ad21
treatment, and, in many instances, were thought to be disease related.
One patient with a history of deep vein thrombosis and an indwelling
catheter developed thrombosis of the subclavian vein; she responded to
appropriate anticoagulation therapy. Another patient developed grade 3
dyspnea 6–7 weeks after treatment due to progression in her disease
status; evaluation demonstrated a large left pleural effusion, and the
patient responded well to thoracentesis. No dose-limiting
vector-related clinical toxicity was experienced. Three patients
experienced Teckhoff catheter-associated infections.
|
Clinical Activity.
Of 13 patients evaluable for response, 5 (38%) had stable disease and
8 (61%) had evidence of progressive disease. One patient with
nonmeasurable disease normalized her CA125 at the 8-week evaluation
point; although she remained without clinical evidence of disease, her
CA125 subsequently rose 1 month later and she was treated with
additional chemotherapy. Another patient with nonmeasurable disease
remained without clinical evidence of disease progression for 6 months
after treatment. To date, eight patients have died subsequent to the
evaluation period due to progressive disease.
Corroborative Laboratory Results.
PCR analysis of evaluable ascites samples, as shown in Fig. 1
and Table 4
, demonstrates the presence of adenoviral vector and expression of the
anti-erbB-2 sFv-encoding gene in most patients 2 days after i.p.
administration and in many patients up to 56 days after treatment.
Specifically, PCR analysis of peritoneal aspirates demonstrated the
presence of Ad21 in 84.6%, 84.6%, and 61.6% of evaluable specimens
at days 2, 14, and 56 after treatment, respectively. In addition, these
analyses demonstrated no evidence suggesting the generation of
wild-type virus.
|
|
, demonstrated expression of the anti-erbB-2 sFv-encoding gene in 10 of
14 evaluable patients at day 2. In most patients gene expression peaked
at day 2 and abated by day 56. An increase in transgene expression
seemed to occur when the dosage of Ad21 exceeded 1.0 x
1010 pfu.
|
. No hypersensitivity reactions were noted.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
A key goal of this study was to determine the use of adenoviral vectors for gene therapy application in the context of carcinoma of the ovary. In this regard, we were able to convincingly demonstrate vector-mediated transfer and expression within cellular material derived from treated patients. Two findings in these studies indicated that this had been achieved; first, a clear dose-response relationship was noted with respect to administered Ad21 and detected transgene levels. Second, the temporal pattern of gene expression was consistent with that predicated by our preclinical studies in human-derived material (10) . These important observations, thus, establish the basic use of adenoviral vectors in this delivery context. Our preclinical studies strongly correlated the level of anti-erbB-2 protein expression with antitumor effect in both established and primary ovarian cancer cell lines (14) . However, access to the antibody used in these preclinical studies was not available for analyzing the clinical specimens obtained from patients in the current study. For our future trials, we have incorporated a myc tag into the transgene expression cassette that would facilitate determination of its expression levels by immunohistochemistry and flow cytometry.
On the other hand, assay-related limitations in the current study precluded determining the efficiency with which gene transfer had occurred. Furthermore, the precise distribution of gene transfer to tumor versus nontumor elements of ascites cellular components was not delineated in this limited study. Such assay limits have restricted the derivation of this key information in many human gene therapy trials endeavored heretofore. To address this issue, we have developed a novel means of processing peritoneal aspirates, which we intend to incorporate into future trials, allowing to isolate primary ovarian cancer cells by affinity purification. To this end, magnetic beads coated with an antibody that specifically recognizes the pancarcinomatous antigen TAG-72 is added to the unfractionated cell suspension. To isolate the immunocomplex formed by the antibody and the TAG-72-expressing tumor cells, the magnetic beads are captured with a magnetic particle concentrator. Thus, we are now able to evaluate the effect of our molecular interventions in a better-defined and more relevant cellular substrate.
In addition, we have endeavored to create a noninvasive, gene-based imaging system, which is being configured in the next generation of trials (28) . This system allows for expression of a receptor-encoding gene construct in addition to a therapeutic gene construct in transduced cells. Thus, transduced tumor implants as well as other transduced nontumor tissues would be amenable to nuclear imaging using commercially approved radiolabeled peptides that would bind to the encoded receptor localized on the cell surface. It is anticipated that such systems will be of fundamental importance to gaining vector efficiency and specificity information in the context of human trials and to correlating gene transfer with clinical outcome.
The documentation of in vivo gene transfer establishes a key feasibility with respect to realizing gene therapy for carcinoma of the ovary. In this regard, basic vector inefficiencies have been recognized to be a fundamental limit in a variety of other cancer gene therapy contexts (29) . A key consideration with respect to the use of the adenoviral vector for in situ gene transfer is the level of the adenoviral receptor CAR on target human cells. Our recent studies have established that ovarian cancer cells are profoundly deficient in this receptor in vitro and exhibit a relative resistance to adenoviral vectors on this basis; tumors derived from patients are similarly minimally CAR immunoreactive (30) . Although we did not specifically analyze peritoneal cellular samples derived from patients in the current trial for CAR expression, this aspect of ovarian cancer pathobiology clearly represents a valid limit to realizing the full potential of any current adenoviral-mediated gene therapy approach and future trials using unmodified adenoviral vector systems should incorporate studies of tumor CAR expression. To further address this issue, we have designed an advanced generation of adenoviral vectors, which are genetically modified to accomplish CAR-independent gene transfer (31) . Such vectors exhibit substantially enhanced infection efficiencies for ovarian cancer tumor targets. Clearly, inclusion of these vector design improvements would be predicated to enhance to adenoviral-mediated gene transfer in future trials.
As noted, none of the patients treated in this study exhibited a dramatic clinical benefit. This finding was not unexpected and reflects, in part, the basic gene delivery shortcomings inherent in a Phase I study. Furthermore, in this regard, mutation compensation strategies require gene transfer into a large proportion of target tumor cells. Thus, our anti-erbB-2 intrabody approach, in its present design, would be expected to exhibit effects exclusively in vector-infected tumor cells. The recognition of this requirement for near-quantitative modification of tumor cells has led to the exploration of genetic interventions whereby antitumor effects may be gained over-and-above those achieved directly via tumor cell modification. In this regard, strategies designed to achieve such "bystander effects" offer a theoretical means to circumvent such requirements for extremely high tumor cell transduction (32, 33, 34) . To this end, we have sought to modify the intrabody approach toward the goal of achieving such a bystander effect. Specifically, the anti-erbB-2 sFv has been engineered to render it a secreted protein subsequent to biosynthesis. We have shown that such secreted sFvs can achieve direct antitumor effects highly analogous to anti-erbB-2 monoclonal antibodies. On this basis, in situ tumor transduction allows secretion of the anti-erbB-2 sFv with the achievement of high local concentrations of this potent antitumor agent. Such an approach combines the recognized efficiency of an anti-erbB-2 monoclonal antibody-based approach with the delivery advantages attributed to gene-based methods. Thus, our aforementioned findings defining the clinical feasibility of intrabody-based gene knockout might soon be extended by these ongoing efforts to fully realize the clinical use of genetically abrogating the erbB-2 oncogene and other tumor relevant targets. Additional Phase I and Phase II trials in development will further clarify the potential efficacy of this intrabody approach in patients with erbB-2-overexpressing ovarian cancer.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by NIH Grants 1R21CA69343-02,
R01CA68245, and R01CA72532; and the Cancer Treatment Research
Foundation. 
2 To whom requests for reprints should be
addressed, at Room 538 OHB, 618 South 20th Street, Birmingham, AL
35233-7333. Phone: (205) 934-4986; Fax: (205) 975-6174; E-mail: rdalvarez{at}aol.com
3 The abbreviations used are: sFv, single-chain
antibody; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-PCR,
reverse transcription-PCR; TBS, Tris-buffered saline; CAR, coxsackie
and adenoviral receptor; pfu, plaque-forming unit.
4 RAC Protocol List, http:
//www.nih.gov/od/oba/protocol.pdf.
Received 2/23/00; revised 4/17/00; accepted 5/ 4/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  J. A. McLear, D. Lebrecht, A. Messer, and W. J. Wolfgang Combinational approach of intrabody with enhanced Hsp70 expression addresses multiple pathologies in a fly model of Huntington's disease FASEB J, June 1, 2008; 22(6): 2003 - 2011. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jiang, W. Shi, Q. Zhang, X. Wang, M. Guo, Z. Cui, C. Su, Q. Yang, Y. Li, J. Sham, et al. Gene Therapy Using Adenovirus-Mediated Full-length Anti-HER-2 Antibody for HER-2 Overexpression Cancers. Clin. Cancer Res., October 15, 2006; 12(20): 6179 - 6185. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Paz, L. A. Brennan, M. Iacolina, J. Doody, Y. R. Hadari, and Z. Zhu Human single-domain neutralizing intrabodies directed against Etk kinase: a novel approach to impair cellular transformation Mol. Cancer Ther., November 1, 2005; 4(11): 1801 - 1809. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. J. Wolfgang, T. W. Miller, J. M. Webster, J. S. Huston, L. M. Thompson, J. L. Marsh, and A. Messer Suppression of Huntington's disease pathology in Drosophila by human single-chain Fv antibodies PNAS, August 9, 2005; 102(32): 11563 - 11568. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Sako, J. Kitayama, H. Koyama, H. Ueno, H. Uchida, H. Hamada, and H. Nagawa Transduction of Soluble Flt-1 Gene to Peritoneal Mesothelial Cells Can Effectively Suppress Peritoneal Metastasis of Gastric Cancer Cancer Res., May 15, 2004; 64(10): 3624 - 3628. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Sangro, G. Mazzolini, J. Ruiz, M. Herraiz, J. Quiroga, I. Herrero, A. Benito, J. Larrache, J. Pueyo, J. C. Subtil, et al. Phase I Trial of Intratumoral Injection of an Adenovirus Encoding Interleukin-12 for Advanced Digestive Tumors J. Clin. Oncol., April 15, 2004; 22(8): 1389 - 1397. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Barzon, M. Boscaro, and G. Palu Endocrine Aspects of Cancer Gene Therapy Endocr. Rev., February 1, 2004; 25(1): 1 - 44. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Korst and R. G. Crystal Active, specific immunotherapy for lung cancer: hurdles and strategies using genetic modification Ann. Thorac. Surg., October 1, 2003; 76(4): 1319 - 1326. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Artsaenko, K. Tessmann, M. Sack, D. Haussinger, and T. Heintges Abrogation of hepatitis C virus NS3 helicase enzymatic activity by recombinant human antibodies J. Gen. Virol., September 1, 2003; 84(9): 2323 - 2332. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Indraccolo, W. Habeler, V. Tisato, L. Stievano, E. Piovan, V. Tosello, G. Esposito, R. Wagner, K. Uberla, L. Chieco-Bianchi, et al. Gene Transfer in Ovarian Cancer Cells: A Comparison between Retroviral and Lentiviral Vectors Cancer Res., November 1, 2002; 62(21): 6099 - 6107. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Canevari, S. Biocca, and M. Figini Re: Blocking Oncogenic Ras Signaling for Cancer Therapy J Natl Cancer Inst, July 3, 2002; 94(13): 1031 - 1032. [Full Text] [PDF]
|
|
|
|
|
|
A. Hemminki, K. R. Zinn, B. Liu, T. R. Chaudhuri, R. A. Desmond, B. E. Rogers, M. N. Barnes, R. D. Alvarez, and D. T. Curiel In Vivo Molecular Chemotherapy and Noninvasive Imaging With an Infectivity-Enhanced Adenovirus J Natl Cancer Inst, May 15, 2002; 94(10): 741 - 749. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kanerva, G. V. Mikheeva, V. Krasnykh, C. J. Coolidge, J. T. Lam, P. J. Mahasreshti, S. D. Barker, M. Straughn, M. N. Barnes, R. D. Alvarez, et al. Targeting Adenovirus to the Serotype 3 Receptor Increases Gene Transfer Efficiency to Ovarian Cancer Cells Clin. Cancer Res., January 1, 2002; 8(1): 275 - 280. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Mahasreshti, J. G. Navarro, M. Kataram, M. H. Wang, D. Carey, G. P. Siegal, M. N. Barnes, D. M. Nettelbeck, R. D. Alvarez, A. Hemminki, et al. Adenovirus-mediated Soluble FLT-1 Gene Therapy for Ovarian Carcinoma Clin. Cancer Res., July 1, 2001; 7(7): 2057 - 2066. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
